Application of reagents for inhibiting EhAQP1, EhPTP2 and EhMetAP2 gene expression in the preparation of drugs for preventing and / or treating shrimp hepatoenterocystis disease

Abstract

The present invention provides the use of an agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes in the preparation of a medicament for preventing and / or treating shrimp hepatoenteric cytosis, specifically belonging to the field of shrimp farming technology. The present invention provides the use of an agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes in the preparation of a medicament for preventing and / or treating shrimp hepatoenteric cytosis. By inhibiting the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes, the number of shrimp hepatoenteric cytosis spores can be reduced, thereby preventing and treating shrimp hepatoenteric cytosis.

Description

Technical Field

[0001] The invention belongs to the technical field of shrimp farming, and particularly relates to the use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a medicine for preventing and / or treating shrimp hepatoenterocytosis. Background Art

[0002] Ecytonucleospora hepatopenaei (EHP) is a typical obligate intracellular parasite, a single-celled eukaryotic organism that primarily infects the hepatic tubular epithelial cells of the shrimp's hepatopancreas. It exploits nutrients from the shrimp to maintain its own energy metabolism and growth and reproduction, causing immune and metabolic disorders in the shrimp, ultimately leading to slow growth and a significant decline in aquaculture yields. Hepatopancreatic microsporidiosis (HPM), also known as shrimp hepatopancreatic cystitis, caused by this pathogen, has become a major pathogen threatening the shrimp aquaculture industry in recent years. Currently, there is no effective treatment for EHP infection. Reducing the risk of infection during aquaculture primarily involves strengthening seed quarantine and managing aquaculture inputs and the environment. Since shrimp are invertebrates and lack a specific immune system, the development of conventional vaccines is lacking theoretical support. Therefore, the prevention and control of EHP in shrimp aquaculture is extremely challenging. EHP has the ability to spread vertically and horizontally, and its dormant spores can withstand harsh environmental conditions and infect farmed shrimp again when the time is right. Therefore, it is difficult to completely eliminate it from the farming system during the breeding process. The development of EHP prevention and control products is imperative and of great significance to the development of the industry. Summary of the Invention

[0003] The present invention aims to provide a reagent for inhibiting the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes for use in the preparation of a medicament for preventing and / or treating shrimp hepatoenteric cytosis. By inhibiting the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes, the number of shrimp hepatoenteric cytosis spores can be reduced, thereby preventing and treating shrimp hepatoenteric cytosis.

[0004] The present invention provides use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in preparing a medicine for preventing and / or treating shrimp hepatoenteric cytosis.

[0005] The present invention also provides the use of an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in the preparation of a medicine for reducing the number of shrimp hepatocystis spores.

[0006] Preferably, the agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes includes an agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes in shrimp hepatocellular carcinoma.

[0007] Preferably, the shrimp comprises prawns; and the prawns comprise Penaeus vannamei.

[0008] Preferably, the agent for inhibiting the expression of EhAQP1, EhPTP2 and EhMetAP2 genes comprises an RNAi agent.

[0009] Preferably, the RNAi agent comprises siRNA; the siRNA comprises siRNA interfering with the expression of EhAQP1, siRNA interfering with the expression of EhPTP2 and siRNA interfering with the expression of EhMetAP2.

[0010] Preferably, the siRNA that interferes with the expression of EhAQP1 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.2; the siRNA that interferes with the expression of EhPTP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.4; the siRNA that interferes with the expression of EhMetAP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0011] The present invention also provides an siRNA for preventing and / or treating shrimp hepatoenteric cytosis, wherein the siRNA includes an siRNA interfering with the expression of EhAQP1, an siRNA interfering with the expression of EhPTP2, and an siRNA interfering with the expression of EhMetAP2.

[0012] Preferably, the siRNA that interferes with the expression of EhAQP1 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.1 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.2; the siRNA that interferes with the expression of EhPTP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.3 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.4; the siRNA that interferes with the expression of EhMetAP2 includes a sense chain primer with a nucleotide sequence as shown in SEQ ID NO.5 and an antisense chain primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0013] Preferably, the shrimp comprises prawns; and the prawns comprise Penaeus vannamei.

[0014] The present invention provides the use of an agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes in the preparation of a medicament for preventing and / or treating shrimp hepatoenteric cystitis. By inhibiting the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes, the number of shrimp hepatoenteric cystitis spores can be reduced, thereby preventing and treating shrimp hepatoenteric cystitis. Experimental results demonstrate that the present invention uses RNA interference to silence the EhAQP1, EhPTP2, and EhMetAP2 genes in shrimp hepatoenteric cystitis, reducing spore loads over different time periods and preventing and treating shrimp hepatoenteric cystitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 This is a graph showing the verification results of the EhAQP1, EhPTP2, and EhMetAP2 expression levels provided by the present invention;

[0017] Figure 2 The spore counting result diagram provided by the present invention;

[0018] Figure 3 This is a graph showing the absolute quantitative results of spores provided by the present invention. DETAILED DESCRIPTION

[0019] The present invention provides the use of an agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes in the preparation of a medicament for preventing and / or treating shrimp hepatoenteric cytosis. In a specific embodiment, the agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes includes an agent that inhibits the expression of the shrimp hepatoenteric cytosis genes EhAQP1, EhPTP2, and EhMetAP2 in shrimp. In a specific embodiment, the shrimp includes prawns; the prawns include Penaeus vannamei. The present invention discovered the virulence genes EhAQP1, EhPTP2, and EhMetAP2 that play a role in EHP infection. EHP spores were isolated and purified from infected shrimp, and whole-genome sequencing was performed, successfully annotating EhAQP1, EhPTP2, and EhMetAP2 in the EHP genome. By inhibiting the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes, shrimp hepatoenteric cytosis can be prevented and treated.

[0020] The nucleotide sequence of EhAQP1 is shown in SEQ ID NO.7: ATGCAAGTCAGTAAAAAATTAATAGCACAGAGAGTCTTTGCTGAATTTTTATGCTCATGTATTTTTGGGTTTGCTGTCTACTCTGCCATTTTAAACACTAAATCTGAAGAAGTTTCTGTTTCAGGCACTACTGTTGGACTTACCGTTGGTTTTTCTGGGATAGCCCTCATATATACCTTTGCAGACCACTCGGTTGCACATTTCAACCCTGCCATTACCATTTCCACCATTTTGACAGGTAAAATAGAAATAGCCATGGGCATTTGCTATGTATGTGCACAGCTGATAGGATTTTTGGTTGCTAGTCTTTTGGTGGTTGTTTGCTTTCCTTACGGGTATTCTGAGACACTTGAGCTTATTACGCCTGCTAAAGTTACAGAGGATTTGTCGACAACAAGTTTGTTTTTTACTGAATTTATTTTAAGCTTCATTTTGGTGTTTGTTGCGTTTGAGGTTGGAATTAACGCTGTTAGAGAGCCTGGGGTTACTTTGTTTATTGGCGAACCACAAAAAGACAGGTCAATATTGGCACCTCTTACCATAGGATTGACTTTAGGCTTTTTAGGATTTTTGGCTTCAACCACATCCGGTGGTGCTTTCAACCCTGGAATAGTATTTGGACCTGCTATTTTAGGGTCTAATTATAGTGATTTTTGGGTTTACATTGTAAGTGAGTTATCAGGGGGTCTTTTAGGTGCATTAGTTCAAGTATTTTTGTTGTTTAAATAA。

[0021] The nucleotide sequence of EhPTP2 is shown in SEQ ID NO.8: ATGAGTCTTTATAATGCACTGGTGCTATTAACTACTATAAAAGCAGGAACAGTAAACATGCCTTTGCCTGGACAAGGACAAAACAATGCGCAACAAGATCCAATTGCAAGACACATTCAGGACATGAAGGTGGAAACAGAAGAAGCAAAAAGAAGGGCTGCAGCAGAATGCCAGCAGAGCCTCATAGAGAAAAACGTACAGGTAGATGGTGCACAACAAAAAGTAGATCCTTCTGAGTTTACTGCGTGTGTTGAAGCAAAAAAGAAGAAATTATTCCAGTTGTCAAAGTCAATCAATTCACTCATTAAAAATGAAATGTCAAAGCCAATTCAAAAGCCATGCGTGGTCAAATTAAACCAGGCAACCAAAAACTGCTACACAAAGGCAGCACTCAAGGAATGGCTCAAGGGTTCAAAATACAGTTTGGATGTGTTTAAGAACGTAGTTGAAATATGGAACACAGAAAAAGAAAAGTTGATAGCAATGATTGTTCATGAAACACCAAAGTACGAGTTAATTTTACCACCAAAAGTATGCAAGTCTTTCTTTAAAAGACCTTCATATAAGATGGACGTAAACAGGGCAGGAGATATGATCAATTCACAGGGTAAGCCTAACGAAAAGAAGGACATTGCAAAGGATTGCAGGCCATGCAGCGACTTTGCTAACACCACAGAAGGTGCATTTGCAGAGTGCAAGAACACATGCGATCCAATGTCTATGATTGTCAATGTTAGCGATAGCATCCACACAGTACACAGGCCAACCACCTTACCATCTGGTAAAGATGACCATAAAAAGCCAACTCCATCTGAAAGTGAAATAAACAATGAAACATTAACATCCAACGAATAA。

[0022]

[0023] The present invention also provides the use of an agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes in the preparation of a drug for reducing the number of shrimp hepatocystis spores. By inhibiting the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes, the number of shrimp hepatocystis spores can be reduced. In a specific embodiment, the agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes includes an agent that inhibits the expression of the shrimp hepatocystis EhAQP1, EhPTP2, and EhMetAP2 genes in shrimp. In a specific embodiment, the shrimp includes prawns, and the prawns include Penaeus vannamei.

[0024] In a specific embodiment, the agent that inhibits the expression of the EhAQP1, EhPTP2, and EhMetAP2 genes comprises an RNAi agent. In a specific embodiment, the RNAi agent comprises siRNA; the siRNA comprises siRNA that interferes with the expression of EhAQP1, siRNA that interferes with the expression of EhPTP2, and siRNA that interferes with the expression of EhMetAP2. In a specific embodiment, the siRNA that interferes with the expression of EhAQP1 comprises a sense strand primer having a nucleotide sequence as set forth in SEQ ID NO.1 and an antisense strand primer having a nucleotide sequence as set forth in SEQ ID NO.2; the siRNA that interferes with the expression of EhPTP2 comprises a sense strand primer having a nucleotide sequence as set forth in SEQ ID NO.3 and an antisense strand primer having a nucleotide sequence as set forth in SEQ ID NO.4; and the siRNA that interferes with the expression of EhMetAP2 comprises a sense strand primer having a nucleotide sequence as set forth in SEQ ID NO.5 and an antisense strand primer having a nucleotide sequence as set forth in SEQ ID NO.6.

[0025] The present invention also provides siRNA for preventing and / or treating shrimp hepatoenteric cytosis, including siRNAs that interfere with the expression of EhAQP1, EhPTP2, and EhMetAP2. Experimental results show that by injecting siRNAs, the present invention interferes with EHP infection and physiological activity, reducing the expression of the interfering genes (EhAQP1, EhPTP2, and EhMetAP2) and spore load in shrimp previously severely infected with EHP over a specific time period, thereby preventing and treating shrimp hepatoenteric cytosis. In a specific embodiment, the siRNA that interferes with EhAQP1 expression includes a sense primer with a nucleotide sequence as shown in SEQ ID NO. 1 and an antisense primer with a nucleotide sequence as shown in SEQ ID NO. 2; the siRNA that interferes with EhPTP2 expression includes a sense primer with a nucleotide sequence as shown in SEQ ID NO. 3 and an antisense primer with a nucleotide sequence as shown in SEQ ID NO. 4; and the siRNA that interferes with EhMetAP2 expression includes a sense primer with a nucleotide sequence as shown in SEQ ID NO. 5 and an antisense primer with a nucleotide sequence as shown in SEQ ID NO. 6. In a specific embodiment, the shrimp includes prawns, and the prawns include Penaeus vannamei.

[0026] To further illustrate the present invention, the use of the reagent for inhibiting the expression of EhAQP1, EhPTP2, and EhMetAP2 genes provided by the present invention in the preparation of a medicament for preventing and / or treating shrimp hepatoenteric cytosis is described in detail below with reference to the accompanying drawings and examples. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1

[0028] Experimental subjects: Severely EHP-infected whiteleg shrimp (Penaeus vannamei) were obtained from the Lüsi Base of the Jiangsu Institute of Marine Fisheries. Severely EHP-infected whiteleg shrimp (n = 180), with an average body weight of 3.2 ± 1.8 g, were cultured in glass tanks with constant aeration at an ambient temperature of 28 ± 2°C for 24 h.

[0029] SiRNA synthesis: Sangon Bioengineering (Shanghai) Co., Ltd. The synthesized siRNA oligo was dried by centrifugation under reduced pressure, leaving the product at the bottom of the tube as a dry powder. It was dissolved in DEPC water and prepared into a 20 μM sample for subsequent experiments.

[0030] The sequences of the synthesized siRNA oligos are listed in Table 1.

[0031] Table 1 Sequence information

[0032] Gene name Sequence (5′→3′) EhAQP1-siRNA Sense chain: CCAUUACCAUUUCCACCAUTT (SEQ ID NO. 1) Antisense strand: AUGGUGGAAAUGGUAAUGGTT (SEQ ID NO. 2) EhPTP2-siRNA Sense chain: GCACUGGUGCUAUUAACUATT (SEQ ID NO. 3) Antisense strand: UAGUUAAUAGCACCAGUGCTT (SEQ ID NO. 4) EhMetAP2-siRNA Sense chain: GGGACUCACAGCAAUGGAATT (SEQ ID NO. 5) Antisense strand: UUCCAUUGCUGUGAGUCCCTT (SEQ ID NO. 6) NC-siRNA Sense chain: UUCUCCGAACGUGUCACGUTT (SEQ ID NO. 10) Antisense strand: ACGUGACACGUUCGGAGAATT (SEQ ID NO. 11)

[0033] Each siRNA was injected at a dose of 2 μg per gram (2 μg / g) into the tail muscle of shrimp severely infected with EHP. Hepatopancreas of six shrimp were randomly sampled before injection as the 0-hour sample. Samples were collected from three experimental groups and a control group (EhAQP1-siRNA, EhPTP2-siRNA, and EhMetAP2-siRNA as experimental groups; NC-siRNA as a control group) at 12, 24, 48, and 72 hours after injection. Hepatopancreas of six shrimp were sampled at each node in each group.

[0034] RNA and DNA extraction: The samples taken at each time point in each group were ground into homogenate using a biological tissue nucleic acid extraction grinder (speed 6.0 m / sec, time 35 s). The obtained homogenate portion was used for RNA extraction, and the rest was reserved for subsequent spore counting. According to the kit instructions, the total RNA of the hepatopancreas was extracted using the RNAEasyFast Animal Tissue / Cell Total RNA Extraction Kit (TIANGEN, DP451). The total DNA of the hepatopancreas was extracted using the Marine Animal Tissue DNA Extraction Kit (TIANGEN, DP324). The concentration and purity of the extracted RNA and DNA were evaluated by Nanodrop2000 (Thermo Fisher, USA), and their integrity was verified by 1.0% agarose gel electrophoresis. The extracted RNA and DNA were stored at -80°C.

[0035] qPCR was used to verify the expression of the interference gene, with β-tublin as the internal reference gene.

[0036] cDNA templates were synthesized using a reverse transcription kit (TIANGEN, KR118) with β-tubulin as the internal reference gene. Three biological replicates and three technical replicates were performed for each validated gene. PCR was performed in a 20 μL reaction system containing 10 μL SYBR Green, 2 μL (10 μmol / L) primers, 2 μL cDNA template, and 6 μL DEPC-treated water (negative control). The PCR program was 95°C for 3 min, followed by 40 cycles of 95°C for 10 s and 60°C for 45 s. 2 -ΔΔCt Methods The fold change of gene expression relative to the control group was calculated and the results were expressed as mean ± standard deviation (SD). The fold difference of each target was obtained from three independent biological replicates.

[0037] Verification of EhAQP1, EhPTP2, and EhMetAP2 expression levels ( Figure 1 ).

[0038] The results of EhAQP1 interference showed that the siRNA-EhAQP1 group showed a significant gene downregulation trend between 12h and 72h ( Figure 1A in the figure shows that there was a significant difference at 12h compared with the control group (siRNA-NC) (p<0.05). In particular, the expression level of EhAQP1 reached its lowest point at 24h, while there was no significant expression change in the control group as a whole. The siRNA-EhPTP2 group ( Figure 1 B) showed significant downregulation of expression at 24h (p<0.01), and the interference effect was most obvious at this time point compared with the control group. However, at 48h and 72h, the expression of the EhPTP2 gene seemed to gradually recover. Figure 1 C), EhMetAP2 gene expression in the interference group showed a downward trend from 24h to 72h, and significant downregulation was observed at 24h and 72h, respectively (p<0.05 and p<0.001).

[0039] Spore counts were performed under a light microscope (hemocytometer), and spores were absolutely quantified by qPCR.

[0040] Take a sample from each group and dilute it 100-fold with ultrapure water. Take 6 μL of the diluted homogenate suspension and place it on a clean glass slide. Then, take 2 μL of fluorescent dye and 2 μL of 10% KOH and mix them with the homogenate suspension on the slide. Allow the mixture to stain for 3 minutes. Finally, place a total volume of 10 μL of the mixed solution on a clean hemocytometer and observe and count under a fluorescence microscope. Repeat the count three times and calculate the average to ensure accuracy.

[0041] Spore count results ( Figure 2 ).

[0042] The number of spores in the three interference groups showed different degrees of reduction. In the EhAQP1 and EhMetAP2 interference groups, the number of spores showed a downward trend, with significant decreases at 72h and 48h, respectively ( Figure 2 A in Figure 2 C). The EhPTP2 interference group showed no overall downward trend, but the number of spores at 48 h was significantly lower than that of the control group ( Figure 2 B) in.

[0043] Real-time quantitative PCR was used to analyze the quantification of EHP spores. The reaction mixture contained 2 μL of extracted DNA, 2× TaqMan FastAdvanced MasterMix, 10 μM of each specific primer, and 0.1 μM of TaqMan probe. Three biological replicates and three technical replicates were performed. Reactions were performed under PCR conditions consisting of 95°C for 20 seconds, followed by 50 cycles of 95°C for 1 second and 60°C for 20 seconds.

[0044] Table 2 Primer information

[0045] Primer name Sequence (5′→3′) β-tubulin-F GAAAGAAGTAGACGAGCAGATG(SEQ ID NO.12) β-tubulin-R TTGTGTTGCCTATGAATGTAGC(SEQ ID NO.13) SSUrRNA-F GGTGGTGTTAAAAGCCATTGAGTTT(SEQ ID NO.14) SSUrRNA-R CCCACCTATACCATGCCTCCTAT(SEQ ID NO.15) EhAQP1-qF GACAGGTCAATATTGGCAC(SEQ ID NO.16) EhAQP1-qR CCCTAAAATAGCAGGTCCA(SEQ ID NO.17) EhPTP2-qF CTCAAGGAATGGCTCAAGGGT(SEQ ID NO.18) EhPTP2-qR CCTGCCCTGTTTACGTCCAT(SEQ ID NO.19) EhMetAP2-qF TGCATTTGAAACAACCAGGC(SEQ ID NO.20) EhMetAP2-qR CTTACGCTGCAACTCTCTGT(SEQ ID NO.21)

[0046] The TaqMan probe 5′-CCGTTCCGCTACTC-3′ (SEQ ID NO. 22) was labeled with the fluorescent dye 6-FAM at the 5′ end and MGB at the 3′ end. The probe was designed based on the SSU rRNA gene of EHP and was used for absolute quantification of EHP spores.

[0047] Absolute quantification of spores ( Figure 3 )

[0048] In the EhAQP1 interference group, the copy number of EHP was lower than that of the control group from 12h to 72h, with significant differences observed at 12h and 48h, and very significant differences at 72h ( Figure 3 In the EhPTP2 interference group, a significant decrease was observed only at 48 h, while the spore count increased dramatically at 72 h compared with the control group ( Figure 3 For the EhMetAP2 interference group, intra-group comparison showed a continuous downward trend in EHP copy number; however, compared with the control group, a significant decrease was only observed at 48 h ( Figure 3 C).

[0049] The present invention conducted an in-depth analysis of transcriptome data from 1 to 14 days of the EHP repertoire experiment in healthy shrimp and found that the infection period of EHP is about 6 days, with germination mainly occurring in 1 to 2 days and proliferation mainly occurring in 3 to 4 days. In the experiment of the present invention, EhAQP1 and EhPTP2 mainly play a role in the germination and invasion stages of the early infection. Interference with EhAQP1 will significantly reduce the spore load in the early stage. EhMetAP2 plays a key role in the subsequent proliferation stage. After interfering with EhMetAP2, the spore load will continue to decline in the later stage. Interference with different genes will reduce the spore load at different time periods.

[0050] In summary, the present invention silenced EhAQP1, EhPTP2, and EhMetAP2 in EHP-infected shrimp by intramuscular injection of siRNA. It was found that siRNA interference exhibited varying inhibitory effects on different genes, with this effect being time-dependent, likely due to the target gene being interfered with. For EhAQP1, interference was most effective in the early stages (12 to 24 hours), while for EhPTP2, it was most effective at 48 hours. The effect of EhMetAP2 interference was more pronounced at 48 and 72 hours. In summary, silencing the EhAQP1, EhPTP2, and EhMetAP2 genes all resulted in varying degrees of reduction in spore load.

[0051] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Inhibition EhAQP1 Use of a gene expression reagent in the preparation of a drug for preventing and / or treating shrimp hepatoenterocystis disease; The inhibition EhAQP1 The reagent for gene expression is an RNAi reagent; the RNAi reagent is siRNA; the siRNA is an interference EhAQP1 expressed siRNA; said interference EhAQP1 The expressed siRNA is a sense strand having a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The shrimp includes prawns; the prawns include whiteleg shrimp.

3. An siRNA for preventing and / or treating shrimp hepatoenteric cytosis, characterized in that: The siRNA is an interference EhAQP1 expressed siRNA; said interference EhAQP1 The expressed siRNA is a sense strand having a nucleotide sequence as shown in SEQ ID NO.1 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO.

2.

4. The siRNA according to claim 3, wherein The shrimps include prawns; and the prawns include whiteleg shrimp.

Images