ANOS1 gene molecular marker related to duck egg yolk ratio and application of ANOS1 gene molecular marker

Abstract

The invention discloses an ANOS1 gene molecular marker related to duck egg yolk ratio and application of the ANOS1 gene molecular marker, and belongs to the technical field of biology, the molecular marker is located at the 131855974 basic group of a No.1 chromosome of a duck reference genome, the site of the molecular marker has A / A and A / G polymorphism, the egg yolk ratio of a site A / A genotype individual is higher than that of a site A / A genotype individual and that of a site G / G genotype individual, and the egg yolk ratio of a site B / A genotype individual is higher than that of a site B / G genotype individual. The egg yolk ratio of A / G genotype individuals is higher than that of G / G genotype individuals, and the molecular marker is used for screening the high-quality duck egg yolk ratio index and improving the high-quality duck egg yolk rate, can be applied to early selection of high-quality ducks, and is beneficial to accelerating the breeding progress, improving the breeding accuracy and reducing the breeding cost and the production cost; the method has great economic application value and breeding value for high-quality ducks.

Description

Technical Field

[0001] The invention relates to an ANOS1 gene molecular marker related to duck egg yolk ratio and application thereof, belonging to the field of biotechnology. Background Art

[0002] Poultry eggs are one of the most easily available and favorite foods for humans. They are nutritious and inexpensive. They are rich in nutrients such as protein, fat, fatty acids, minerals and vitamins, and are one of the important animal-derived foods for humans. Egg yolks are rich in fat-soluble vitamins A, D, E, K, as well as nutrients such as lutein and zeaxanthin. Lutein and zeaxanthin are beneficial to vision health. Under normal circumstances, the yolk ratio of poultry eggs is generally around 30%-33%. Most of the nutritional and health-care ingredients in poultry eggs are in the yolk. Increasing the yolk ratio is equivalent to increasing the overall nutritional value of poultry eggs. In addition, poultry eggs with a high yolk ratio are preferred for processing mayonnaise, egg yolk powder, and egg yolk liquid. At the same time, the yolk ratio is also related to the hatching ability of poultry eggs. During the incubation process, the yolk provides nutrition for embryonic development. Poultry eggs with a larger yolk weight tend to have a higher hatching rate.

[0003] In egg-laying duck production, duck eggs are usually made into a variety of duck egg products, such as salted duck eggs and preserved eggs. The yolk ratio directly affects the quality and taste of the final product. Egg processing companies will select duck eggs with a suitable yolk ratio for egg processing based on market demand and supply the market. The yolk ratio is the abbreviation of the ratio of the yolk weight to the egg weight. The measurement method is to break part of the eggshell, manually separate the egg white and yolk, weigh them, and then calculate. In variety breeding or production, the yolk ratio of duck eggs produced by laying ducks is measured and then female ducks are selected for breeding or production. The cycle is long, and it is necessary to wait until the laying ducks start laying eggs and lay eggs stably before measurement and selection; it is also costly, and the data of a single measurement is not representative. It is necessary to measure multiple times to obtain accurate data for selection; the selection efficiency is low. Under normal circumstances, gonadotropins act on the gonads, promote the development of the gonads and the secretion of sex hormones, and improve the reproductive performance of livestock and poultry. The hypothalamus secretes gonadotropin-releasing hormone (GnRH), and GnRH stimulates the pituitary gland to secrete gonadotropins, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH). The ANOS1 gene, also known as the KAL1 gene, encodes an extracellular matrix protein that regulates the release of hypothalamic GnRH, and then regulates the level of gonadotropins (FSH and LH) secreted by the pituitary gland. Currently, there are no reports on the use of the ANOS1 gene or technologies related to the ANOS1 gene to detect the yolk ratio of duck eggs. Summary of the invention

[0004] The purpose of the present invention is to solve the deficiencies in the prior art and to provide an ANOS1 gene molecular marker related to duck egg yolk ratio and its application, which can quickly and accurately identify duck egg yolk ratio.

[0005] In order to achieve the above object, the present invention is achieved through the following technical solutions:

[0006] In the first aspect, the present invention provides an ANOS1 gene molecular marker related to the duck egg yolk ratio, wherein the molecular marker is located at base 131855974 of chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the molecular marker site has A / A and A / G polymorphisms, and the egg yolk ratio of ducks with A / A genotype at the site is higher than that of ducks with A / G genotype.

[0007] The nucleotide sequence of the ANOS1 gene (Anas platyrhynchos domestica) is shown in SEQ ID NO:3.

[0008] Furthermore, the yolk ratio of ducks with the A / G genotype was higher than that of ducks with the G / G genotype.

[0009] In a second aspect, the present invention provides the use of the molecular marker in detecting duck egg yolk ratio.

[0010] In a third aspect, the present invention provides a primer pair for detecting the molecular marker, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2.

[0011] In a fourth aspect, the present invention provides the use of the primer pair in detecting duck egg yolk ratio.

[0012] In a fifth aspect, the present invention provides a method for detecting duck egg yolk ratio, comprising the following steps:

[0013] Step S1, using a duck DNA sample to be tested to perform PCR amplification using a duck DNA specific primer pair to obtain an amplified product, the duck DNA specific primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2;

[0014] Step S2, performing Sanger sequencing on the amplified product;

[0015] Step S3, determining the molecular marker genotype of the target site according to the sequencing result of step S2.

[0016] Furthermore, in step S1, the final concentration of the PCR amplification reaction system is 25 μl, specifically:

[0017]

[0018] The reaction conditions of PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 60 sec, for a total of 40 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0019] Furthermore, the judgment standard in step S3 is that the yolk ratio of ducks with A / A genotype at the ANOS1 gene SNP site is higher than that of ducks with A / G genotype and ducks with G / G genotype, and the yolk ratio of ducks with A / G genotype at the site is higher than that of ducks with G / G genotype.

[0020] The present invention has the following beneficial effects: (1) The molecular markers and molecular marker primer pairs provided by the present invention can efficiently and quickly identify the duck egg yolk ratio trait, providing a scientific basis for the early breeding of high-quality ducks. In addition, the detection method disclosed by the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genomic breeding technology.

[0021] (2) The gene molecular marker in the present invention is used to increase the yolk ratio of duck eggs, improve the selection efficiency of female ducks, quickly meet the market requirements for the yolk ratio of duck eggs, and improve the production efficiency of the enterprise. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the Manhattan plot of the GWAS analysis of duck egg yolk ratio at 40 weeks of age.

[0023] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes of the ANOS1 gene.

[0024] Figure 3 This is the phenotypic distribution diagram of individuals with three genotypes of the chr1:131855974 molecular marker.

[0025] SEQ ID NO: 1: GGGCTTATTAGCAACATC

[0026] SEQ ID NO: 2: CAGATTCCTACTGGGTTT

[0027] SEQ ID NO: 3:

[0028] GGGCTTATTAGCAACATCATTAGAAACTGGAGCTGCAAAGTGTGAGAGACAAAGGGAGA

[0029] GCAAAATGAAGCAAAAGGTCTGGGCTGGGCTCGATATGTCTTTGCACACATTCATTGGA

[0030] TCAGGATCTGTATTTCAGTTATCCCACTCATTTTGGGACACCACATGGATAAAAAGCT

[0031] TGTTTAGGAAGAGAACGAGACAAGTAGACATGCCTTTCTTTTCTTCCACATGCACAACT

[0032] AGATAAAAACCCAGTAGGAATCTG DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with the embodiments, but they are not intended to limit the present invention.

[0034] Example 1

[0035] In this example, the egg-yolk ratio of Jinding ducks at 40 weeks of age was measured, and SNP genotyping was performed using whole genome resequencing technology. The ANOS1 gene molecular marker significantly associated with the egg-yolk ratio was screened through whole genome association analysis. The results are as follows: Figure 1 shown.

[0036] In this example, the following experiments were performed to identify and apply the ANOS1 gene molecular markers related to duck egg yolk ratio.

[0037] 1. Phenotypic and genotypic testing

[0038] (1) Experimental materials and yolk ratio phenotype determination

[0039] 548 Jinding female ducks were selected as experimental animals and raised under the same feeding conditions with free access to food and water. At 40 weeks of age, the egg yolk ratio of each duck was recorded in turn as the phenotypic data of duck egg yolk ratio.

[0040] (2) Extraction of genomic DNA

[0041] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0042] (3) PCR amplification

[0043] The above-extracted genomic DNA was used as a template to amplify a fragment containing the SNP molecular marker at base 131855974 of duck chromosome 1.

[0044] Upstream primer: 5'-GGGCTTATTAGCAACATC-3' (SEQ ID NO: 1)

[0045] Downstream primer: 5'-CAGATTCCTACTGGGTTT-3' (SEQ ID NO: 2)

[0046] The final concentration of the reaction system (25 μl) is:

[0047]

[0048] The reaction conditions of PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 60 sec, for a total of 40 cycles; extension at 72°C for 2 min; storage at 20°C; 10 μl was used for agarose detection, and a single target band of the ANOS1 gene with a length of 260 bp was amplified, containing the 131855974th base of duck chromosome 1.

[0049] (4) Sequencing verification and genotyping

[0050] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak graph was as follows: Figure 2 , Figure 3 shown.

[0051] 2. Results Analysis

[0052] 511 female Jinding ducks with clear records of yolk ratio phenotype at 40 weeks of age were selected for correlation analysis. The t.test test function of R4.0 software was used for statistical test, and the pairwise average comparison mode was selected to perform statistical test on the genotype and yolk ratio of the experimental duck group. P<0.05 indicated significant difference, and P<0.01 indicated extremely significant difference. The results are shown in Table 1.1. Among the tested individuals, there were 299 A / A genotypes, 108 A / G genotypes, and 104 G / G genotypes of the ANOS1 gene. The yolk ratio of the three genotypes at 40 weeks of age was extremely different (p<0.01). The average yolk ratio of the A / A genotype individuals at 40 weeks of age was 27.11, which was significantly higher than that of the A / G and G / G genotype individuals (p<0.01), 1.32 higher than that of the A / G genotype individuals, and 2.54 higher than that of the G / G genotype individuals, respectively. The average yolk ratio of A / G genotype individuals was 25.79, which was significantly higher than that of G / G genotype individuals (p<0.01), and 1.22 higher than that of G / G genotype individuals. The results showed that the molecular marker of duck ANOS1 gene was significantly correlated with duck yolk ratio. According to the actual breeding goals, ANOS1 gene A / A genotype individuals can be selected to increase duck yolk ratio, or ANOS1 gene G / G genotype individuals can be selected to reduce duck yolk ratio, improve the overall yolk ratio uniformity, improve breeding efficiency, and meet market demand.

[0053] Table 1. Association analysis between the molecular marker at base 131855974 on chromosome 1 and egg yolk ratio

[0054] genotype Number / piece Yolk ratio at 40 weeks (%) Standard Deviation CV A / A 299 <![CDATA[35.11 a ]]> 2.70 2.58％ A / G 108 <![CDATA[31.79 b ]]> 1.65 2.53％ G / G 104 <![CDATA[28.57 c ]]> 2.73 2.97％

[0055] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0056] The above shows and describes the basic principles, main features and advantages of the present invention. However, the above is only a specific embodiment of the present invention, and the technical features of the present invention are not limited thereto. Any other implementation methods derived by any technician in the field without departing from the technical solution of the present invention should be included in the patent scope of the present invention.

Claims

1. A molecular marker of the ANOS1 gene associated with duck egg yolk ratio, characterized in that: The molecular marker is located at base 131855974 of chromosome 1 of the duck reference genome. The molecular marker site has A / A and A / G polymorphisms, and the yolk ratio of ducks with A / A genotype is higher than that of ducks with A / G genotype.

2. According to the ANOS1 gene molecular marker related to duck egg yolk ratio according to claim 1, the egg yolk ratio of ducks with A / G genotype at the site is higher than that of ducks with G / G genotype.

3. Use of the molecular marker described in claim 1 in detecting duck egg yolk ratio.

4. A primer pair for detecting the molecular marker according to claim 1, characterized in that: It comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown as SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO:

2.

5. Use of the primer pair described in claim 4 in detecting duck egg yolk ratio.

6. The use according to claim 3 or 5, characterized in that: The detection method includes the following steps: Step S1, using a duck DNA sample to be tested to perform PCR amplification using a duck DNA specific primer pair to obtain an amplified product, the duck DNA specific primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2; Step S2, performing Sanger sequencing on the amplified product; Step S3, determining the molecular marker genotype of the target site according to the sequencing result of step S2.

7. The use according to claim 6, characterized in that: In step S1, the final concentration of the reaction system for PCR amplification is 25 μl, specifically: The reaction conditions of PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 60 sec, for a total of 40 cycles; extension at 72°C for 2 min; and storage at 20°C.

8. The use according to claim 6, characterized in that: The judgment standard in step S3 is that the yolk ratio of ducks with A / A genotype at the ANOS1 gene SNP site is higher than that of ducks with A / G genotype and ducks with G / G genotype, and the yolk ratio of ducks with A / G genotype at the site is higher than that of ducks with G / G genotype.

Images