A nanobody, a nucleotide molecule, an expression plasmid, a host cell, and methods of making and uses thereof
By designing nanobodies with specific amino acid sequences and expressing them in host cells, high-affinity B7-H3 nanobodies were prepared, solving the problems of insufficient affinity and immune risk, and achieving better tumor treatment effects.
Patent Information
- Application Number
- CN202411893590.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-12-20
AI Technical Summary
Existing B7-H3 nanobodies have insufficient affinity for B7-H3, resulting in limited therapeutic effects and posing immune risks due to heterogeneity.
A novel nanobody containing specific complementarity-determining regions and framework amino acid sequences was designed, and a high-affinity B7-H3 nanobody was prepared by expressing and purifying it in host cells using an expression plasmid.
The affinity of B7-H3 nanobodies was improved, the immune risks caused by heterogeneity were reduced, making them easier to penetrate the blood-brain barrier and enhancing the therapeutic effect on the inside of tumors.
Smart Images

Figure CN119661717B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of nanobodies, and particularly relates to a nanobody, a nucleotide molecule, an expression plasmid, a host cell, and a preparation method and use thereof. BACKGROUND
[0002] Small cell lung cancer (SCLC) is a kind of malignant epithelial tumor composed of small cells, the cytoplasm of tumor cells is rare, the cell boundary is not clear, the nuclear chromatin is fine granular, and the nucleolus is not obvious or not obvious, the cells are round, oval or fusiform, the nuclear notch is obvious, and the necrosis is typical and extensive, and the nuclear division count is high.
[0003] B7-H3 is a type I transmembrane protein, which belongs to the B7 immune co-stimulation and co-inhibition family members. B7-H3 is not expressed in monocytes and granulocytes and normal tissues of human body. In recent years, it is found that B7-H3 is expressed on some dendritic cells, T cells, natural killer (NK) cells and B cells, so B7-H3 can be used as an immune checkpoint. The target point can not only promote the immune escape of tumor cells by inhibiting the immune system, but also can mediate the metastasis, drug resistance and angiogenesis of tumor through some non-immune pathways to promote the progression of cancer. Studies have found that B7-H3 is abnormally expressed in a large amount in non-small cell lung cancer, pancreatic cancer, primary liver cancer, colorectal cancer, breast cancer, prostate cancer, laryngeal cancer, melanoma and other tumor tissues, and is also expressed on the surface of stromal cells, fibroblasts and epithelial cells in the tumor microenvironment (TME). The excessive expression of B7-H3 in tumor tissues is often accompanied by poor prognosis, shorter overall survival and progression-free survival of patients.
[0004] Patent CN110642948B discloses a B7-H3 nanobody, a preparation method and use thereof, and specifically discloses that the B7-H3 nanobody is expected to be used as a therapeutic antibody for the treatment of various malignant tumors with high expression of B7-H3 molecules, but the affinity of the B7-H3 nanobody to B7-H3 is poor and needs to be further improved. SUMMARY
[0005] The present application aims to provide a nanobody, a nucleotide molecule, an expression plasmid, a host cell, and a preparation method and use thereof.
[0006] The present application provides a nanobody, which comprises a complementarity determining region (CDR) and a framework region (FR), wherein the complementarity determining region is separated by the framework region;
[0007] The complementarity determining region comprises CDR1, CDR2 and CDR3;
[0008] The framework region comprises FR1, FR2, FR3 and FR4;
[0009] The amino acid sequence of the CDR1 is shown as SEQ ID NO: 1;
[0010] The amino acid sequence of the CDR2 is shown as SEQ ID NO: 2;
[0011] The amino acid sequence of the CDR3 is shown as SEQ ID NO: 3;
[0012] The amino acid sequence of the FR1 is shown as SEQ ID NO: 4;
[0013] The amino acid sequence of the FR2 is shown as SEQ ID NO: 5;
[0014] The amino acid sequence of the FR3 is shown as SEQ ID NO: 6;
[0015] The amino acid sequence of the FR4 is shown as SEQ ID NO: 7.
[0016] Further, the amino acid sequence of the nanobody is shown as SEQ ID NO: 8.
[0017] The present application also provides a nucleotide molecule encoding the above-mentioned nanobody.
[0018] Further, the sequence of the nucleotide molecule is shown as SEQ ID NO: 9.
[0019] The present application also provides an expression plasmid comprising the above-mentioned nucleotide molecule.
[0020] The present application also provides a host cell comprising the above-mentioned expression plasmid.
[0021] The present application also provides the use of the above-mentioned nucleotide molecule, the above-mentioned expression plasmid or the above-mentioned host cell in the preparation of the above-mentioned nanobody.
[0022] The present application also provides a method for preparing the above-mentioned nanobody, the method comprising the following steps:
[0023] (1) constructing the expression plasmid of claim 5;
[0024] (2) transforming the expression plasmid into a host cell, inducing expression, purifying, and obtaining the nanobody.
[0025] Further, in step (1), the method for constructing the expression plasmid is to cut the tool vector and perform homologous recombination with the nucleotide molecule of claim 3 or 4, i.e.
[0026] In step (2), the host cell is Hek293 cell; the condition for inducing expression is culturing at 10-40 DEG C in a CO2 shaker for 5-10 days; and the purification condition is centrifuging at 5000-20000 rpm for 10-30 min, taking supernatant, and purifying by using a protein A gravity column.
[0027] Further, in step (1), the tool carrier is pcDNA3.1-x-IgG1; the temperature for enzyme digestion is 30-45 DEG C, and the time is 4-6 h.
[0028] In step (2), the condition for inducing expression is culturing at 20-30 DEG C in a CO2 shaker for 7 days; and the purification condition is centrifuging at 10000 rpm for 20 min, taking supernatant, and purifying by using a protein A gravity column.
[0029] Further, the method for purifying by using a protein A gravity column comprises the following steps: after loading supernatant, washing 3 column volumes by using PBS buffer, adding glycine hydrochloride for elution, and repeating elution twice.
[0030] The application further provides use of the above-mentioned nanobody in preparation of a drug for preventing and / or treating cancer.
[0031] Further, the cancer is small cell lung cancer, non-small cell lung cancer, pancreatic cancer, primary liver cancer, colorectal cancer, breast cancer, prostate cancer, throat cancer or melanoma.
[0032] The application has the following beneficial effects:
[0033] The application provides a nanobody, a nucleotide molecule, an expression plasmid, a host cell, and a preparation method and use thereof. The anti-B7-H3 nanobody disclosed by the application has a molecular weight of about 15 KDa, has high affinity to B7-H3 protein, and has significantly improved affinity to B7-H3 compared with the B7-H3 nanobody disclosed in patent CN110642948B, significantly reduces immunological risk caused by heterogeneity, is more conducive to penetrating the blood-brain barrier, is more likely to reach the inside of a tumor to play a therapeutic effect, and has a wide application prospect in preparation of a drug for treating late-stage tumors.
[0034] Obviously, according to the above content of the application, according to ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the application.
[0035] The above mentioned subject matter of the present application will be further explained in detail by way of specific embodiments in the form of examples. However, this should not be understood as limiting the scope of the above mentioned subject matter of the present application to the following examples. Any technology realized based on the above mentioned subject matter of the present application falls within the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 Detection of the affinity of the nanobody 11C6 to B7-H3.
[0037] Figure 2 Detection results of the nanobody 11C6 to B7-H3 by kinetic bio-layer interferometry.
[0038] Figure 3 Detection results of the full-length antibody Enoblituzumab to B7-H3 by kinetic bio-layer interferometry. DETAILED DESCRIPTION
[0039] The raw materials and equipment used in the present application are known products, which can be obtained by purchasing commercially available products.
[0040] The "room temperature" referred to in the present application is 25±5℃, and the time of "overnight" is 12±3 hours.
[0041] Example 1, Preparation of the nanobody 11C6
[0042] 1. Construction of the expression vector
[0043] (1) Enzymatic digestion of the skeleton vector: the tool vector pcDNA3.1-x-IgG1 was subjected to BamH I / EcoR I enzyme (purchased from Yixing Biological) digestion at 37℃ for 5h, and then the vector was recovered using a PCR product recovery kit (Cycle-Pure Kit PCR product purification kit, OMEGA, D6492-01).
[0044] Table 1 Plasmid system subjected to BamH I / EcoR I double enzyme digestion
[0045]
[0046] (2) Homologous recombination: the nucleotide fragment for recombinant expression was diluted 20 times with ddH2O, 1 ul of the diluted sample was taken and subjected to homologous recombination with the above-mentioned enzyme-digested recovered vector (recombinase, NovoRec Plus one step PCR Cloning Kit, Coastal Protein, product number: NR005-01B). The homologous recombination system is shown in the table below. The homologous recombination system was subjected to 50°C, 30 min reaction in a PCR instrument. 100 ul of TOP10 competent cells were added to each homologous recombination product, and transformation operation was performed (placed on ice for 20 min, 42°C heat shock for 90 s, immediately placed on ice for 2 min, added with 800 ul of LB culture medium, 37°C, 220 rpm culture for 25-45 min. Coated in Amp-resistant plate medium, 37°C plate incubator culture overnight).
[0047] Table 2 Homologous recombination reaction system
[0048]
[0049] The sequence of the nucleotide fragment for recombinant expression is:
[0050] caggtgcagctggtggaaagcggcggcggcctggtgcagccgggcggcagcctgcgcctgagctgcgcggcgagcggctttacctttagccgctatggcatgggctgggcgcgccaggtgccgggcaaaggcctggaatgggtgagcggcatttatagcgatggcagcacctattatgcgcgcagcgtgaaaggccgctttaccattagccgcgataacgcgaaaaacaccgtgtatctgcagatgaacagcctgaaaccggaagataccgcggtgtattattgcacccgcggcaccggcctgagccatgaagcggatagcggcagctggaccggcggccgcggccagggcacccaggtgaccgtgagcagc (SEQ ID NO: 9).
[0051] (3) Identification of Escherichia coli culture by PCR: Single colony of Escherichia coli was picked from the plate and cultured in 200 μL LB medium (1L solution: 10g tryptone, 5g yeast extract, 10g sodium chloride) at 37°C and 220 rpm for 3h. 1 μL of the culture was used as a template for culture PCR identification (homologous recombination system). Positive clones were selected for sequencing. The PCR products were electrophoretically extracted and recovered (Gel Extraction Kit, OMEGA, catalog number D2500-01). Homologous recombination was performed again. After culture PCR identification, positive clones were selected for sequencing.
[0052] 2. Expression and purification of Hek293F nanobody in cells
[0053] (1) Antibody expression
[0054] The bacterial strain was inoculated into 20 ml of LB medium containing ampicillin and incubated overnight at 37°C. Plasmids were extracted using a plasmid extraction kit (Plasmid Miniprep Kit II, BevoMed Cat: BW-PD1213). Hek293 cells were passaged to maintain good cell growth with a viability greater than 95%. The Hek293 cell density was adjusted to 2.5 × 10⁻⁶ cells / year at transfection. 6 cells / ml. Take 50ug of expression plasmid and add it to 1ml of OPM medium (Shanghai Aopumai Biotechnology Co., Ltd.) and mix well. Take 150ug of polyethyleneimine (PEI) and add it to 1ml of OPM medium and mix well. After mixing the two, shake well and let stand at room temperature for 30min. Then add it to 50ml of Hek293 cells and culture on a CO2 shaker. On the second day, add 5% final volume of OPM medium to feed the cells and continue to culture until day 7. Centrifuge at 10000rpm for 20min to harvest the cell culture supernatant for protein purification.
[0055] (2) Antibody purification
[0056] Protein A column (5 ml column volume) purification of antibody protein: Take the protein A column (Chutian Microsphere Biotechnology (Changsha) Co., Ltd., TH-protein A, Y5001) out of the refrigerator, rinse with one column volume of ultrapure water, rinse with one column volume of 0.1M NaOH, and rinse with PBS buffer for 3 column volumes.
[0057] After centrifugation, the cell supernatant was all loaded into a gravity column, and after washing with 3 column volumes of PBS buffer, 800 ul of 0.1M glycine hydrochloride (Gly-HCl) was added for elution, and the elution was repeated twice, and the target protein (named 11C6) was collected. The protein concentration was detected by microspectrophotometer A280 method (before measurement, blank buffer was used for calibration, 1-2 microliters of blank liquid was dropped on the optical fiber platform, the upper arm was placed down, and the liquid was clamped between the upper arm and the measurement platform. Click the "Blank" button in the software, and measure the sample: after calibration, 2 microliters of sample was taken and accurately dropped on the center of the optical fiber platform. Gently place the upper arm, so that the sample is in the detection area between the optical fibers, click the "Measure" button to start the measurement of the sample), and the protein purity was not less than 95%.
[0058] The amino acid sequence of the target protein 11C6 is shown in SEQ ID NO: 8, which includes complementary determining regions CDR1-CDR3, which are separated by four framework regions FR1, FR2, FR3 and FR4 (see Table 3).
[0059] Table 3. Amino acid sequence of target protein
[0060]
[0061] The beneficial effects of the present application are demonstrated by the following experimental examples.
[0062] Experimental Example 1, Affinity detection of 11C6 nanobody and B7-H3
[0063] 1. Experimental method
[0064] B7H3-His antigen was coated on an enzyme-labeled plate at a concentration of 5ug / ml, and coated overnight at 4℃. Discard the coating solution, wash with PBS for 2 times, and block at 37℃ for 2h. Nanobody 11C6 was added after 3-fold dilution starting from 500nm, and incubated at 37℃ for 1h. Wash with 0.1% PBST for 5 times (each time for 2-3min), and add horseradish peroxidase-labeled Fc secondary antibody (Goat Anti-Human IgG-Fc Secondary Antibody (HRP) brand), and incubate at 37℃ for 45min. Known monoclonal antibody Enoblituzumab (Enoblituzumab) which can simultaneously target B7-H3 was used as a control antibody.
[0065] 2. Experimental results
[0066] Table 4. Half effective concentration of 11C6 nanobody and Enoblituzumab to B7-H3
[0067]
[0068] Affinity ELISA test results as follows Figure 1 As shown, the 11C6 antibody of this invention can target the B7H3 protein. The 11C6 nanobody of this invention exhibits a superior affinity for B7-H3 compared to the control antibody Enoblituzumab. Figure 1 The 11C6 nanobody of this invention has a half-maximal effective concentration (EC50) against B7-H3. 50 The EC50 value was 0.197, while that of the control antibody Enoblituzumab was 0.197. 50 The value was 0.6139. This indicates that the binding activity of the 11C6 nanobody of the present invention to B7-H3 is superior to that of the control antibody Enoblituzumab.
[0069] Experimental Example 2: Biomembrane Interferometry Detection of B7-H3 Kinetics by 11C6 Nanobody
[0070] 1. Experimental Methods
[0071] Add 200 µL / well of equilibration buffer to column 1 of the 96-well plate and set the probe equilibration time to 300 s. Dilute the antibody to 100 nm using equilibration buffer and add 200 µL / well to column 2 of the 96-well plate, setting the probe to load antibody for 120 s. Add 200 µL / well of equilibration buffer to column 3 of the 96-well plate and set the probe equilibration time to 300 s. Dilute the antigen to five concentrations (200, 100, 50, 25, 12.5, 0 nM) using equilibration buffer and add them sequentially to column 4 of the 96-well plate, 200 µL / well, setting the probe binding time to 60 s. Dissociation: Add 200 µL / well of equilibration buffer to column 5 of the 96-well plate and set the probe to dissociate for 300 s.
[0072] 2. Experimental Results
[0073] Table 5. Affinity of 11C6 nanobody to B7H3-His
[0074]
[0075] Table 6. Affinity of Enoblituzumab with B7H3-His
[0076]
[0077] In the biomembrane interference (BLI) assay, the results for 11C6 nanobody and Enoblituzumab are as follows: Figure 2 , 3 As shown, the 11C6 nanobody of the present invention has a high affinity for the B7-H3 protein, which is superior to the traditional Enoblituzumab antibody, and has the advantages of small molecular weight and low immunogenicity of nanobodies.
[0078] In summary, the present application provides a kind of nanobody, nucleotide molecule, expression plasmid, host cell, and its preparation method and use.The nanobody has high affinity with B7-H3 protein, significantly reduces the immunological risk caused by heterogeneity, is more conducive to penetrating blood-brain barrier, is more easily to reach tumor interior and play therapeutic effect, and has wide application prospect in the preparation of drugs for preventing and / or treating advanced tumor.
Claims
1. A nanobody, characterized in that, It includes the Complementary Determinant Region (CDR) and the Frame Region (FR), wherein the Complementary Determinant Region is separated by the Frame Region; The complementary determination regions are CDR1, CDR2, and CDR3; The frame region includes FR1, FR2, FR3 and FR4; The amino acid sequence of CDR1 is shown in SEQ ID NO:1; The amino acid sequence of CDR2 is shown in SEQ ID NO:2; The amino acid sequence of CDR3 is shown in SEQ ID NO:3; The amino acid sequence of FR1 is shown in SEQ ID NO:4; The amino acid sequence of FR2 is shown in SEQ ID NO:5; The amino acid sequence of FR3 is shown in SEQ ID NO:6; The amino acid sequence of FR4 is shown in SEQ ID NO:
7.
2. The nanobody according to claim 1, characterized in that, The amino acid sequence of the nanobody is shown in SEQ ID NO:
8.
3. A polynucleotide molecule, characterized in that, It encodes the nanobody as described in claim 1 or 2.
4. The polynucleotide molecule according to claim 3, characterized in that, The sequence of the polynucleotide molecule is shown in SEQ ID NO:
9.
5. An expression plasmid, characterized in that, It contains the polynucleotide molecule as described in claim 3 or 4.
6. A host cell, characterized in that, It comprises the expression plasmid as described in claim 5.
7. Use of the polynucleotide molecule of claim 3 or 4, the expression plasmid of claim 5, or the host cell of claim 6 in the preparation of the nanobody of claim 1 or 2.
8. A method for preparing the nanobody according to claim 1 or 2, characterized in that, The method includes the following steps: (1) Construct the expression plasmid as described in claim 5; (2) The expression plasmid was transferred into the host cell, induced to express, purified, and nanobodies were obtained.
Citation Information
Patent Citations
B7-H3 nanobody, its preparation method and applications
CN110642948B
B7-H3 nanobody and preparation method and application thereof
CN110642948A
Anti-mesothelin nano antibody and application thereof
CN114276454A