High-temperature-resistant β-mannanase mutant and preparation method thereof

Abstract

The invention discloses a thermostable β-mannanase mutant and a preparation method thereof. The wild-type β-mannanase is derived from Coprinus cinerea ( Coprinopsis cinerea ), using directed evolution to transform it and obtain a thermostable β-mannanase mutant, wherein the mutations of the mutant include at least one of N381K, R123Y, and M439L. The β-mannanase mutant of the present invention has good thermal stability under alkaline conditions and longer heating time. In a pH 10 buffer, the enzyme activity of the mutant was increased by 107.0% compared with the original enzyme after high temperature treatment at 90°C for 2 h. The ability of the enzyme mutant to catalyze the hydrolysis of β-mannanase was significantly improved, and it has broad application prospects.

Description

Technical Field

[0001] The present invention relates to a beta-mannanase mutant and a preparation method thereof, in particular to a high-temperature resistant beta-mannanase mutant and a preparation method thereof, belonging to the technical fields of enzyme engineering and genetic engineering. Background Art

[0002] β-Mannanase (EC3.2.1.78) is a hydrolase that specifically hydrolyzes β-1,4-mannan, belonging to the glycoside hydrolase family. Mannan is the second-largest complex in hemicellulose after xylan and a common carbohydrate in plant cell walls. Its backbone is composed of β-1,4-glycosidic bonds. β-Mannanase can cleave β-1,4-glycosidic bonds within mannan molecules, breaking down complex polysaccharides into simpler oligosaccharides and even the monosaccharide mannose. Consequently, it has found widespread industrial applications, such as improving food texture, increasing the digestibility of animal feed, reducing chemical usage in papermaking, and improving the efficiency of cellulosic ethanol production. However, existing β-mannanases suffer from poor heat resistance, making them unable to maintain stable biological activity during production, transportation, and application, severely limiting their application.

[0003] Patent application CN115044634A discloses the use of a mannanase from Coprinus cinereus. Through genetic engineering, the gene encoding the mature mannanase from Coprinus cinereus was introduced into Pichia pastoris and fermented to produce the mannanase. The enzyme was then used to identify the fine structure of β-galactomannan and to hydrolyze β-galactomannan to produce mannobiose. However, this technology did not improve the heat resistance of the mannanase. Patent application CN107400665A discloses a site-directed mutagenesis mannanase and its use. The MAN47 gene of the β-mannanase from Pseudomonas aeruginosa was subjected to site-directed mutagenesis, replacing isoleucine at position 197 with leucine, lysine at position 280 with asparagine, and valine at position 380 with alanine. The resulting MAN47 mutant exhibits high temperature resistance, wide pH stability, and improved trypsin resistance. However, the thermal stability test of this mutant was carried out by incubating at pH 5.0 for 30 minutes, so its thermal stability under alkaline conditions and longer heating times is not clear. Summary of the Invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a β-mannanase mutant with good thermal stability under alkaline conditions and longer heating time, and to provide related nucleotide sequences, recombinant vectors, recombinant cells and preparation methods.

[0005] Technical solution: The thermostable β-mannanase mutant of the present invention is obtained by amino acid substitution of the sequence shown in SEQ ID NO.1, wherein the substitution is at least one of N381K, R123Y, and M439L.

[0006] The present invention uses the wild-type β-mannanase from Coprinopsis cinerea as the original enzyme, whose amino acid sequence is SEQ ID NO. 1, and the gene sequence encoding the enzyme is SEQ ID NO. 2. The thermostable β-mannanase mutant is obtained by replacing at least one amino acid at positions 381, 123, and 439 of the enzyme. The replacements are: asparagine at position 381 is replaced with lysine; arginine at position 123 is replaced with tyrosine; and methionine at position 439 is replaced with leucine. The resulting thermostable β-mannanase mutant exhibits good thermal stability under alkaline conditions and for extended heating times.

[0007] The present invention uses the standard single-letter code for amino acids, for example: N381K means that asparagine (N) at position 381 at the N-terminus is changed to lysine (K); N381K-R123Y means that asparagine (N) at position 381 at the N-terminus is changed to lysine (K), and arginine (R) at position 123 at the N-terminus is mutated to tyrosine (Y).

[0008] The present invention also provides a nucleotide sequence encoding the β-mannanase mutant. The nucleotide sequence can be obtained by base mutation of the sequence shown in SEQ ID NO. 2.

[0009] The present invention also provides a recombinant vector comprising the nucleotide sequence. The recombinant vector can be a plasmid or a virus, and can maintain replication ability in a host cell and amplify or express the nucleotide sequence.

[0010] Preferably, the recombinant vector includes a cloning vector or an expression vector.

[0011] The present invention also provides a recombinant cell comprising the recombinant vector. The recombinant cell can be E. coli DH5α.

[0012] The present invention also provides a method for preparing the β-mannanase mutant, comprising the following steps:

[0013] (1) Using the β-mannanase gene as a template, a PCR reaction was performed using point mutation primers to obtain the mutant gene;

[0014] (2) inserting the mutant gene into an expression vector and transferring it into a host cell to obtain a recombinant cell;

[0015] (3) Cultivating the recombinant cells and inducing expression of the β-mannanase mutant.

[0016] Preferably, in step (1), the base sequence of the β-mannanase gene is shown as SEQ ID NO.2.

[0017] Preferably, in step (2), the mutant gene is inserted into an expression vector using a DNA homologous recombination method.

[0018] Preferably, in step (3), after expression is completed, the cells are collected; or the cells are disrupted and the crude enzyme solution of the original enzyme is collected; or the cells are disrupted and the crude enzyme solution of the β-mannanase mutant is collected.

[0019] Preferably, in step (1), the primers are designed by modeling and predicting the 3D model of the original enzyme:

[0020] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC M439L-F GCCGCGCTCAAAGCGCGCGGCCTCGAG M439L-R CCGCGCGCTTTGAGCGCGGCCGCATG

[0021] Preferably, in step (1), the PCR reaction system is:

[0022]

[0023] Preferably, in step (1), the conditions of the PCR reaction are:

[0024]

[0025] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: the β-mannanase mutant has good thermal stability under alkaline conditions and longer heating time. In a pH 10 buffer solution, after high-temperature treatment at 90°C for 2 hours, the enzyme activity of the mutant is increased by 89% compared with the original enzyme. The ability of the enzyme mutant to catalyze the hydrolysis of β-mannanase is significantly improved, and it has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the protein structure of the original β-mannanase;

[0027] Figure 2 Standard curve for colorimetric determination of glucose at -540 nm;

[0028] Figure 3 Schematic diagram of the specific enzyme activity of original β-mannanase under different pH conditions;

[0029] Figure 4 Schematic diagram of the relative enzyme activities of the original β-mannanase and the enzyme mutants under different temperature conditions. DETAILED DESCRIPTION

[0030] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0031] Sources or ingredients of materials used in the examples:

[0032] 1. Strains and plasmids

[0033] Synthesis of the pET-22b(+) plasmid carrying the original Coprinopsis cinerea β-mannanase gene, synthesis of mutagenesis primers and plasmid construction primers, and sequencing of the gene sequence in the plasmid were completed by Jin Weizhi (Suzhou). The pET-22b(+) plasmid expressing the β-mannanase mutant was constructed by the applicant.

[0034] The strain E. coli DH5α was used for plasmid construction (purchased from Shenzhen Kangti Life Science Technology Co., Ltd.), and the strain E. coli BL21 (DE3) was used for exogenous protein expression (purchased from Shenzhen Kangti Life Science Technology Co., Ltd.).

[0035] 2. Experimental reagents and culture medium

[0036] Key reagents included: PCR enzymes and buffer components from the MutUFO Fast Mutagenesis Kit (Nanjing Jujiang Biotechnology), a plasmid extraction kit from Shanghai Bioengineering, a DNA marker from Shanghai Bioengineering, and the endonuclease DpnI from Adamas. Other conventional reagents were domestically produced and of analytical grade.

[0037] LB liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 5 g / L NaCl. If using LB solid medium, add 15 g / L agar powder.

[0038] TB liquid culture medium: yeast powder 12 g / L, tryptone 12 g / L, glycerol 4 ml / L, dipotassium hydrogen phosphate 12.5 g / L, potassium dihydrogen phosphate 2.3 g / L.

[0039] Comparison of specific enzyme activity of original β-mannanase under different pH conditions:

[0040] The original β-mannanase was treated with 0.1 M glycine-sodium hydroxide buffer at pH 7.0, 8.0, 9.0, 10.0, and 11.0, and the residual enzyme activity was determined using the DNS method. The DNS method is a commonly used method for determining enzyme activity. It is based on the coloring reaction between the reducing sugars produced by the enzyme-catalyzed reaction and dithiobarbituric acid (DNS) under alkaline conditions.

[0041] The specific method is as follows:

[0042] Take 30 μL of crude enzyme solution and add it to 120 μL of 1% carob bean gum solution and blow it evenly. After reacting at 65°C for 30 minutes, add 150 μL of DNS solution. Treat the mixed solution in a boiling water bath for 10 minutes, immediately cool it to room temperature in an ice bath, and measure its absorbance at 540 nm. In the negative control experiment, the crude enzyme solution was replaced with buffer solution, and the rest of the operations were the same. Prepare 0.7000, 0.5000, 0.2500, 0.1250, and 0.1000 mg / mL glucose standard solutions, take 150 μL and use the above treatment method to obtain the glucose-540 nm standard curve, as shown below. Figure 2 As shown. Definition of crude enzyme activity: Under enzymatic reaction conditions, the amount of enzyme required to catalyze the hydrolysis of carob bean gum to produce 1 nmol of glucose per 1 min is one enzyme activity unit (U). Specific enzyme activity is the catalytic ability of the enzyme per unit volume of crude enzyme solution (U / mL); the specific enzyme activity of crude enzyme solution is calculated based on the absorbance value at 540nm and the standard curve. The results are shown in Figure 3 As shown in the figure: compared with buffers of other pH values, the original β-mannanase still maintains a higher enzyme activity in a buffer of pH 10.0, so the original enzyme has good alkali resistance. The subsequent heat-resistant reactions were all carried out in a buffer of pH 10.0.

[0043] Example 1: A thermostable β-mannanase mutant N381K

[0044] In this example, β-mannanase from Coprinopsis cinerea was used as the original enzyme, and the asparagine at position 381 of its amino acid sequence was mutated to lysine. The preparation method is as follows: (1) preparing the mutant gene and constructing a recombinant plasmid; (2) constructing a recombinant cell to express the β-mannanase mutant. The details are as follows:

[0045] (1) Preparation of mutant genes and construction of recombinant plasmids

[0046] The primers for the N381K mutation site are shown in Table 1. PCR was performed using the pET-22b(+) plasmid carrying the original β-mannanase gene as a template. The PCR system is shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0047] Table 1 Primers for point mutation and plasmid construction

[0048] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC

[0049] Note: The underlined markers in the primers are mutation sites, “F” represents the upstream primer, and “R” represents the downstream primer.

[0050] Table 2 PCR reaction system

[0051]

[0052]

[0053] Table 3 PCR reaction conditions

[0054]

[0055] After verification of the PCR product by electrophoresis, digest the template with the endonuclease DpnI. Prepare the reaction mixture as shown in Table 4 and digest at 37°C for 1-2 hours.

[0056] Table 4 Template digestion system

[0057] Ingredients content DpnI 1 μl PCR products 0.06 pmol

[0058] After template digestion, the product was subjected to DNA homologous recombination. The reaction system was prepared as shown in Table 5 and reacted at 37°C for 30 minutes for one-step cloning to construct the expression plasmid of the mutant enzyme.

[0059] Table 5 Homologous recombination system

[0060] Ingredients content DpnI digest 0.06 pmol 5×UFOBuffer 4 μl UvsXase 2 μl ddH2O to 20 μl

[0061] The obtained plasmid was transformed into the engineered bacterium E. coli DH5α for amplification, and the recombinant plasmid was extracted and sequenced for verification.

[0062] (2) Construction of recombinant cells expressing β-mannanase mutants

[0063] Transform the recombinant plasmid into the expression host E. coli BL21 (DE3) and plate onto LB plates containing 100 ng / mL ampicillin for screening. Inoculate the transformants into 5 mL of LB liquid medium containing 100 ng / mL ampicillin and culture overnight at 37°C, 140 rpm in a shaker. Inoculate 2.5 mL of the bacterial broth into 50 mL of TB liquid medium containing 100 ng / mL ampicillin and culture at 37°C, 140 rpm for 6 hours. Add filter-sterilized IPTG to the fermentation broth to a final concentration of 0.4 mM and continue incubating at 22°C, 140 rpm for 22 hours.

[0064] Transfer the recombinant bacterial fermentation broth to a centrifuge tube and collect the cells by centrifugation at 11,000 rpm. Resuspend the cells in 20 mL of pH 10.0 buffer, disrupt the cells by sonication for 10 minutes, and centrifuge again at 12,000 rpm to remove cell debris. The resulting supernatant is the crude enzyme solution containing the β-mannanase mutant.

[0065] Example 2: A thermostable β-mannanase mutant R123Y

[0066] This example uses the same original enzyme as in Example 1, and mutates the arginine at position 123 of its amino acid sequence N-terminus to tyrosine. The preparation method is essentially the same as in Example 1, except for the mutation primers, as shown in Table 6:

[0067] Table 6 Point mutation primers and plasmid construction primers

[0068] Primer name Sequence (5'-3') R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC

[0069] Example 3: A thermostable β-mannanase mutant M439L

[0070] This example uses the same original enzyme as in Example 1, but mutates the methionine at position 439 of its amino acid sequence N-terminus to leucine. The preparation method is essentially the same as in Example 1, except for the mutation primers, as shown in Table 7:

[0071] Table 7 Point mutation primers and plasmid construction primers

[0072] Primer name Sequence (5'-3') M439L-F GCCGCGCTCAAAGCGCGCGGCCTCGAG M439L-R CCGCGCGCTTTGAGCGCGGCCGCATG

[0073] Example 4: A thermostable β-mannanase mutant N381K-R123Y

[0074] This example uses the same original enzyme as in Example 1, with the asparagine at position 381 of its amino acid sequence N-terminus mutated to lysine, and the arginine at position 123 mutated to tyrosine. The preparation method is essentially the same as in Example 1, with the difference being the mutation primers, as shown in Table 8:

[0075] Table 8 Point mutation primers and plasmid construction primers

[0076] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC

[0077] Example 5: A thermostable β-mannanase mutant N381K-R123Y-M439L

[0078] This example uses the same original enzyme as in Example 1, with the asparagine at position 381 of its amino acid sequence N-terminus mutated to lysine, the arginine at position 123 mutated to tyrosine, and the methionine at position 439 mutated to leucine. The preparation method is essentially the same as in Example 1, except for the mutation primers, as shown in Table 9:

[0079] Table 9 Point mutation primers and plasmid construction primers

[0080] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC M439L-F GCCGCGCTCAAAGCGCGCGGCCTCGAG M439L-R CCGCGCGCTTTGAGCGCGGCCGCATG

[0081] Performance test: testing enzyme activity at different temperatures

[0082] The original β-mannanase crude enzyme solution and the β-mannanase mutant prepared in Example 1-5 were treated with 0.1M glycine-sodium hydroxide buffer at pH 10.0 at 70°C, 80°C, and 90°C for 2 hours, and the residual enzyme activity was determined by the DNS method. Figure 4 and shown in Table 10.

[0083] Table 10 β-mannanase activity at different temperatures at pH 10.0

[0084] strains Relative activity at 70℃ Relative activity at 80℃ Relative activity at 90℃ WT 100％ 52％ 43％ N381K 141％ 117％ 69％ R123Y 138％ 102％ 64％ M439L 125％ 96％ 61％ N381K-R123Y 164％ 131％ 75％ N381K-R123Y-M439L 182％ 145％ 89％

[0085] Depend on Figure 4 The results showed that after high-temperature treatment at 90°C for 2 hours in a pH 10.0 buffer, all mutants had higher enzyme activities than the original β-mannanase. Among them, the mutant enzyme N381K-R123Y-M439L had the highest enzyme activity, increasing by 107.0% relative to the original enzyme activity.

Claims

1. A thermostable β-mannanase mutant, characterized in that: The sequence shown in SEQ ID NO. 1 is obtained by amino acid substitution, wherein the substitution is at least one of N381K, R123Y, and M439L.

2. A nucleotide, characterized in that Encoding the β-mannanase mutant according to claim 1.

3. A recombinant vector, characterized in that Comprising the nucleotide according to claim 2.

4. The recombinant vector according to claim 3, characterized in that These include cloning vectors or expression vectors.

5. A recombinant cell, characterized in that Comprising the recombinant vector according to claim 3.

6. A method for preparing the β-mannanase mutant according to claim 1, characterized in that: The steps include: (1) Using the β-mannanase gene as a template, a PCR reaction was performed using point mutation primers to obtain the mutant gene; (2) inserting the mutant gene into an expression vector and transferring it into a host cell to obtain a recombinant cell; (3) Cultivating the recombinant cells and inducing expression of the β-mannanase mutant.

7. The preparation method according to claim 6, characterized in that In step (1), the base sequence of the β-mannanase gene is shown as SEQ ID NO.

2.

8. The preparation method according to claim 6, characterized in that In step (2), the mutant gene is inserted into an expression vector using a DNA homologous recombination method.

9. The preparation method according to claim 6, characterized in that In step (3), after expression is completed, the cells are collected; or the cells are disrupted and the crude enzyme solution is collected; or the cells are disrupted and the separated and purified β-mannanase mutant is collected.

10. The preparation method according to claim 6, characterized in that In step (1), the primers are: N381K-F: CGTGACCACC AAA AAACCGGCGGTGTATAC N381K-R: GCCGGTTT TTT GGTGGTCACGCCATATTCTTC R123Y-F: CTGAGCGGCCATAGC TAT GATAACATGAACCGC R123Y-R: CATGTTATCATAGC TAT GGCCGCTCAGGCCC M439L-F: GCCGCG CTC AAAGCGCGCGGCCTCGAG M439L-R: CCGCGCGCTTT GAG CGCGGCCGCATG。

Images