Primers, probes, kits and methods for detecting copy number variations of SMN1 and SMN2 genes

Abstract

The present invention relates to primers, probes, kits and methods for detecting copy number variations of SMN1 and SMN2 genes. The kit of the present invention combines amplification refractory mutation system PCR (ARMS-PCR) and competitive primer PCR (COP-PCR), and is paired with the Taq-Man probe method, which can effectively distinguish the differences between the SMN1 gene and the SMN2 gene at two different sites in exons 7 and 8, while ensuring the amplification efficiency of the target, and has high sensitivity, good specificity and high stability (precision). In addition, the kit is paired with stable PCR amplification reaction components, which can effectively distinguish the differences between SMN1 deletion, carriage and normal, and can also calculate and analyze the copy number of SMN2, providing a basis for the disease analysis, medication guidance and prognosis of SMA patients.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology and relates to primers, probes, kits and methods for detecting copy number variations in SMN1 and SMN2 genes. Background Art

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease characterized by progressive muscle weakness and atrophy caused by degeneration of motor neurons in the brainstem and spinal cord. It is the most common fatal inherited neuromuscular disease in infants and young children. SMA is inherited in an autosomal recessive manner. The carrier frequency is 1 / 35 to 1 / 80. The incidence of SMA patients is approximately 1 / 8000 to 1 / 10000, with no significant regional or racial differences.

[0003] Based on the patient's age of onset and clinical course, SMA is divided into four types from severe to mild.

[0004] Type I SMA typically develops within 6 months of age and accounts for approximately 45% of all SMA cases. A key characteristic is the inability to sit independently, requiring a stroller or wheelchair. Swallowing and feeding become difficult, and due to the difficulty in preventing aspiration (the inhalation of secretions or food into the lungs causing suffocation), the child eventually loses the ability to swallow safely. Most children die from respiratory failure before the age of 2.

[0005] Children with type II SMA typically develop the disease between 6 and 18 months of age, accounting for approximately 30% to 40% of cases. They possess a range of motor abilities, but motor function indicators are delayed. A typical characteristic is the ability to sit independently, although some children require assistance to achieve this position. With braces or external support, they may be able to stand, but cannot walk independently and require a wheelchair for mobility. Despite a shortened lifespan, most children can live into adulthood.

[0006] Children with type III SMA typically develop the disease after 18 months of age, accounting for approximately 20% of cases. Initially, patients can stand and walk independently, but as the disease progresses, walking becomes difficult at some point. Early motor milestones are usually normal; however, once they begin walking, they frequently fall, have difficulty getting up from a bent-over or sitting position, and may be unable to run. As the disease progresses, fasciculations in the limbs and foot deformities may occur. Some patients experience daily life disruptions due to scoliosis and respiratory failure. Life expectancy is not shortened or only slightly reduced.

[0007] Symptoms of adult-onset type IV SMA typically begin after age 35. SMA rarely develops between the ages of 18 and 30. Adult-onset SMA is much less common than other types and is defined as not showing weakness until after age 18, but most reported cases of type IV have developed after age 35. It is typically characterized by insidious onset and very slow progression. Muscles controlled by the medulla oblongata, those used for swallowing and breathing, are rarely affected.

[0008] The SMN1 gene is the pathogenic gene for SMA. It can be roughly understood that SMN1 gene deletion indicates an SMA patient, a single copy of the SMN1 gene indicates a carrier, and at least two copies of the SMN1 gene indicate a normal person.

[0009] The human genome contains two highly homologous SMN genes: SMN1 and SMN2. These two genes are arranged tandemly on chromosomes. SMN1, located closer to the telomere, is also known as SMNT, while SMN2, located closer to the centromere, is known as SMNC. These two genes differ by only five nucleotide sites (two of which are in the coding region, located in exons 7 and 8, and the other three in introns 6 and 7), yet they encode the same protein. These two genes are primarily distinguished by two gene loci in exons 7 and 8. SMN1 is the predominant functional gene, and SMN1 deletion is the main cause of spinal muscular atrophy (SMA).

[0010] Because the SMN gene stop codon is located in exon 7, exon 8 does not code for amino acids. Therefore, the SMN1 and SMN2 coding sequences differ by only one base, a C>T difference in exon 7.

[0011] The SMN2 gene produces only 10% to 15% of the functional, structurally stable full-length SMN protein. Most of the truncated SMN protein produced by the SMN2 gene is structurally unstable and easily degraded. However, SMN2 is a compensatory gene for SMN1, and having multiple copies of the SMN2 gene can delay onset or milder symptoms. The SMN2 copy number provides guidance for drug trials.

[0012] A 2020 review published in Germany described the relationship between clinical type and SMN2 copy number in 3459 SMA patients: generally, the higher the SMN2 copy number, the milder the phenotype.

[0013] 73% of patients with type I SMA carry two copies of SMN2;

[0014] 78% of patients with type II SMA carry 3 copies of SMN2;

[0015] 49% of patients with type III SMA carry three SMN2 copies, and 44% carry four SMN2 copies;

[0016] 81% of patients with type IV SMA carry 4 copies of SMN2.

[0017] Currently, the main clinical methods for detecting SMN gene copy number include: restriction fragment length polymorphism analysis using polymerase chain reaction (PCR-RFLP), denaturing high-performance liquid chromatography (PCR-DHPLC), multiplex ligation probe amplification (MLPA), and real-time quantitative PCR. PCR-RFLP can only be used for qualitative analysis of patients with homozygous deletion of exon 7 of the SMN1 gene (i.e., 0 copies), and cannot detect carriers of heterozygous deletion (i.e., single copy). Furthermore, the technique itself can lead to misdiagnosis due to incomplete enzyme digestion. PCR-DHLPC and MLPA can be used to detect homozygous deletion and heterozygous deletion carriers. MLPA can also achieve quantitative analysis of 0, single, two, three, and four copies of the gene, but it is complex to operate, has low throughput, is time-consuming (48-72 hours), requires specific instruments, and is expensive, thus limiting its widespread application in practice.

[0018] Therefore, there is currently a lack of a rapid method for detecting exons 7 and 8 of the SMN1 and SMN2 genes and their copy numbers. Summary of the Invention

[0019] To address the aforementioned technical problems, the present invention aims to provide primers, probes, kits, and methods for detecting copy number variations in the SMN1 and SMN2 genes. The kit of this invention combines amplification arrest mutation system PCR (ARMS-PCR) and competitive primer PCR (COP-PCR) with the Taq-Man probe method. This effectively distinguishes the differences between the SMN1 and SMN2 genes at two different sites in exons 7 and 8, while ensuring target amplification efficiency. Furthermore, the kit, with its stable PCR amplification reaction components, effectively distinguishes the differences between SMN1 deletions, carriers, and normal individuals, and also allows for the calculation and analysis of SMN2 copy numbers, providing a basis for SMA patient disease analysis, medication guidance, and prognosis.

[0020] Amplification arrestor mutation system PCR (ARMS), also known as allele-specific amplification (ASA), was first established by Newton et al. to detect known mutations. Its basic principle is that if the 3' end base of the primer is not complementary to the template base, it cannot be extended using a standard DNA polymerase. Therefore, three primers (see primer design) are designed based on known point mutations, with their 3' end bases complementary to the mutated and normal template bases, respectively, thus distinguishing the template with a certain point mutation from the normal template. This method has been used to detect various SNP sites and mutations.

[0021] Competitive primer PCR (COP-PCR) designs allele-specific oligonucleotides targeting a single side-point mutation in the target DNA. Unlike ARMS-PCR primers, the mutation site in competitive primers is located in the middle of the primer rather than at the end, and the length is ideally 12-16 nucleotides. Both primers compete to anneal at the same site on the template; perfectly complementary primers have a 20-100 times greater chance of annealing than single-base mismatch primers. If only one primer is used as a label, the competitive amplification results will differ for different templates, with incompletely bound templates showing poor amplification.

[0022] To further improve the specificity of competing primers, this invention modifies the primers with locking nucleotides, shortening their length and reducing mismatches. Locking nucleotides (LNAs) are nucleotide analogs whose ribose ring is "locked" by a methylene bridge connecting the 2'-O and 4'-C atoms. LNA mononucleotides contain the same nucleic acid bases found in DNA and RNA and can form base pairs according to the Watson-Crick base pairing principle. However, by "locking" the molecule with the methylene bridge, LNAs tend to form an ideal Watson-Crick binding conformation. When bound to DNA or RNA oligonucleotides, LNAs facilitate faster pairing with complementary nucleotide chains and increase the stability of the resulting double strand.

[0023] In summary, AMRS-PCR utilizes the principle that primer end mismatch causes difficulties in polymerase amplification, while COP-PCR utilizes the difficulty of annealing caused by primer-template mismatch to reduce non-specific amplification. However, both AMRS-PCR and COP-PCR have differences in base adaptation, and the amplification effect of some base mismatches is not significant. Therefore, this invention innovatively combines COP-PCR and AMRS-PCR, which can better distinguish the mutual influence between SMN1 and SMN2 genes.

[0024] In addition, in order to further eliminate the influence between SMN1 and SMN2 genes, the present invention sets a blocking blocker and blocks the pseudogene by introducing a C3Spacer termination modification at the 3' end to avoid its nonspecific amplification and make the detection more accurate.

[0025] The objective of this invention can be achieved through the following methods:

[0026] In a first aspect, the present invention provides a primer and probe combination for detecting copy number variations in the SMN1 and SMN2 genes, comprising the following sequences:

[0027] The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN1 gene are shown in SEQ ID No. 1-3, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN1 gene is shown in SEQ ID No. 4;

[0028] The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN2 gene are shown in SEQ ID No. 5-7, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN2 gene is shown in SEQ ID No. 4;

[0029] The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON8 site of the SMN1 gene are shown in SEQ ID Nos. 8 to 10, respectively; the nucleotide sequence of the probe for detecting the EXON8 site of the SMN1 gene is shown in SEQ ID No. 11;

[0030] The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON8 site of the SMN2 gene are shown in SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. 10, respectively; the nucleotide sequence of the probe for detecting the EXON8 site of the SMN2 gene is shown in SEQ ID No. 11;

[0031] The nucleotide sequences of the primers used to detect the internal standard gene TOP3A are shown in SEQ ID No. 14-15, respectively; the nucleotide sequences of the probes used to detect the internal standard gene TOP3A are shown in SEQ ID No. 16.

[0032] The primer and probe combination described in this invention is used for rapid identification of the SMN1 gene, exon 7 and exon 8 of the SMN2 gene, and the internal standard gene TOP3A.

[0033] The details are as follows:

[0034]

[0035] As one embodiment of the present invention, the 5' and 3' ends of the probe are respectively equipped with a fluorescent group and a quenching group, wherein the fluorescent group is selected from any one or more of FAM, HEX, VIC, TET, TAMRA, ROX, CY3.5, and CY5; and the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

[0036] Secondly, the present invention provides the application of the primer and probe combination in the preparation of a kit for detecting copy number variations of the SMN1 and SMN2 genes.

[0037] Thirdly, the present invention provides a kit for detecting copy number variations of SMN1 and SMN2 genes, the kit comprising a detection solution and an enzyme mixture; the detection solution comprising a primer and probe combination, wherein the concentration of each primer or probe in the primer and probe combination is 0.2-0.4 μM.

[0038] As one embodiment of the present invention, the detection solution includes SMN1 gene E7 detection solution, SMN1 gene E8 detection solution, SMN2 gene E7 detection solution, and SMN2 gene E7 detection solution;

[0039] In the SMN1 gene E7 detection solution, the concentration of the primers or probes shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 14, and SEQ ID No. 15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No. 2, SEQ ID No. 4, and SEQ ID No. 16 is 0.2 μM.

[0040] In the SMN2 gene E7 detection solution, the concentration of the primers or probes shown in SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 14, and SEQ ID No. 15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No. 6, SEQ ID No. 4, and SEQ ID No. 16 is 0.2 μM.

[0041] In the SMN1 gene E8 detection solution, the concentration of the primers or probes shown in SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 14, and SEQ ID No. 15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No. 9, SEQ ID No. 11, and SEQ ID No. 16 is 0.2 μM.

[0042] In the SMN2 gene E8 detection solution, the concentration of the primers or probes shown in SEQ ID No. 12, SEQ ID No. 10, SEQ ID No. 14, and SEQ ID No. 15 is 0.4 μM; the concentration of the primers or probes shown in SEQ ID No. 13, SEQ ID No. 11, and SEQ ID No. 16 is 0.2 μM.

[0043] As an embodiment of the present invention, the detection solution further comprises PCR buffer, 3.2-3.4 mM MgCl2, and 0.1-0.4 mM dNTPs; the dNTPs include one or more of dATP, dTTP, dCTP, dGTP, and dUTP.

[0044] In some embodiments, the molar ratio of dATP, dTTP, dCTP, dGTP and dUTP is 1:1:1:1:1.

[0045] As one embodiment of the present invention, the enzyme mixture includes DNA polymerase.

[0046] As one embodiment of the present invention, the kit further includes a normal control, a single-copy control, a deletion control, and a blank control; in the normal control, the copy number ratio of the internal control gene:SMN1 gene:SMN2 gene is 2:2:2; in the single-copy control, the copy number ratio of the internal control gene:SMN1 gene:SMN2 gene is 2:1:1; in the deletion control (referring to SMN1 deletion, as individuals with simultaneous deletions of SMN1 and SMN2 genes do not exist in reality), the copy number ratio of the internal control gene:SMN2 gene is 2:2. It should be noted that the deletion control refers to SMN1 deletion, as individuals with simultaneous deletions of SMN1 and SMN2 genes do not exist in reality.

[0047] In a fourth aspect, the present invention provides a method for detecting SMN1 and SMN2 gene copy number variations using the kit for non-diagnostic purposes, comprising the following steps:

[0048] S1. Extract nucleic acid from the sample;

[0049] S2. Add the sample nucleic acid to the E7 or E8 detection solution and enzyme mixture to prepare the reaction system for RT-PCR reaction; the E7 detection solution includes any one of the SMN1 gene E7 detection solution and the SMN2 gene E7 detection solution; the E8 detection solution includes any one of the SMN1 gene E8 detection solution and the SMN2 gene E8 detection solution.

[0050] S3. Result Interpretation.

[0051] As one embodiment of the present invention, in step S1, the nucleic acid of the sample is extracted using the Qiagen QIAampDNA Blood Mini Kit (catalog number: 51104, 51106) to prepare a sample nucleic acid volume of 70 μL.

[0052] In one embodiment of the present invention, in step S2, the reaction system is prepared in 25 μL, and the composition of the reaction system is as follows:

[0053]

[0054] The SMN1 and SMN2 genes can be detected using different E7 and E8 solutions. Specifically, the E7 exon detection solution contains either the SMN1 or SMN2 exon detection solution; unless otherwise specified, this indicates that the solution will be prepared according to actual requirements.

[0055] In some embodiments, the amount of E7 or E8 detection solution added is 7.5 μL / person, the amount of enzyme mixture added is 12.5 μL / person, the amount of sample nucleic acid added is 5 μL / person, and the final volume is 25 μL / person.

[0056] As one embodiment of the present invention, in step S3, the normal control, single copy control, deletion control and blank control are configured and tested in the same way as the sample nucleic acid.

[0057] As one embodiment of the present invention, in step S3, the RT-PCR reaction is performed according to the following procedure: 97℃ for 5 min; 97℃ for 10 s, 58℃ for 45 s, for a total of 45 cycles, and fluorescence signals are collected during the annealing extension phase.

[0058] As one embodiment of the present invention, in step S4, the result is interpreted as follows: missing means 0 copies, carrying means 1 copy, and normal means 2 copies or more.

[0059] SMN copy number determination (taking SMN1 as an example; the determination criteria for SMN2 are the same as those for SMN1):

[0060] 1. The Ct value of the internal control gene in the sample to be tested is ≤30;

[0061] 2. The test results for both E7 and E8 reactions lacking the reference standard should be missing;

[0062] 3. Calculate the ΔCt value between the target gene and the internal control gene in the E7 and E8 reactions, respectively. ΔCt = CtFAM - CtVIC. Calculate the average ΔCt value of the normal control in the E7 and E8 reactions, and denot it as ΔCta.

[0063] 4. Calculate the ΔCt value between the target gene and the internal control gene in the E7 and E8 reactions of the test samples, respectively. ΔCt = CtFAM - CtVIC, denoted as ΔCts.

[0064] 5. △△Ct=△Cts-△Cta;

[0065] 6. Judgment of test results: If any of the following conditions are met in the sample to be tested, it is considered that the SMN gene exon is deleted.

[0066] If the following results are met, the SMN gene should be considered to be missing:

[0067] E7 reaction: △△Ct≥1.5 or no signal in FAM channel;

[0068] E8 reaction: △△Ct≥1.5 or no signal in the VIC channel;

[0069] If the following results are met, the SMN gene should be considered a single copy:

[0070] E7 reaction: 0.5﹤△△Ct﹤1.5;

[0071] E8 reaction: 0.5﹤△△Ct<1.5;

[0072] If the following results are met, the SMN gene should be considered normal (double copy):

[0073] E7 reaction: ΔΔCt≤0.5;

[0074] E8 reaction: △△Ct≤0.5.

[0075] The conventional method typically uses a probe-based PCR (MLPA) assay to detect the copy number of the SMN1 and SMN2 genes in human spinal muscular atrophy (SMN1 and SMN2) by designing shared primers for detecting exon 7, Exon 7, of the SMN1 and SMN2 genes, and primers for detecting exon 8, Exon 8, of the SMN1 gene. These primers are then combined with probes for detecting exons 7 and 8, Exon 7, to form a primer-probe combination. Locked nucleotides are also incorporated into the probes. However, the probe-based assay typically requires stringent PCR reaction conditions, and the probe amplification required by the shared primers is extremely unstable and exhibits poor reproducibility. The present invention utilizes a primer-based assay (combining amplification retardation mutation system PCR (ARMS-PCR) with competitive primer PCR (COP-PCR)) to address these issues. Furthermore, the kit prepared using the designed primer-probe combination exhibits high sensitivity, good specificity, and high stability (precision).

[0076] Compared with the prior art, the present invention has the following beneficial effects:

[0077] 1. The primer composition for rapid detection of exon 7 deletion sites in the SMN1 gene of the present invention uses competitive primer PCR (COP-PCR) and designs upstream primers according to different target genes to specifically amplify the SMN1 gene while avoiding interference from the SMN2 gene. At the same time, the locked nucleotide modification (LNA) is introduced to increase the annealing temperature of the COP-PCR primers and improve the specificity of primer binding.

[0078] 2. The primer composition for rapid detection of exon 7 deletion sites of the SMN1 gene of the present invention employs a mutation amplification arrest system (AMRS-PCR) and downstream primers designed according to different target genes to specifically amplify the SMN1 gene while avoiding interference from the SMN2 gene; and the primer composition for rapid detection of exon 8 deletion sites of the SMN1 gene employs a mutation termination modification arrest system (AMRS-PCR) and probes designed according to different target genes to specifically amplify the SMN2 gene while avoiding interference from the SMN1 gene.

[0079] 3. The probes for rapid detection of the SMN1 gene of the present invention also use MGB probes, which can specifically bind to differential sites, accurately distinguish SMN1 from SMN2, and further reduce the impact of SMN2 copy number.

[0080] 4. The present invention also provides primer probes for detecting the copy number of SMN2 exon 7 and exon 8. Simultaneously, a fluorescent quantitative PCR technology platform is employed. This platform offers advantages in being simple, convenient, rapid, and accurate in distinguishing between the SMN1 and SMN2 genes, known mutation sites in the SMN1 gene, and gene deletions, as well as single and double copies of SMN1. It is suitable for auxiliary diagnosis of SMA patients and screening of SMA carriers.

[0081] 5. The present invention incorporates an internal standard to effectively avoid false negative test results and monitor the collection, transportation, and extraction processes of test samples. Furthermore, by combining different gene amplification fragments with fluorescent probes, rapid and efficient single-tube simultaneous detection is possible, significantly increasing detection throughput. The internal standard selected is TOP3A, which is stably present as a single copy in the genome.

[0082] 6. This invention can not only detect exon 7 deletion of the SMN1 gene, but also distinguish exon 8 deletion of the SMN1 gene, which is beneficial for assisting in the diagnosis of exon 7 deletion while ensuring the stability of the system.

[0083] 7. Compared with the probe method in the prior art, the primer method of the present invention (combining amplification arrest mutation system PCR (ARMS-PCR) and competitive primer PCR (COP-PCR)) can solve the problems of the above probe amplification being extremely unstable and having poor reproducibility. Moreover, the kit prepared by the present invention based on the designed primer-probe combination has high sensitivity, good specificity, and high stability (precision).

[0084] 8. The judgment method of the present invention introduces a relative quantitative method (△△Ct=△Cts-△Cta), which can eliminate the influence of different reagents, instruments and well positions, and further improve the ability to distinguish between single copies and double copies. Attached Figure Description

[0085] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0086] Figure 1 The amplification curve of SMN1 sample 2 in Example 4;

[0087] Figure 2 is the amplification curve of SMN1 sample 3 in Example 4;

[0088] Figure 3 The amplification curve of SMN1 sample 9 in Example 4;

[0089] Figure 4 is the amplification curve of SMN2 sample 9 in Example 4;

[0090] Figure 5 This is the amplification curve of SMN2 sample 1 in Example 4. DETAILED DESCRIPTION

[0091] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the scope of protection of the present invention is not limited to the following embodiments; any adjustments and improvements made under the concept of the present invention are all within the scope of protection of the present invention.

[0092] Example 1: Design and optimization of specific primers and probes

[0093] 1. Design of specific primers and probes

[0094] The SMN1 gene, SMN2 gene, and TOP3A gene were downloaded through NCBI search, and specific amplification primers and molecular beacons or Taqman probes for the above sequence sites were designed using Beacon Designer or Primer 3 software, respectively, and synthesized by Shanghai Shuoying Biotechnology Co., Ltd.

[0095] The reference sequence of the SMN1 gene on NCBI is: NC_000005.10, REGION:70924941..70966375;

[0096] The reference sequence of the SMN2 gene on NCBI is: NC_000005.10, REGION:70049523..70090528;

[0097] The reference sequence of TOP3A gene on NCBI is: NC_000017 REGION: complement(18271428..18314994);

[0098] The designed primer sequences are shown in Table 1:

[0099] Table 1

[0100]

[0101] The specific sequence is as follows:

[0102] SEQ ID No.1: GCTAT+CTATGT+CTATATAG*;

[0103] SEQ ID No.2: ATATATAGCTATCTATATCTATATAGCTATTTTT;

[0104] SEQ ID No.3: ACCTTCCTTCTTTTTGATTTTGTCTG;

[0105] SEQ ID No.4: TAACTTCCTTTATTTTCCTTACAGGG;

[0106] SEQ ID No.5: GCTAT+CTATAT+CTATATAG*;

[0107] SEQ ID No.6: ATATATAGCTATCTATGTCTATATAGCTATTTTT;

[0108] SEQ ID No.7: ACCTTCCTTCTTTTTGATTTTGTCTA;

[0109] SEQ ID No.8:GAAAAACCATCTGTAAAAGACTGG;

[0110] SEQ ID No.9:TCTGTAAAAGACTGAGGTGGG;

[0111] SEQ ID No.10: CACATTCAAATTTTCTCAACT;

[0112] SEQ ID No.11: GGAGGCCAGCACGGTGGTGAGG;

[0113] SEQ ID No.12:GAAAAACCATCTGTAAAAGACTGA;

[0114] SEQ ID No.13:TCTGTAAAAGACTGGGGTGGG;

[0115] SEQ ID No.14: GAACAGCGACTGTACGAGTTTATTG;

[0116] SEQ ID No.15: CCTGCCCCTGAGCATCCT;

[0117] SEQ ID No.16: TCGCCATTCCTGGCTTGCTGC;

[0118] In this context, * indicates that the primer is a locked nucleotide-modified probe, +C indicates that the base position has been modified (i.e., the methylene bridge connecting the 2'-O atom and the 4'-C atom on the ribose ring of the base is "locked"), and other bases have not been modified;

[0119] The modification of the blocking oligonucleotide was terminated using a C3 spacer.

[0120] 2. Optimization of specific primers and probes

[0121] 2.1 Screening of specific primers and probes

[0122] In Table 1, SMN1-EXON7-R1, SMN2-EXON7-R1, SMN1-EXON8-F1, and SMN2-EXON8-F1 are the selected primers. The primers designed for ARMS primer selection are shown in Table 2. The selection process is as follows:

[0123] Table 2

[0124]

[0125] The primers used for screening that end in m (m1m2m3) are primers that introduce terminal mismatches at the penultimate base of the 3' end.

[0126] Results: Table 3

[0127]

[0128] The results are shown in Table 3. While the three screening primers (m1, m2, m3) for introducing mutation sites using the ARMS primer SMN1-EXON7-R1 could better distinguish between SMN2 and SMN1 (see SMN2 not amplified), their own amplification ability was reduced, with a Ct value delay of 3-10 compared to R1. Considering all factors, SMN1-EXON7-R1 was still chosen, as its Ct value differed from SMN2 by 11 cycles, representing a nearly 2000-fold difference in amplification efficiency. The primers used for amplifying SMN2 were similar, therefore SMN2-EXON7-R1 was also selected.

[0129] Results: Table 4

[0130]

[0131] The results are shown in Table 4. The difference in Ct values ​​between SMN1 and SMN2 using SMN1-EXON8-F1 was 6, and the amplification efficiency difference was approximately 50-100 times. The primers with introduced mutations (m1m2m3) did not show an increase in resolving power, but the overall amplification efficiency decreased; therefore, the unmutated primer SMN1-EXON8-F1 was still selected. Similar results were observed with primers used to detect SMN2; therefore, the unmutated primer SMN2-EXON8-F1 was also selected.

[0132] Therefore, after ARMS primer screening, SMN1-EXON7-R1, SMN2-EXON7-R1, SMN1-EXON8-F1, and SMN2-EXON8-F1 were finally selected.

[0133] 2.2 Introduction of LNA nucleotides

[0134] Table 1 shows the introduction of LNA nucleotides in the primers, and Table 5 shows the LNA nucleotides used for comparison.

[0135] Table 5

[0136]

[0137] Results: Table 6

[0138]

[0139] The results are shown in Table 6: After the introduction of LNA, the amplification efficiency increased and the Ct value of SMN1 was advanced; the resolution also increased and the difference in Ct values ​​between SMN1 and SMN2 increased. Therefore, LNA nucleotides were selected to be introduced into the specific primers.

[0140] 2.3. Addition of Blocker

[0141] Table 1 shows the increase in the number of blocks in the primers and probes, as shown in Table 7.

[0142] Table 7: Comparison of differences in adding Blockers

[0143]

[0144] The results showed that adding a blocker could slightly improve the resolution, so we chose to add a blocker to the primer probe.

[0145] In summary, this example screened specific primers and probes, introduced LNA nucleotides, and added blockers to ultimately design and optimize the primer probes listed in Table 1.

[0146] Example 2: Nucleic acid extraction from samples

[0147] (1) Clinical sample collection, preservation and transportation: peripheral venous blood, EDTA anticoagulation method. Samples that can be tested within 24 hours can be stored at 4℃; samples that cannot be tested within 24 hours should be stored at -70℃ or below (if there is no -70℃ storage condition, temporarily store at -20℃). The sample should not be frozen and thawed more than 5 times, otherwise it will affect the test results.

[0148] (2) Nucleic acid extraction: Nucleic acid extraction of samples was performed using the Qiagen QIAamp DNA Blood Mini Kit according to the instructions. The extracted human genomic DNA should have an OD260nm / OD280nm ratio between 1.7 and 2.0. The DNA concentration should be between 1 ng / uL and 100 ng / uL. If the concentration exceeds the range, it should be extracted again, diluted, or discarded.

[0149] The sample information and nucleic acid concentration information are shown in Table 8 below:

[0150] Table 8

[0151]

[0152] Example 3 Detection of extracted sample nucleic acid

[0153] 1. Prepare the amplification reaction system shown in Table 11 using the detection solutions from Table 9 or 10:

[0154] Table 9. Detection Solution Preparation Table (Exon 7 / 8 Detection Solution)

[0155]

[0156] Taking the SMN1 gene as an example

[0157] Table 10 Detection Solution Preparation Table (Exon 7 / 8 Detection Solution)

[0158]

[0159] Taking the SMN2 gene as an example

[0160] Table 11 Preparation of Amplification Reaction System

[0161]

[0162] Taking the SMN1 gene as an example

[0163] Perform RT-PCR amplification according to the following procedure: 97℃ for 5 min; 97℃ for 10 s, 58℃ for 45 s, for a total of 45 cycles.

[0164] 2. The kit also includes a normal control, a single-copy control, and a deletion control, all of which are plasmids purchased from Qingke Biotechnology. They can be used after dilution to 10^7 using TE buffer. The normal control, single-copy control, and deletion control are prepared by mixing three different plasmids—SMN1 (SEQ ID No. 30), SMN2 (SEQ ID No. 31), and TOP3A (SEQ ID No. 32)—in the following ratios: In the normal control, the copy number ratio of internal control gene:SMN1 gene:SMN2 gene is 2:2:2; in the single-copy control, the copy number ratio is 2:1:1; and in the deletion control, the copy number ratio is 2:2. The blank control is pure water.

[0165] Normal controls, single-copy controls, missing controls, and blank controls were prepared and tested using the same method as the sample nucleic acid.

[0166] Example 4 Results Analysis

[0167] Based on the ΔCt values ​​and ΔΔCt calculations for different targets, the results are shown in Table 12:

[0168] Table 12 Result Interpretation

[0169]

[0170] Taking the SMN1 gene as an example

[0171] Tube A contains exon 7 of the SMN1 gene; tube B contains exon 8 of the SMN1 gene.

[0172] △△Ct=△Cts-△Cta

[0173] The amplification curves corresponding to samples 2, 3, and 9 are as follows: Figure 1-3 As shown; where, Figure 1 SMN1 is a copy of exon 7 (i.e., SMN1 carrier, and the spouse needs to be screened). Figure 2 SMN1 is 2 copies or more of exon 7 (i.e., SMN1 is normal, no need to screen the spouse). Figure 3 The SMN1 in the patient is 0 copies of EXON7 exon (i.e., SMN1 is deleted, and the SMN2 copy needs to be tested).

[0174] Six SMA patients (SMN10 copies) were selected for SMN2 copy number testing: samples 1, 5, 9, 10, 17, and 20. The results are shown in Table 13.

[0175] Table 13

[0176]

[0177] The C tube is exon 7 of the SMN2 gene; the D tube is exon 8 of the SMN2 gene.

[0178] The amplification curves corresponding to sample 9 and sample 1 are as follows: Figure 4-5 As shown, Figure 4 SMN2 is the first copy of EXON7 exon 1 (if SMN1 is missing, the disease may be very serious), Figure 5 SMN2 is EXON7 exon 2 or more copies (if SMN1 is normal, the disease may be mild).

[0179] Example 5 Specificity Analysis

[0180] The method of the present invention is used to detect the four cases where the number of copies of SMN2 (when detecting SMN1 gene) and SMN1 (when detecting SMN2 gene) is 3, 4, 5, and 6, and there is no crossover.

[0181] The method of this invention does not cross-contaminate common pathogens such as HBV, HCV, cytomegalovirus, and herpes simplex virus type 1 (HSV1).

[0182] The specific details are shown in Table 14.

[0183] Table 14

[0184]

[0185] Example 6 Sensitivity Analysis

[0186] Detection limit exploration (taking the copy number of exon 7 of the SMN1 gene as an example)

[0187] Samples containing human nucleic acid were diluted to 10, 5, 2, 1, and 0.5 ng / uL, with three replicates for each concentration. The lowest concentration (100%, 3 / 3) was used as the set limit of detection for validation, and the results are shown in Table 15.

[0188] Table 15: Detection Limit Exploration

[0189]

[0190] When sample 1 was diluted to 0.5 ng / uL, an interpretation error occurred. Therefore, a detection limit of 1 ng / uL was set for verification.

[0191] The sample containing human nucleic acid was diluted and amplified by multiplex quantitative PCR to the lower limit of detection (LOD), which was 1 ng / µL. Twenty replicates were performed; a result of more than 95% (19 / 20) positive was considered acceptable.

[0192] L1: Take 20 μL of 1 copy of SMN1 nucleic acid and add it to TE solution to obtain 1 ng / μL;

[0193] L2: Take 20 μL of 2 copies of SMN1 nucleic acid and add it to TE solution to obtain 1 ng / μL;

[0194] L3: Take 20 μL of 0 copies of SMN1 nucleic acid and add it to TE solution to obtain 1 ng / μL;

[0195] Exon 7 of SMN1;

[0196] As shown in Table 16:

[0197] Table 16: Detection Limit Validation

[0198]

[0199] L4: Take 20 μL of 2 copies of SMN2 nucleic acid and add it to TE solution to obtain 1 ng / μL;

[0200] L5: Take 20 μL of 1 copy of SMN2 nucleic acid and add it to TE solution to obtain 1 ng / μL;

[0201] Exon 7 of SMN2;

[0202] As shown in Table 17:

[0203] Table 17

[0204]

[0205] Example 7 Precision Analysis

[0206] Precision (taking exons 7 and 8 of the SMN1 gene as an example) was determined by 2 ng / uL repeated 10 times. A CV value of less than 5% was considered passing. The results are shown in Table 18.

[0207] Table 18

[0208]

[0209] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A primer and probe combination for detecting SMN1 and SMN2 gene copy number variation, characterized in that: The primer and probe combination includes the following sequences: The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN1 gene are shown in SEQ ID No. 1-3, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN1 gene is shown in SEQ ID No. 4; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON7 site of the SMN2 gene are shown in SEQ ID No. 5-7, respectively; the nucleotide sequence of the probe for detecting the EXON7 site of the SMN2 gene is shown in SEQ ID No. 4; The nucleotide sequences of the upstream primer, blocker, and downstream primer used to detect the EXON8 site of the SMN1 gene are shown in SEQ ID No. 8-10, respectively; The nucleotide sequence of the probe used to detect the EXON8 site of the SMN1 gene is shown in SEQ ID No. 11; The nucleotide sequences of the upstream primer, blocker, and downstream primer for detecting the EXON8 site of the SMN2 gene are shown in SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. 10, respectively; the nucleotide sequence of the probe for detecting the EXON8 site of the SMN2 gene is shown in SEQ ID No. 11; The nucleotide sequences of the primers used to detect the internal standard gene TOP3A are shown in SEQ ID No.14-15 respectively; the nucleotide sequence of the probe used to detect the internal standard gene TOP3A is shown in SEQ ID No.

16.

2. The primer and probe combination according to claim 1, characterized in that: The 5' and 3' ends of the probe carry a fluorescent group and a quenching group, respectively, wherein the fluorescent group is selected from one of FAM, HEX, VIC, TET, TAMRA, ROX, CY3.5, and CY5; and the quenching group is selected from one of BHQ1, BHQ2, BHQ3, DABCYL, and MGB.

3. Use of the primer and probe combination as claimed in claim 1 or 2 in the preparation of a kit for detecting SMN1 and SMN2 gene copy number variation.

4. A kit for detecting SMN1 and SMN2 gene copy number variation, characterized in that: The kit comprises a detection solution and an enzyme mixture; the detection solution comprises the primer and probe combination as claimed in claim 1 or 2, and the concentration of each primer or probe in the primer and probe combination is 0.2-0.4 μM.

5. The kit according to claim 4, characterized in that The detection liquid includes SMN1 gene E7 detection liquid, SMN1 gene E8 detection liquid, SMN2 gene E7 detection liquid and SMN2 gene E8 detection liquid; In the SMN1 gene E7 detection solution, the concentration of the primers shown in SEQ ID No.1, SEQ ID No.3, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the blockers or probes shown in SEQ ID No.2, SEQ ID No.4, and SEQ ID No.16 is 0.2 μM; In the SMN2 gene E7 detection solution, the concentration of the primers shown in SEQ ID No.5, SEQ ID No.7, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the blockers or probes shown in SEQ ID No.6, SEQ ID No.4, and SEQ ID No.16 is 0.2 μM; In the SMN1 gene E8 detection solution, the concentration of the primers shown in SEQ ID No.8, SEQ ID No.10, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the blockers or probes shown in SEQ ID No.9, SEQ ID No.11, and SEQ ID No.16 is 0.2 μM; In the SMN2 gene E8 detection solution, the concentration of the primers shown in SEQ ID No.12, SEQ ID No.10, SEQ ID No.14, and SEQ ID No.15 is 0.4 μM; the concentration of the blockers or probes shown in SEQ ID No.13, SEQ ID No.11, and SEQ ID No.16 is 0.2 μM.

6. The kit according to claim 4, characterized in that The detection solution also includes PCR buffer, 3.2-3.4 mM MgCl2 and 0.1-0.4 mM dNTPs; the dNTPs include dATP, dTTP, dCTP, dGTP and dUTP.

7. The kit according to claim 4, characterized in that The enzyme mixture includes DNA polymerase.

Images