Application of Bcor and Zc3h12a in prevention and treatment of chronic infection

Abstract

The invention discloses an application of Bcor and Zc3h12a in prevention and treatment of chronic infection. The invention provides any one of the following applications of a reagent targeting a Bcor gene or an expression product thereof or a combination of the reagent targeting the Bcor gene or the expression product thereof and a reagent targeting a Zc3h12a gene or an expression product thereof: (i) an application in preparation of a drug for preventing and / or treating chronic infection; (ii) application in preparation of a reagent for enhancing the chronic infection resistance of the T cells; (iii) use in the preparation of an agent for preventing and / or reversing T cell depletion.

Description

Technical Field

[0001] The invention belongs to the technical field of immune cells, and particularly relates to uses of Bcor and Zc3h12a in preventing and treating chronic infections. Background Art

[0002] During chronic viral infection, T cells that recognize viral antigens enter a low-function state called exhaustion, i.e., T cell exhaustion. Exhausted T cells have reduced proliferation capacity, weakened killing capacity, reduced cytokine secretion, and high expression of various immunosuppressive receptors (such as PD-1, etc.), which ultimately leads to reduced T cell antiviral ability and the inability of the body to completely eliminate the virus. Preventing, reducing and / or reversing T cell exhaustion is an important way to enhance antiviral ability. Currently, the main way to prevent, reduce and / or reverse T cell exhaustion is to block inhibitory receptors on the surface of T cells with antibodies, but this method has not yet achieved significant results in chronic viral infections.

[0003] Therefore, preventing, reducing and / or reversing T cell exhaustion / damage and restoring T cell effector function after or during chronic infection, thereby effectively preventing or treating chronic infection, remains to be further studied. Summary of the invention

[0004] Problem that the invention aims to solve

[0005] The present invention modifies the fate of antigen-specific T cells targeting pathogens (such as viruses) through gene editing, effectively preventing and / or reversing the state of T cell exhaustion, enhancing T cell survival, stemness and function, and improving the ability of T cells to resist chronic infections (such as chronic viral infections), and can significantly reduce the titer of chronic viruses.

[0006] Solutions for solving problems

[0007] The first aspect of the present invention provides any of the following uses of an agent targeting the Bcor gene or its expression product or a combination of an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product:

[0008] (i) Use in the preparation of a medicament for preventing and / or treating chronic infections;

[0009] (ii) use in the preparation of an agent for enhancing the ability of T cells to resist chronic infection;

[0010] (iii) Use in the preparation of an agent for preventing and / or reversing T cell exhaustion.

[0011] In some embodiments, the T cells comprise naive T cells, CD4 + T cells, CD8+ at least one of T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric T cells, and antigen-specific T cells;

[0012] Optionally, the T cells comprise activated T cells;

[0013] Optionally, the T cells comprise antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against pathogens causing chronic infection;

[0014] Optionally, the T cells comprise CD8 + T cells;

[0015] Optionally, said T cells comprise exhausted T cells.

[0016] In some embodiments, the chronic infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection;

[0017] Preferably, the chronic infection comprises a viral infection.

[0018] In some embodiments, the T cells are T cells from a subject; and / or, the chronic infection is a chronic infection in a subject;

[0019] Optionally, the subject is a human or a non-human animal.

[0020] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product comprises at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex and a small molecule inhibitor;

[0021] Optionally, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule;

[0022] Optionally, the polypeptide comprises at least one of an antibody or an antigen-binding fragment thereof, an artificial zinc finger nuclease, and a TALEN system;

[0023] Optionally, the ribonucleoprotein complex comprises a CRISPR / cas system.

[0024] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product includes an agent used in any one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology.

[0025] The second aspect of the present invention provides a modified T cell, wherein the modified T cell is a T cell treated with an agent targeting the Bcor gene or its expression product, or the modified T cell is a T cell treated with an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product;

[0026] Optionally, the T cells comprise activated T cells;

[0027] Optionally, the T cells comprise antigen-specific T cells;

[0028] Optionally, the T cells comprise CD8 + T cells;

[0029] Optionally, said T cells comprise exhausted T cells.

[0030] In some embodiments, the antigen-specific T cells are antigen-specific T cells directed against pathogens that cause chronic infections;

[0031] Optionally, the chronic infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection;

[0032] Preferably, the chronic infection comprises a viral infection;

[0033] Optionally, the chronic infection is a chronic infection in a subject.

[0034] The third aspect of the present invention provides use of the modified T cells according to the second aspect of the present invention in the preparation of a medicament for preventing and / or treating chronic infection.

[0035] The fourth aspect of the present invention provides a composition comprising at least one selected from the following (a) to (c):

[0036] (a) an agent targeting the Bcor gene or its expression product;

[0037] (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and,

[0038] (c) The modified T cell according to the second aspect of the present invention.

[0039] Optionally, the composition is a pharmaceutical composition, which further comprises a pharmaceutically acceptable carrier.

[0040] Effects of the Invention

[0041] The present invention achieves the purpose of enhancing the ability of T cells to resist chronic infection (such as chronic viral infection) by gene editing of antigen-specific T cells of chronically infected pathogens (such as viruses). By knocking out the Bcor gene or knocking out the Bcor and Zc3h12a genes at the same time, the proliferation ability, stemness and function of T cells exhausted during chronic infection, especially during chronic viral infection, are greatly improved, and the ability to resist pathogens (viruses) is enhanced, such as reducing viral titers. The present invention solves the problems of weak proliferation, low stemness, and functional defects of T cells during chronic infection, such as chronic viral infection, and will effectively improve the ability of T cells to resist chronic infection, such as anti-viral infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 . Simultaneous knockout of Bcor and Zc3h12a affects CD8 + There was no significant effect on the expansion and persistence of T cells

[0043] Figure 1 A in the figure is a schematic diagram of the experimental design. Cas9 + P14 cells were activated and transduced with retrovirus expressing non-targeting sgRNA with GFP marker (sgControl) or indicated sgRNA with Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed at a 1:1 ratio and co-transferred to Cas9 infected with LCMVArmstrong one day before cell adoptive transfer. + In B6 mice, GFP and Thy1.1 double-positive P14 cells in blood and spleen were detected by flow cytometry. Figure 1 Figure B shows the dynamics of Thy1.1-positive P14 cells in the blood during LCMV Armstrong infection (n=5 mice per group). Representative images of GFP+ and Thy1.1-positive P14 cells in the spleen 36 days after infection are shown ( Figure 1 C) and statistical analysis ( Figure 1 D) (n=5 mice per group). Figure 1 In B and D, data represent mean ± standard error (mean ± SEM); Figure 1 B and F in the figure are two-way ANOVA multiple-comparisons test. Figure 1 The D in the figure is a two-tailed paired Student's t test.

[0044] Figure 2.Concurrent knockout of Bcor and Zc3h12a enhances CD8 expression during chronic infection with LCMV clone 13 virus + T cell expansion capacity, persistence and stemness

[0045] Figure 2 A in the figure is a schematic diagram of the experimental design. Cas9 + P14 cells were activated and transduced with retrovirus expressing non-targeting sgRNA with a GFP marker (sgControl) or the indicated sgRNA with a Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed at a 1:1 ratio and co-transferred to Cas9 infected with LCMV clone 13 one day before cell adoptive transfer. + In B6 mice, GFP and Thy1.1 double-positive P14 cells in blood and spleen were detected by flow cytometry. Figure 2 Figure B shows the dynamics of Thy1.1-positive P14 cells in the blood during LCMV clone 13 infection (n=5 mice per group). Figure 4 shows the GFP expression in the spleen at 36 days after infection. + Representative images of Thy1.1-positive P14 cells ( Figure 2 C) and statistical analysis ( Figure 2 D) (n=5 mice per group). Figure 2 Panel E shows a schematic diagram of the experimental design for secondary transfer of P14 cells. Figure 2 Panel F shows the kinetics of Thy1.1+P14 cells in the blood after LCMV clone 13 infection (n=4 mice per group). Figure 2 In B, D, and F, data represent mean ± standard error (mean ± SEM); Figure 2 B and F in the figure are two-way ANOVA multiple-comparisons test. Figure 2 The D in the figure is a two-tailed paired Student's t test.

[0046] Figure 3 . Simultaneous knockout of Bcor and Zc3h12a enhances CD8 + T cell survival and function

[0047] Figure 3 A in the figure is the experimental design diagram. The activated Cas9 is infected with a retrovirus expressing the indicated sgRNA + P14 cells, LCMV clone 13 infected with Cas9 +One day after infection, P14 cells were adoptively transferred into B6 mice. Two weeks after infection, P14 cells in the spleen were analyzed by flow cytometry. Figure 3 B and C in the figure are Annexin V in P14 cells + Representative graph of the proportion of P14 cells ( Figure 3 B) and statistical analysis ( Figure 3 C) (n=3-6 mice per group). Figure 3 Panels D and E show P14 cells stimulated with 50 ng / ml phorbol 12-myristate 13-acetate (PMA) and 1 μM ionomycin for 4 hours and examined by intracellular staining. Figure 3 D in the figure is a representative curve and Figure 3 E in Figure Statistical analysis (n=3-4 mice per group). Data represent mean±SEM, P values ​​are shown, two-tailed unpaired Student's t-test.

[0048] Figure 4 . Simultaneous knockout of Bcor and Zc3h12a reverses CD8 T cell exhaustion during chronic viral infection and renders T cells TCF + TIM3 - Stem phenotype

[0049] Infect activated Cas9 with retrovirus expressing indicated sgRNA + P14 cells were infected with LCMV clone 13 Cas9 one day before adoptive transfer. + Two weeks after infection, the analysis was performed. Figure 4 A and B in the table are TCF1 + TIM3 - and TCF1 - TIM3 + Representative figure of flow cytometry analysis of P14 cell ratio ( Figure 4 A) and statistical analysis ( Figure 4 (B), n = 3-5 mice per group), data represent mean ± SEM, P values ​​are shown, one-way ANOVA multiple-comparisons test. Figure 4 C and D in the figure are single-cell sequencing analysis of 4 groups of P14 cells. Figure 4 Figure C shows the UMAP projections of single-cell sequencing of four groups of P14 cells. Eight cell clusters were defined and represented by different grayscales. Figure 4 D in FIG. 1 is the ratio of 8 clusters in 4 groups of P14 cells.

[0050] Figure 5.Simultaneous knockout of Bcor and Zc3h12a enhances T cell resistance to chronic viral infection and reduces viral titers

[0051] Figure 5 Figure A shows the experimental design. LCMV clone 13 infected Cd8 - / - Mice were adoptively transferred with indicated Cas9 after 30 days + After 40 days, P14 cells in the spleen were analyzed by flow cytometry, and viral titers in peripheral blood, liver, and lung were measured. Figure 5 Figures B and C show Thy1.1 in the spleen + Representative graph of flow cytometry analysis of P14 cell ratio ( Figure 5 B) and statistical analysis ( Figure 5 C) (n=3 mice per group). Figure 5 Virus titers in various organs in D, 6-8 mice per group. Figure 5 In C and D, data represent mean ± SEM, two-tailed unpaired Student's t test.

[0052] Figure 6 Inducible knockout of Bcor and Zc3h12a expression in exhausted T cells partially reversed T cell exhaustion during chronic infection with LCMV clone 13

[0053] Figure 6 Figure A shows the experimental design: Naive P14 cells from CD45.2 B6 mice with the indicated genotypes were transferred into CD45.1 / 2 B6 mice, which were infected with LCMV clone 13 one day later. Twenty-one days later, recipient mice were treated with tamoxifen to induce knockout of the indicated genes, with tamoxifen injected into the tail for 5 consecutive days. P14 cells were monitored in the peripheral blood of recipient mice by flow cytometry, and P14 cells were analyzed in the spleen 40 days after the initial injection of tamoxifen. Figure 6 Middle B shows the dynamics of P14 cells in the blood of recipient mice. Figure 6 C and D show representative images of P14 cells in the spleen of recipient mice ( Figure 6 C) and statistical analysis ( Figure 6 Middle D) (n=9 to 11 mice per group). Figure 6 Figures E and F show Ly108 in P14 cells in the spleen of recipient mice. + CD62L + Representative images of P14 cells ( Figure 6 E) and statistical analysis ( Figure 6 Middle (F) (n=9 to 11 mice per group). Figure 6 Figures G and H show TCF1 expression in P14 cells of recipient mice in the spleen + TIM3- Representative images of P14 cells ( Figure 6 G) and statistical analysis ( Figure 6 Middle H)

[0054] (n=9-11 mice per group). Figure 6 In B, D, F, and H, data are mean ± SEM, and P values ​​are shown. Figure 6 B is a two-way ANOVA multiple-comparisons test. Figure 6 D, F, and H are two-tailed unpaired Student's t-tests. DETAILED DESCRIPTION

[0055] Various exemplary embodiments, features and aspects of the present invention will be described in detail below. The word "exemplary" used here means "used as an example, embodiment or illustrative". Any embodiment described here as "exemplary" is not necessarily interpreted as being superior or better than other embodiments.

[0056] In addition, in order to better illustrate the present invention, numerous specific details are provided in the following specific embodiments. It should be understood by those skilled in the art that the present invention can be implemented without certain specific details. In other examples, methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the subject matter of the present invention.

[0057] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0058] In this specification, the word "may" means both performing a certain process and not performing a certain process.

[0059] In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", etc., mean that the specific elements (e.g., features, structures, properties and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0060] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoints numerical values ​​A and B.

[0061] In this specification, when the term "and / or" is used to connect two or more options, it should be understood to mean any one of the options or any two or more of the options.

[0062] In this specification, the term "immune cell" refers to any cell that plays a role in an immune response. Immune cells are of hematopoietic origin and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, dendritic cells, eosinophils, neutrophils, mast cells, basophils and granulocytes.

[0063] In this specification, the term "lymphocyte" refers to all immature, mature, undifferentiated and differentiated white lymphocyte populations, which include tissue-specific species and specialized species. By way of non-limiting example, the lymphocyte encompasses B cells, T cells, NKT cells and NK cells.

[0064] In this specification, "administering", "giving" and "treating" when applied to animals, humans, experimental subjects, cells, tissues, organs or biological fluids refer to the contact of an exogenous drug, therapeutic agent, diagnostic agent or composition with an animal, a human, a subject, a cell, a tissue, an organ or a biological fluid. "Administering", "giving" and "treating" can refer to, for example, treatment, pharmacokinetics, diagnosis, research and experimental methods. The treatment of cells includes contact of an agent with a cell, and contact of an agent with a fluid, wherein the fluid is in contact with the cell. "Administering", "giving" and "treating" also mean in vitro and ex vivo treatment of, for example, a cell by an agent, a diagnostic agent, a combination composition or by another cell. "Treatment" when applied to humans, veterinary medicine or research subjects refers to treatment, prevention or preventive measures, research and diagnostic applications.

[0065] In this specification, "treatment" means administering an internal or external therapeutic agent, such as a recombinant immune cell comprising the present invention, to a patient who has one or more symptoms of a disease, and the therapeutic agent is known to have a therapeutic effect on these symptoms. Typically, the therapeutic agent is administered in an amount effective to alleviate one or more symptoms of the disease in the treated patient or population, whether by inducing regression of such symptoms or inhibiting the development of such symptoms to any clinically measurable extent. The amount of the therapeutic agent that effectively alleviates any specific disease symptom (also referred to as a "therapeutically effective amount") can vary according to a variety of factors, such as the patient's disease state, age, and weight, and the ability of the drug to produce the desired therapeutic effect in the patient. Whether the disease symptoms have been alleviated can be evaluated by any clinical detection method commonly used by doctors or other professional health care personnel to evaluate the severity or progression of the symptoms.

[0066] In the present specification, the term "prevention" refers to preventive treatment of a subject who does not have a disease now or in the past but is at risk of developing a disease or who had a disease in the past and does not have a disease now but is at risk of recurrence of the disease.

[0067] In this specification, "effective amount" includes an amount sufficient to improve or prevent the symptoms or conditions of a medical condition. An effective amount also means an amount sufficient to allow or facilitate diagnosis. The effective amount for a particular patient or veterinary subject may vary depending on factors such as the condition to be treated, the patient's overall health, the method, route and dosage of administration, and the severity of side effects. An effective amount can be the maximum dose or dosage regimen that avoids significant side effects or toxic effects.

[0068] In this specification, a "therapeutically effective amount" is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or sufficient to delay or minimize one or more symptoms associated with a condition. A therapeutically effective amount refers to an amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a condition. The term "therapeutically effective amount" can include an amount that improves overall therapy; reduces or avoids symptoms, signs, or causes of a condition; and / or enhances the therapeutic efficacy of another therapeutic agent.

[0069] In this specification, a "prophylactically effective amount" is an amount sufficient to prevent a condition or one or more symptoms associated with a condition or to prevent its recurrence. A prophylactically effective amount refers to an amount of a therapeutic agent, alone or in combination with other agents, that provides a prophylactic benefit in preventing a condition. The term "prophylactically effective amount" may include an amount that improves overall prevention or enhances the prophylactic efficacy of another prophylactic agent.

[0070] In this specification, the term "pharmaceutically acceptable" (or "pharmacologically acceptable", "pharmaceutically usable") refers to molecular entities and compositions that do not produce adverse reactions, allergic reactions or other undesirable reactions when administered to animals or humans, as appropriate. The term "pharmaceutically acceptable carrier" as used herein includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic agents and absorption delaying agents, buffers, excipients, adhesives, lubricants, gels, surfactants, etc. that can be used as media for pharmaceutically acceptable substances.

[0071] In this specification, "BCOR gene" and "Bcor gene" can be used interchangeably unless otherwise specified. The "BCOR gene" is the BCOR gene of any target subject.

[0072] In this specification, "ZC3H12A gene" and "Zc3h12a gene" can be used interchangeably unless otherwise specified. The "ZC3H12A gene" is the "ZC3H12A gene" of any target subject.

[0073] In this specification, "stemness" is also called "stem cell characteristics", which means that cells have the ability to self-renew and differentiate into different cell types.

[0074] In this specification, "subject" or "host" refers to human or non-human animals, including mammals. For example, primates (such as humans, monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, mice and the like. "Subjects" or "hosts" include therapeutic and non-therapeutic types. "Subjects" or "hosts" include experimental animal models or animals used to produce biological molecules expressing therapeutic diseases, i.e., "non-therapeutic hosts" or "non-therapeutic subjects".

[0075] <Use of preventing and / or treating chronic infection, enhancing the ability of T cells to resist chronic infection, preventing and / or reversing T cell exhaustion>

[0076] In some aspects of the present invention, any of the following uses of an agent targeting the Bcor gene or its expression product or a combination of an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product is provided:

[0077] (i) Use in the preparation of a medicament for preventing and / or treating chronic infections;

[0078] (ii) use in the preparation of an agent for enhancing the ability of T cells to resist chronic infection;

[0079] (iii) Use in the preparation of an agent for preventing and / or reversing T cell exhaustion.

[0080] (gene, gene expression product)

[0081] In some embodiments, the expression product of the Bcor gene or Zc3h12a gene refers to various forms of molecules of the Bcor gene or Zc3h12a gene at various stages, such as but not limited to molecules produced by the Bcor gene or Zc3h12a gene during amplification, replication, transcription, splicing, processing, translation, and modification, such as cDNA, mRNA, precursor protein, mature protein, and fragments thereof.

[0082] In some embodiments, exemplary information of the Bcor gene and the Zc3h12a gene can be found in Table 1 below.

[0083] Table 1 Information of Bcor gene and Zc3h12a gene

[0084]

[0085] In the present invention, specifically, the human Bcor gene (Gene ID: 54880, updated on May 29, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 54880) and the mouse Bcor gene (Gene ID: 71458, updated on May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 71458) encode the transcriptional repressor BCOR in cells. The human Zc3h12a gene (Gene ID: 80149, updated on May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 80149) and the mouse Zc3h12a gene (Gene ID: 230738, updated on May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 230738) encode the protein ZC3H12A involved in mRNA degradation in cells. The above genes are all incorporated into the present invention by reference.

[0086] (Agents targeting genes or their expression products)

[0087] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can recognize and bind to the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can regulate the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can reduce the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can silence the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0088] In other embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product reduces or eliminates the expression and / or function of the Bcor gene or Zc3h12a gene (e.g., in immune cells, such as T cells). Exemplarily, the T cells do not contain the Bcor gene or Zc3h12 gene, or the biological function of the expression product of the Bcor gene or the expression product of the Zc3h12 gene of the T cells is inhibited. In some specific embodiments, compared with immune cells (e.g., T cells) not treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product, the expression or function of the Bcor gene or Zc3h12a gene in the immune cells (e.g., T cells) treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100%.

[0089] In the present invention, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can be an agent used in at least one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology, or can be a small molecule inhibitor.

[0090] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product is selected from, but not limited to: at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex (RNP) or a small molecule inhibitor.

[0091] Nucleic Acids

[0092] In some embodiments, the nucleic acid is selected from DNA, RNA, DNA / RNA.

[0093] In some embodiments, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule.

[0094] "Antisense RNA molecule" refers to an RNA molecule complementary to an mRNA transcript, regardless of length.Antisense RNA molecules refer to single-stranded RNA molecules that can be introduced into cells, tissues, or subjects and that cause reduced expression of endogenous target gene products by a mechanism that is independent of endogenous gene silencing pathways but relies on degradation of target mRNA transcripts mediated by RNase H. In some embodiments, antisense nucleic acids comprise modified backbones, such as phosphorothioates, phosphorodithioates, or other backbones known in the art, or may comprise non-natural internucleoside linkages. In some embodiments, antisense nucleic acids may comprise locked nucleic acids (LNA).

[0095] "RNA interference molecules" refer to RNA polynucleotides that mediate the reduced expression of endogenous target gene products by degrading target mRNA through endogenous gene silencing pathways (e.g., Dicer and RNA-induced silencing complexes (RISC)). Exemplary RNA interference molecules include microRNAs (also referred to herein as "miRNAs"), short hairpin RNAs (shRNAs), small interfering RNAs (siRNAs), RNA aptamers, and morpholinos.

[0096] In some specific embodiments, the siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary to form an RNA dimer together; and the antisense strand can hybridize or be complementary to a target sequence in the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some specific embodiments, the siRNA can specifically bind to a target sequence in the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0097] In some specific embodiments, the shRNA is obtained by vector expression, for example, a DNA fragment that can transcribe the shRNA is cloned into a viral expression vector and expressed. The shRNA includes a sense chain fragment and an antisense chain fragment, and a stem-loop structure connecting the sense chain fragment and the antisense chain fragment, the sequences of the sense chain fragment and the antisense chain fragment are complementary, and the sequence of the antisense chain is complementary or hybridized to the transcription product sequence of the target sequence in the Bcor gene or Zc3h12a gene. The shRNA can become siRNA after enzyme cleavage, thereby specifically regulating the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0098] Those skilled in the art will appreciate that when the Bcor gene or its expression product or the Zc3h12a gene or its expression product is used as a target, effective siRNA or shRNA can be designed and prepared according to the interfering RNA design principles known in the art.

[0099] Peptides

[0100] In some embodiments, the polypeptide is selected from: an antibody or an antigen-binding fragment thereof, a protein containing one or more zinc finger binding domains and an enzyme domain (zinc finger system, or artificial zinc finger nucleases (Zinc Finger Nucleases, ZFN)), and a protein containing a transcription activator-like effector (TALE) nuclease domain and an enzyme domain (TALEN system).

[0101] Ribonucleoprotein complex (RNP)

[0102] In some embodiments, the RNP is selected from: CRISPR / cas system.

[0103] In some specific embodiments, the CRISPR / cas system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule, and the enzyme protein is a Cas protein or a Cas ortholog.

[0104] In some optional embodiments, the enzyme protein is selected from Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e or Cas13f protein or its direct homologs.

[0105] In some embodiments, the CRISPR / cas system includes at least one of the following:

[0106] (i) a targeting domain sequence in a guide RNA (gRNA) targeting the Bcor gene is complexed with a first Cas endonuclease protein to form a first ribonucleoprotein (RNP) complex; and,

[0107] (ii) The targeting domain sequence in the Zc3h12a gene-targeting guide RNA (gRNA) is complexed with a second Cas endonuclease protein to form a second ribonucleoprotein (RNP) complex.

[0108] In some embodiments, in the CRISPR / cas system of the present invention, the nucleic acid binding segment in the guide RNA (gRNA) targeting the Bcor gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Bcor gene derived from a subject (e.g., NCBI Gene ID: 54880 or NCBI Gene ID: 71458); the nucleic acid binding segment in the guide RNA (gRNA) targeting the Zc3h12a gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Zc3h12a gene derived from a subject (e.g., NCBI Gene ID: 80149 or NCBI Gene ID: 230738).

[0109] In some specific embodiments, in the CRISPR / cas system of the present invention, the targeting domain in the guide RNA (gRNA) targeting the Bcor gene comprises the sequence ACTGGGCAATACCGCAACAG (SEQ ID NO: 3) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 3; the targeting domain in the guide RNA (gRNA) targeting the Bcor gene comprises the sequence GCTGCCACAAGCACTCTAGG (SEQ ID NO: 6) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 6; the targeting domain of the guide RNA (gRNA) targeting the Zc3h12a gene comprises the sequence CTAGGGGAATTGGTGAAGCA (SEQ ID NO: 4) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 4; the targeting domain of the guide RNA (gRNA) targeting the Zc3h12a gene comprises the sequence CAGGACGCTGTGGATCTCCG (SEQ ID NO: 7) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 8. NO:7 has a sequence with at least 85%, 90%, or 95% identity.

[0110] Small molecule inhibitors

[0111] In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product comprises a small molecule inhibitor that can reduce or silence the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0112] In the present invention, the term "small molecule" refers to a low molecular weight compound, which can be produced by artificial synthesis or obtained from natural sources and has a molecular weight of less than 2000 Daltons (Da), less than 1500 Da, less than 1000 Da, less than 900 Da, less than 800 Da, less than 700 Da, less than 600 Da or less than 500 Da.

[0113] In some embodiments, the small molecule inhibitor can be an organic compound, an inorganic compound, or a combination of organic and / or inorganic compounds. In some specific embodiments, the small molecule inhibitor is a chemically prepared active substance or compound. Typically, these compounds are synthesized in a classical manner by chemical reactions between different organic and / or inorganic compounds.

[0114] In some embodiments, the small molecule inhibitor can exert its activity in the form in which it is administered, or the small molecule inhibitor can be a prodrug. Thus, "small molecule inhibitor" encompasses both active forms and prodrugs.

[0115] The term "prodrug" refers to a compound or substance that is converted into a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that is metabolized into a pharmaceutically active form in a subject after administration (e.g., by enzymatic activity in the subject).

[0116] The term "small molecule inhibitor" also encompasses pharmaceutically acceptable salts thereof. The term "pharmaceutically acceptable salt" refers to any salt form of a small molecule inhibitor that is safe and effective for administration to a target subject and that has the desired biological activity, pharmaceutical activity, and / or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts may include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, sucrose salt, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). Suitable base salts may include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

[0117] (T cells, T cell depletion)

[0118] In the present invention, the term "T cells" includes naive T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric T cells and antigen-specific T cells.

[0119] In some specific embodiments, the T cells comprise activated T cells.

[0120] In some specific embodiments, the T cells comprise CD8 + T cells.

[0121] In some specific embodiments, the T cells comprise antigen-specific T cells.

[0122] In some specific embodiments, the antigen-specific T cells are antigen-specific T cells directed against pathogens that cause chronic infections.

[0123] In some embodiments, the T cells comprise exhausted T cells.

[0124] In the present invention, the term "exhausted T cells" or "T cell exhaustion" refers to dysfunctional T cells, which gradually lose their effector functions during chronic infection.

[0125] In some embodiments, the T cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0126] In some embodiments, the subject has a chronic infection.

[0127] In some specific embodiments, the T cells comprise antigen-specific T cells against a pathogen causing the chronic infection in a subject with a chronic infection.

[0128] (Chronic Infection)

[0129] In some embodiments, chronic infection refers to the persistence of pathogens in the body after acute infection or latent infection. In some embodiments, chronic infection is a chronic infection in a subject. In some embodiments, the subject is a human or non-human animal.

[0130] In some embodiments, the chronic infection refers to a chronic microbial infection, which includes a bacterial infection, a viral infection, a fungal infection, a protozoan infection, or a parasitic infection. In some embodiments, the chronic microbial infection is a chronic or latent form of a viral infection, i.e., a chronic viral infection.

[0131] In some embodiments, the chronic microbial infection is caused by a pathogen selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium bovis, Helicobacter pylori, Staphylococcus aureus, Salmonella typhi, Treponema pallidum, Escherichia coli, Haemophilus influenzae, Pseudomonas aeruginosa, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, human immunodeficiency virus (HIV), herpes virus, herpes simplex virus (HSV), hepatitis B virus (HBV), hepatitis C virus (HCV), measles virus, papovavirus, varicella-zoster virus, T-cell leukemia virus, adenovirus, parvovirus, Epstein-Barr virus, enterovirus, mouse hepatitis virus (MHV), cytomegalovirus (CMV), papillomavirus, and lymphocytic choriomeningitis virus (LCMV). In some embodiments, the chronic microbial infection is an antibiotic-resistant or antiviral-resistant infection (e.g., antibiotic-resistant tuberculosis (TB), methicillin-resistant Staphylococcus aureus (MRSA), enterovirus 68, Nipah virus, Middle East Respiratory Syndrome (MERS)).

[0132] <Modified T cells and their use in treating chronic infections>

[0133] In some aspects of the present invention, a modified T cell is provided, which is a T cell treated with an agent targeting the Bcor gene or its expression product as described above, or the modified T cell is a T cell treated with an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product as described above.

[0134] In some embodiments, the T cells comprise activated T cells.

[0135] In some embodiments, the T cells comprise CD8 + T cells.

[0136] In some embodiments, the T cells comprise antigen-specific T cells.

[0137] In some embodiments, the antigen-specific T cells are antigen-specific T cells against pathogens causing chronic infections, wherein the chronic infections are chronic infections as described above.

[0138] In some embodiments, the T cells comprise exhausted T cells.

[0139] In some embodiments, the T cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0140] In some specific embodiments, the subject has a chronic infection. In some specific embodiments, the T cells comprise antigen-specific T cells against a pathogen causing the chronic infection in a subject with a chronic infection.

[0141] In some aspects of the present invention, there is provided the use of modified T cells in the preparation of a medicament for preventing and / or treating chronic infections, wherein the modified T cells are T cells treated with an agent targeting the Bcor gene or its expression product as described above, or the modified T cells are T cells treated with an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product as described above.

[0142] In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product reduces or eliminates the expression and / or function of the Bcor gene or Zc3h12a gene in the modified T cells. Exemplarily, the modified T cells do not contain the Bcor gene or Zc3h12 gene, or the biological function of the expression product of the Bcor gene or the expression product of the Zc3h12 gene of the T cells is inhibited. In some specific embodiments, compared with T cells (unmodified T cells) not treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product, the expression or function of the Bcor gene or Zc3h12a gene in the modified T cells treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100%.

[0143] In some embodiments, the modified T cells do not contain other genetic modifications, such as modifications of structures for adoptive cell therapy and modifications of biological molecules for treating diseases. Among them, the structures for adoptive cell therapy include chimeric antigen receptor (CAR) structures, T cell antigen receptor (TCR) structures, receptor structures based on ligand receptor binding, or synthetic T cell receptors or antigen receptors (synthetic Tcell receptor and antigen receptor, STAR). The biological molecules used to treat diseases are selected from: cytokines, hormones, growth factors, coagulation factors, chemokines, co-stimulatory molecules, activation peptides, antibodies or their antigen binding fragments, or mutants of the above.

[0144] (Handling method)

[0145] In the present invention, there is no particular limitation on the method for treating T cells with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product, for example, the agent targeting the Bcor gene or its expression product and / or the agent targeting the Zc3h12a gene or its expression product may be introduced into T cells. In some exemplary embodiments, treating T cells with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product may be introducing nucleotides carrying one or more components capable of expressing an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product into T cells by techniques known to those skilled in the art.

[0146] In some embodiments, the vector used is a viral vector, a virus-like vector or a non-viral vector. In some embodiments, the recombinant vector of a polynucleotide comprising one or more components encoding an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product (e.g., components for reducing or eliminating the expression and / or function of the Bcor gene and Zc3h12a gene in T cells, such as sgRNA, Cas protein, etc.) is a viral vector. Suitable viral vectors include, but are not limited to, viral vectors based on: vaccinia virus, polio virus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), etc. Suitable non-viral vectors are selected from transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria, or virus-like particles.

[0147] In some embodiments, the polynucleotide sequence encoding an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is operably linked to a control element, such as a transcriptional control element, such as a promoter. The transcriptional control element can be functional in a eukaryotic cell (e.g., a mammalian cell) or a prokaryotic cell (e.g., a bacterial or archaeal cell). In some embodiments, the polynucleotide sequence encoding an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is operably linked to a plurality of control elements that allow the polynucleotide to be expressed in both prokaryotic and eukaryotic cells. Depending on the cell type and gene regulation system used, any of a number of suitable transcriptional and translational control elements (including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, etc.) can be used in the expression vector.

[0148] In some embodiments, non-limiting examples of suitable eukaryotic promoters (promoters that function in eukaryotic cells) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTR) from retroviruses, and mouse metallothionein 1. The selection of suitable vectors and promoters is entirely within the capabilities of those of ordinary skill in the art. The expression vector may also include a ribosome binding site and a transcription terminator for translation initiation. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include a nucleotide sequence encoding a protein tag (e.g., 6×His tag, hemagglutinin tag, green fluorescent protein, etc.) fused to a site-directed modified polypeptide to produce a chimeric polypeptide.

[0149] (Methods for obtaining and culturing T cells).

[0150] In the present invention, there is no particular limitation in principle on the method of obtaining T cells. For example, peripheral blood mononuclear cells can be isolated from the peripheral blood of a subject, and immune cells of a specific phenotype can be isolated by, for example, magnetic bead sorting or flow cytometry sorting techniques.

[0151] In some embodiments, in the present disclosure, there is no particular limitation in principle on the method of culturing T cells. In some embodiments, T cells can be implanted into a subject for amplification, and recombinant immune cells amplified in vivo can be obtained. Modified T cells obtained after amplification from the first generation subject can be used for autologous treatment of the subject or for allogeneic treatment of other subjects. In some embodiments, T cells are autologous T cells or allogeneic T cells for the subject. In some embodiments, T cells can also be amplified in vitro.

[0152] <Composition>

[0153] In other aspects, the present disclosure provides a composition. In some embodiments, the "composition" is a preparation comprising (a) an agent targeting the Bcor gene or its expression product as described above; (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and (c) at least one of the modified T cells described above, which can be administered or delivered to a subject or cell. The composition can (i) prevent and / or treat chronic infection; (ii) enhance the ability of T cells to resist chronic infection; (iii) prevent and / or reverse T cell exhaustion.

[0154] "Therapeutic composition" or "pharmaceutical composition" (used interchangeably herein) is a composition comprising (a) an agent targeting the Bcor gene or its expression product as described above; (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and (c) at least one of the modified T cells described above, which can be administered to a subject to treat chronic infection. In some optional embodiments, the composition for treating a disease further includes a pharmaceutically acceptable carrier.

[0155] <Method>

[0156] In some embodiments, the present disclosure provides a method for treating chronic infection in a subject in need thereof. The method comprises administering to the subject an agent targeting the Bcor gene or its expression product as described above, or administering to the subject an agent targeting the Bcor gene or its expression product as described above and an agent targeting the Zc3h12a gene or its expression product as described above, or administering to the subject the modified T cells as described above, or administering to the subject a composition or pharmaceutical composition as described above.

[0157] In some embodiments, the present disclosure provides a method for enhancing the ability of T cells to resist chronic infection, comprising the step of treating T cells with the reagent targeting the Bcor gene or its expression product as described above, or the reagent targeting the Bcor gene or its expression product as described above and the reagent targeting the Zc3h12a gene or its expression product.

[0158] In some embodiments, the present disclosure provides a method for preventing and / or reversing T cell exhaustion, comprising the step of treating T cells with an agent targeting the Bcor gene or its expression product as described above, or an agent targeting the Bcor gene or its expression product as described above and an agent targeting the Zc3h12a gene or its expression product.

[0159] Example

[0160] The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0161] Example 1. Preparation of recombinant T cells with knockout of Bcor and / or Zc3h12a

[0162] 1. Construction of gene knockout vector

[0163] In this example, retrovirus-based sgRNA expression vectors were constructed, namely, pMSCV-sgBcor-Thy1.1, pMSCV-sgZc3h12a-Thy1.1, pMSCV-sgBcor / Zc3h12a-Thy1.1, pMSCV-sgControl-Thy1.1 and pMSCV-sgControl-GFP.

[0164] Among them, the vector pMSCV-sgControl-Thy1.1 (SEQ ID NO: 1), in which positions 1686-1705 are random sequences SEQ ID NO: 2 that do not target any gene, is called sgNon-targeting or sgControl as a control that does not knock out any gene;

[0165] Vector pMSCV-sgBcor-Thy1.1, the vector sequence is obtained by replacing positions 1686-1705 of SEQ ID NO:1 with SEQ ID NO:3, and keeping other sequences unchanged, SEQ ID NO:3 is the target sequence recognition region of sgBcor for knocking out Bcor, and is used for knocking out Bcor;

[0166] Vector pMSCV-sgZc3h12a-Thy1.1, wherein the vector sequence is obtained by replacing positions 1686-1705 of SEQ ID NO:1 with SEQ ID NO:4, while keeping other sequences unchanged, SEQ ID NO:4 is a target sequence recognition region of sgZc3h12a for knocking out Zc3h12a, and is used for knocking out Zc3h12a;

[0167] Vector pMSCV-sgBcor / Zc3h12a-Thy1.1, wherein the sequence of the vector is that positions 1686-1705 of SEQ ID NO:1 are the target sequence recognition region of mouse sgBcor for knocking out Bcor (SEQ ID NO:3), and positions 2131-2150 are the target sequence recognition region of sgZc3h12a for knocking out mouse Zc3h12a (SEQ ID NO:4), and are used for simultaneously knocking out mouse Bcor and mouse Zc3h12;

[0168] The vector pMSCV-sgControl-GFP, the vector sequence is obtained by replacing the Th1.1 expression sequence position 2079-2616 of SEQ ID NO: 1 with the EGFP expression sequence (SEQ ID NO: 5).

[0169] All vectors were obtained by complete gene synthesis.

[0170] The sgRNAs used above are shown in Table 2 below:

[0171] Table 2 sgRNA target sequence recognition region

[0172]

[0173] 2. Isolation and activation of primary P14 cells

[0174] Cas9 was isolated by magnetic bead sorting +The initial CD8 + T cells were resuspended in 2 ml RPMI1640 medium (containing 5% fetal bovine serum and interleukin-2), and the polypeptide gp33-41 (Qiangyao Bio, Cat#04010023714; a polypeptide composed of 9 amino acid residues, which is the optimal sequence in the GP1 antigenic determinant of lymphocytic choriomeningitis virus, the sequence is KAVYNFATC; SEQ ID NO: 8) was added for in vitro activation, that is, the cells were cultured in a 5% carbon dioxide 37°C incubator, and the virus was infected after 24 hours of culture.

[0175] 3. Construction of P14 cells with knockout of Bcor and Zc3h12a genes

[0176] 1) Retrovirus preparation

[0177] 1×10 6 After Phoenix-Eco cells (ATCC#CRL-3214) were cultured for 24 hours, 20 μg of the sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1 prepared in 1 above and 60 mg of the packaging plasmid pCL-Eco (purchased from Addgene#12371) were co-transfected by the calcium phosphate precipitation method. The supernatant containing the packaged virus was harvested 48 hours after transfection, and the viral supernatant was filtered with a 0.45 μm filter membrane to remove dead cell impurities to obtain the retroviral supernatant, i.e., the retrovirus with Bcor and Zc3h12a knocked out.

[0178] 2) Retroviral infection

[0179] After 36 hours of in vitro activation in step 2, 1×10 6 CD8 + T cells, add 1 ml of the retroviral supernatant obtained in step 1, mix well, and centrifuge horizontally at room temperature at 2000 × g for 2 hours. Then place in a carbon dioxide incubator for 4 hours, replace with 2 ml of fresh RPMI1640 medium (containing 5% fetal bovine serum and 2 ng / ml interleukin-2) and continue to culture (this time is recorded as the time after infection), and use flow cytometry to sort out Thy1.1-positive cells (Thy1.1-biotin, BioLegend #202510), that is, P14 cells with simultaneous knockout of Bcor and Zc3h12a (expressed as Thy1.1-sgBcor / Zc3h12a-P14).

[0180] 4. Construction of Bcor-knockout P14 cells

[0181] The only difference from “3. Construction of P14 cells with Bcor and Zc3h12a knockout” is that “sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1” is replaced with “sgRNA expression vector pMSCV-Zc3h12a-Thy1.1”, and the other steps remain unchanged to obtain P14 cells with Bcor knockout (expressed as Thy1.1-sgZc3h12a-P14).

[0182] 5. Construction of P14 cells with Zc3h12a knockout

[0183] The only difference from “3. Construction of P14 cells with Bcor and Zc3h12a knockout” is that “sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1” is replaced with “sgRNA expression vector pMSCV-sgBcor-Thy1.1”, and the other steps remain unchanged to obtain P14 cells with Bcor knockout (expressed as Thy1.1-sgBcor-P14).

[0184] 6. Construction of sgControl-P14 cells without knockout gene

[0185] The only difference from “3. Construction of P14 cells with Bcor and Zc3h12a knockout” is that “sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1” is replaced with “sgRNA expression vector pMSCV-sgControl-Thy1.1”, and the other steps remain unchanged to obtain P14 cells with no gene knockout (expressed as Thy1.1-sgControl-P14).

[0186] The only difference from “3. Construction of P14 cells with Bcor and Zc3h12a knockout” is that “sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1” is replaced with “sgRNA expression vector pMSCV-sgControl-GFP”, and the other steps remain unchanged to obtain P14 cells with no gene knockout (expressed as GFP-sgControl-P14).

[0187] 7. ERT2 Cre P14 and ERT2CreBcor fl / fl Zc3h12a fl / fl Construction of P14 mice

[0188] By ERT2 CreB6 mice (Strain#:008463, Jackson Laboratory) were crossbred with P14 transgenic mice to obtain ERT2 Cre P14 mice; ERT2 Cre P14 mice and Bcor fl / fl Zc3h12a fl / fl Transgenic mice (commissioned by Saiye Biotechnology) were crossbred to obtain ERT2CreBcor fl / fl Zc3h12a fl / fl P14 mice. ERT2Cre was induced by tamoxifen to express Cre to knock out Bcor and Zc3h12a.

[0189] Example 2. Virus infection and titration

[0190] Lymphocytic choriomeningitis virus (LCMV) strains Armstrong and LCMV clone 13 each induced acute and chronic infection. LCMV was expressed in BHK21[C13] cells ( CCL10) and titrated by plaque assay on VERO cells. 6 Mice were intravenously infected with LCMV Armstrong (2×10 6 Mice were infected by intraperitoneal injection of 100 PFU of LCMV. Mice infected with LCMV were maintained in accordance with the institutional biosafety regulations of Tsinghua University. The LCMV viral load in serum / organ / tissue samples was quantified by qPCR assay.

[0191] Example 3: Knockout of Bcor and Zc3h12a does not affect CD8 expression during acute infection with LCMV Armstrong virus + T cell expansion capacity and persistence

[0192] Cell transfusion process Figure 1 As shown in A: From Cas9 + CD8 isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 +T cells (the method is the same as that of Example 1, step 2); then the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor-Thy1.1, the retrovirus obtained by transfection with pMSCV-Zc3h12a-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgControl-GFP were used to infect activated CD8 + T cells, the obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgBcor-P14, Thy1.1-sgZc3h12a-P14, Thy1.1-sgBcor / Zc3h12a-P14 and GFP-sgControl-P14 cells (the method is the same as 3 of Example 1), and the above cells obtained after 24 hours of infection were respectively injected into C57bl / B6 mice (hereinafter referred to as B6 mice) through the tail vein. The specific injection method is as follows:

[0193] 6-8 week old B6 mice weighing 20-25 g were divided into 4 groups, namely, control (sgControl) group (5 mice), sgBcor group (5 mice), sgZc3h12a group (5 mice) and sgBcor / Zc3h12a group (5 mice).

[0194] LCMV Armstrong infected mice (the method is the same as Example 2).

[0195] Control (sgControl) group: Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1, and then the mixture was transfused into each mouse in the sgControl group via the tail;

[0196] sgBcor group: Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and the Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1, and then the mixture was transfused into each mouse in the sgBcor group via the tail;

[0197] sgZc3h12 group: Thy1.1-sgZc3h12-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgZc3h12l-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1, and then the mixture was transfused into each mouse in the sgZc3h12 group via the tail;

[0198] sgBcor / Zc3h12a group: Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgControl group via the tail.

[0199] On the 7th, 14th, 21st and 28th day after transfusion, the percentage of Thy1.1-sgControl-P14 cells without gene knockout, Thy1.1-sgBcor-P14 cells with Bcor knockout, Thy1.1-sgZc3h12-P14 cells with Zc3h12a knockout and Thy1.1-sgBcor / Zc3h12a-P14 cells with both Bcor and Zc3h12a knockout in the peripheral blood of each mouse was analyzed using Thy1.1 antibody (the knockout vector carries a Thy1.1 screening tag) and GFP fluorescence flow cytometry to determine the percentage of Thy1.1-sgControl-P14 cells without gene knockout, Thy1.1-sgBcor-P14 cells with Bcor knockout, and Thy1.1-sgZc3h12a-P14 cells with both Bcor and Zc3h12a knockout in the peripheral blood of each mouse. + The proportion of T cells, i.e., proliferation, contraction, and persistence of infused P14 cells were monitored in the blood and spleen.

[0200] The results are as follows Figure 1 As shown in Figure B, during acute infection with LCMV Armstrong, Zc3h12a deficiency and Bcor / Zc3h12a deficiency, but not Bcor deficiency, enhanced the expansion of P14 cells in the blood at day 7 after infection ( Figure 1 B), Bcor deficiency enhanced the proliferation of P14 cells in the blood at day 14 after infection. However, Bcor deficiency, Zc3h12a deficiency, and Bcor / Zc3h12a deficiency had no effect on the persistence of P14 cells ( Figure 1 B).

[0201] The results are as follows Figure 1 C and Figure 1 D, Thy1.1 in the spleen of LCMV Armstrong-infected mice compared with that in controls at 36 days after infection. +Compared with control P14 cells, the number of Bcor-deficient, Zc3h12a-deficient, and Bcor / Zc3h12a-deficient P14 cells was slightly lower or had no significant difference.

[0202] These data suggest that knockout of Bcor and Zc3h12a alone or together may alter the expression of Bcor and Zc3h12a in CD8 + T cells cannot increase CD8 + T cell expansion capacity and persistence.

[0203] Example 4: Knockout of Bcor and Zc3h12a significantly enhanced CD8 + T cell expansion, persistence and stemness

[0204] Cell transfusion process Figure 2 As shown in A: From Cas9 + CD8 isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); then the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor-Thy1.1, the retrovirus obtained by transfection with pMSCV-Zc3h12a-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgControl-GFP were used to infect activated CD8 + The obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgBcor-P14, Thy1.1-sgZc3h12a-P14, Thy1.1-sgBcor / Zc3h12a-P14 and GFP-sgControl-P14 cells (the method is the same as 3 of Example 1), and the above cells obtained after infection for 24 hours were respectively injected into B6 mice through the tail vein. The specific injection method is as follows:

[0205] B6 mice aged 6-8 weeks with a body weight of 20-25 g were divided into 4 groups, namely, control (sgControl) group (5 mice), sgBcor group (5 mice), sgZc3h12a group (5 mice) and sgBcor / Zc3h12a group (5 mice). LCMV clone 13 was used to infect mice (the method was the same as in Example 2).

[0206] Control (sgControl) group: Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1, and then the mixture was transfused into each mouse in the sgControl group via the tail;

[0207] sgBcor group: Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and the Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1, and then the mixture was transfused into each mouse in the sgBcor group via the tail;

[0208] sgZc3h12 group: Thy1.1-sgZc3h12-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgZc3h12l-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1, and then the mixture was transfused into each mouse in the sgZc3h12 group via the tail;

[0209] sgBcor / Zc3h12a group: Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells prepared by the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgControl group via the tail.

[0210] On the 7th, 14th, 21st and 28th day after transfusion, the percentage of Thy1.1-sgControl-P14 cells without gene knockout, Thy1.1-sgBcor-P14 cells with Bcor knockout, Thy1.1-sgZc3h12-P14 cells with Zc3h12a knockout and Thy1.1-sgBcor / Zc3h12a-P14 cells with both Bcor and Zc3h12a knockout in the peripheral blood of each mouse was analyzed using Thy1.1 antibody (the knockout vector carries a Thy1.1 screening tag) and GFP fluorescence flow cytometry to determine the percentage of Thy1.1-sgControl-P14 cells without gene knockout, Thy1.1-sgBcor-P14 cells with Bcor knockout, and Thy1.1-sgZc3h12a-P14 cells with both Bcor and Zc3h12a knockout in the peripheral blood of each mouse. + The proportion of T cells, i.e., proliferation, contraction, and persistence of infused P14 cells were monitored in the blood and spleen.

[0211] The results are as follows Figure 2 As shown in Figure 2B, during chronic infection with LCMV clone 13, Bcor deficiency, and to a greater extent Bcor / Zc3h12a deficiency, strongly enhanced the expansion and persistence of P14 cells in the blood ( Figure 2 Zc3h12a deficiency alone did not affect the expansion and persistence of P14 cells in chronic infection with LCMV clone 13, but it significantly enhanced the effect of Bcor deficiency on the persistence of P14 cells ( Figure 2 B).

[0212] The results are as follows Figure 2 C and Figure 2 D, at 36 days post infection, in the spleens of mice infected with LCMV clone 13, Bcor-deficient P14 cells increased approximately 43-fold, Bcor / Zc3h12a-deficient P14 cells increased 234-fold (compared to Thy1.1+ control P14 cells in the control group), while Zc3h12a-deficient P14 cells decreased. These data indicate that Bcor potently suppresses CD8 + T cell expansion and persistence, and the effects of Bcor deficiency could be further enhanced by loss of Zc3h12a.

[0213] Since Bcor-deficient and Bcor / Zc3h12a-deficient P14 cells are abundant in mice infected with LCMV clone 13, we tested their stemness. Figure 2 As shown in Figure E, P14 cells from the first-generation recipients were flow-sorted and transferred into the second-generation recipient mice, with primary P14 cells used as a reference. After LCMV clone 13 infection, Bcor / Zc3h12a-deficient P14 cells proliferated and persisted in secondary recipients, and the proliferation of Bcor-deficient P14 cells was slightly stronger than that of primary P14 cells, but the secondary proliferation / persistence was much weaker than that of Bcor / Zc3h12a-deficient P14 cells ( Figure 2 F), indicating that Bcor / Zc3h12a-deficient P14 cells have higher stemness than Bcor-deficient P14 cells, which is consistent with the higher number of Bcor / Zc3h12a-deficient P14 cells in the primary host ( Figure 2 B to D in the figure).

[0214] Example 5: Knockout of Bcor and Zc3h12a enhances CD8 expression during chronic infection with LCMV clone 13 virus + T cell survival, function and stemness

[0215] Cell transfusion process Figure 3 As shown in A: From Cas9 +CD8 isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the retrovirus obtained by transfection with pMSCV-sgControl-Th1.1, the retrovirus obtained by transfection with pMSCV-sgBcor-Thy1.1, the retrovirus obtained by transfection with pMSCV-Zc3h12a-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1 were respectively infected with activated CD8 + T cells, the obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgBcor-P14, Thy1.1-sgZc3h12a-P14 and Thy1.1-sgBcor / Zc3h12a-P14 cells (the method is the same as 3 of Example 1), and the above cells obtained after infection for 24 hours were respectively injected into the tail vein of B6 mice, and the specific injection method is as follows:

[0216] B6 mice aged 6-8 weeks with a body weight of 20-25 g were divided into four groups, namely, control group (sgControl), sgBcor group, sgZc3h12a group and sgBcor / Zc3h12a group. LCMV clone 13 was used to infect mice (the method was the same as in Example 2).

[0217] Control (sgControl) group: Thy1.1-sgControl-P14 cells prepared by the method of Example 1 were transfused into each mouse in the sgControl group via tail injection;

[0218] sgBcor group: Thy1.1-sgBcor-P14 cells prepared by the method of Example 1 were prepared into a cell suspension with PBS and then transfused into each mouse in the sgBcor group via the tail;

[0219] sgZc3h12 group: Thy1.1-sgZc3h12-P14 cells prepared by the method of Example 1 were prepared into a cell suspension with PBS and then transfused into each mouse in the sgZc3h12 group via the tail;

[0220] sgBcor / Zc3h12a group: Thy1.1-sgBcor / Zc3h12a-P14 cells prepared by the method of Example 1 were prepared into a cell suspension with PBS and then transfused into each mouse in the sgControl group via the tail.

[0221] 24 hours after the cells were reinfused, mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0222] We analyzed the apoptosis of P14 cells. Figure 3 B and Figure 3 In C, the apoptosis of P14 cells in the sgZc3h12 group was increased compared with that in the control group (sgControl), while the apoptosis of P14 cells in the sgBcor group and sgBcor / Zc3h12a group was decreased compared with that in the control group (sgControl).

[0223] like Figure 3 and Figure 4 We investigated the role of Bcor and Zc3h12a in the regulation of CD8 + To distinguish effector T cells from effector / terminal T cells by expression of TCF1 and TIM3 markers, we performed flow cytometry analysis ( Figure 4 Apoptosis in Bcor-deficient and Bcor / Zc3h12a-deficient P14 cells was significantly reduced, while apoptosis in Zc3h12a-deficient P14 cells was slightly increased ( Figure 3 B and C). The enhanced stemness and persistence of Bcor-deficient P14 cells and Bcor / Zc3h12a-deficient P14 cells did not affect the expression of the effector molecule IFNg ( Figure 3 D and E in ).

[0224] Zc3h12a deficiency increases TCF1 + TIM3 - The percentage of effector T cells ( Figure 4 Figure 3 (A and B). Zc3h12a-deficient TCF1 in spleen compared with control P14 cells. + TIM3 - The proportion of T cells increased, but their absolute number decreased significantly due to increased apoptosis. + TIM3 - Compared with Bcor-deficient TCF1, Bcor / Zc3h12a-deficient TCF1 + TIM3 - The proportion of T cells further increased, and their number also increased significantly ( Figure 4 A and B in ).

[0225] To further understand the status of Bcor / Zc3h12a-deficient P14 cells, we performed single-cell RNA sequencing (scRNA-seq). Figure 4In C and D, P14 cells can be divided into 8 major clusters, C0 to C7. Control, Bcor-deficient, Zc3h12a-deficient, and Bcor / Zc3h12a-deficient P14 cells are each mainly concentrated in one or two related clusters with limited overlap. Control P14 cells are mainly present in C2 and C5, with a small part in C6. Zc3h12a-deficient P14 cells are mainly in C3. C0 generated by Bcor deficiency is almost absent in control P14 cells. Bcor / Zc3h12a-deficient P14 cells are mainly present in C1, a cluster absent in control P14 cells, indicating that Bcor / Zc3h12a deficiency induces CD8 + A new state of T cells.

[0226] Example 6: Re-infusion of CD8 Bcor and Zc3h12a knockout cells + T cells reduce LCMV clone 13 virus titers in mice

[0227] Cell transfusion process Figure 5 A: LCMV clone 13 infected Cd8 - / - Mouse, from Jaxson Laboratory, JAX#:002665 (method is the same as in Example 2). + CD8 isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the same method as in Example 1, step 2); the retrovirus obtained by transfection with pMSCV-sgControl-Th1.1 and the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1 were used to infect activated CD8 + The recombinant cells were named Thy1.1-sgControl-P14 and Thy1.1-sgBcor / Zc3h12a-P14 (the method was the same as that of Example 1, step 3). The cells obtained after infection for 24 hours were injected into the caudal vein of Cd8 mice infected for 30 days. - / - Mice, cell populations and P14 cell proportions were analyzed by flow cytometry 40 days after infection, and viral titers in serum, liver, and lung were analyzed.

[0228] The results are as follows Figure 5 The striking expansion and persistence of Bcor / Zc3h12a-deficient P14 cells in mice chronically infected with LCMV clone 13 prompted us to investigate whether these cells could suppress viral replication. + To influence T cell responses, we used Cd8 - / -Mice were used as recipients. Cd8 were infected with LCMV clone 13 - / - Mice were cultured for 30 days to establish chronic infection, and then control or Bcor / Zc3h12a-deficient P14 cells were transfected into these mice. Bcor / Zc3h12a deficiency enhanced the expression of Cd8 - / - The expansion of P14 cells in mice improved viral control, indicating that Bcor / Zc3h12a-deficient P14 cells have antiviral efficacy in mice chronically infected with LCMV clone 13.

[0229] Example 7: Induction of BCOR in Exhausted T Cells and ZC3H12A Deletion Partially Reverses T Cell Exhaustion During Chronic Infection with LCMV Clone 13

[0230] To examine whether BCOR and ZC3H12A deletion could reprogram exhausted T cells and reverse T cell exhaustion, we isolated ERT2 from mice. Cre P14 or ERT2 Cre Bcor fl / fl Zc3h12a fl / fl P14 cells were transferred into B6 mice infected with LCMV clone 13. To distinguish the transferred cells from the host endogenous cells, we used host B6 mice with a CD45.1 / 2 genetic background. Figure 6 As shown in A: From ERT2 Cre P14 (CD45.2 genetic background) and ERT2 Cre Bcor fl / fl Zc3h12a fl / fl CD8 T cells were isolated from spleen and lymph nodes of P14 (CD45.2 genetic background) transgenic mice (obtained in Example 1). + T cells activated by peptide gp33-41 to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the above cells were respectively infused into B6 (CD45.1 / 2 genetic background) mice via the tail vein, and the specific infusion method was as follows:

[0231] B6 mice aged 6-8 weeks weighing 20-25 g were divided into 4 groups, namely ERT2 Cre P14 (control) group (9 rats) and ERT2 Cre Bcor fl / fl Zc3h12a fl / fl Group P14 (11 mice): Mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0232] ERT2 Cre P14 (control) group: ERT2 prepared by the method of Example 1 CreP14 cells were transfused into ERT2 Cre Each mouse in the P14 group;

[0233] ERT2 Cre Bcor fl / fl Zc3h12a fl / fl Group P14: ERT2 prepared by the method of Example 1 Cre Bcor fl / fl Zc3h12a fl / fl P14 cells were prepared into cell suspension with PBS and transfused into ERT2 Cre Bcor fl / fl Zc3h12a fl / fl Each mouse in the P14 group;

[0234] 24 hours after the cells were reinfused, mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0235] Twenty-one days after infection, mice were injected with tamoxifen (purchased from Sigma) via the tail for 5 consecutive days. P14 cells in peripheral blood were analyzed by flow cytometry every week, and P14 cells in spleen were analyzed on the 40th day after tamoxifen injection.

[0236] The persistence of exhausted T cells in chronic viral infection depends on a subset of cells called precursor-exhausted T (TPEX) cells (TCF1 + Tim3- or Ly108 + CD62L + ), which has stem cell-like properties and can self-renew and replenish exhausted T cells. Figure 6 The results showed that 21 days after establishment of chronic viral infection, before tamoxifen administration, ERT2 Cre ERT2 transferred in peripheral blood of P14 (control) group Cre P14 and ERT2 Cre Bcor fl / fl Zc3h12a fl / fl ERT2 transferred in peripheral blood of P14 group Cre Bcor fl / fl Zc3h12a fl / fl P14 cells account for CD8 + The percentage of T cells was similar, and after tamoxifen injection, ERT2 Cre Bcor fl / fl Zc3h12a fl / fl P14 cells account for CD8 + The percentage of T cells exceeded that of control P14 cells, accounting for CD8 + The percentage of T cells ( Figure 6Middle B); ERT2 in spleen 40 days after tamoxifen injection Cre Bcor fl / fl Zc3h12a fl / fl P14 cells account for CD8 + The percentage and number of T cells exceeded those of the control P14 cells ( Figure 6 C and D); More importantly, 40 days after tamoxifen injection, in ERT2 Cre Bcor fl / fl Zc3h12a fl / fl In P14 cells, TCF1 + TIM3 - or Ly108 + CD62L + The proportion of T cells was significantly higher than that of ERT2 Cre P14 cells ( Figure 6 These data suggest that T cell exhaustion can be partially reversed by inhibition of BCOR and ZC3H12A.

[0237] It should be noted that, although the technical solution of the present invention is introduced with specific examples, those skilled in the art will appreciate that the present invention should not be limited thereto.

[0238] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

[0239] The nucleotide sequence of vector pMSCV-sgControl-Thy1.1 (SEQ ID NO: 1):

[0240]

[0241]

[0242] The single underlined part is sgControl, and the double underlined part is Thy1.1.

[0243] Nucleotide sequence encoding EGFP (SEQ ID NO: 5)

[0244] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtctggcgag

[0245] ggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacct

[0246] acggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttct

[0247] tcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggag

[0248] gacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggcgaacttca

[0249] agatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaac

[0250] cactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcg

[0251] gcatggacgagctgtacaagtaa。

Claims

1. Any of the following uses of an agent targeting the Bcor gene or its expression product or a combination of an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product: (i) Use in the preparation of a medicament for preventing and / or treating chronic infections; (ii) use in the preparation of an agent for enhancing the ability of T cells to resist chronic infection; (iii) Use in the preparation of an agent for preventing and / or reversing T cell exhaustion.

2. The use according to claim 1, wherein The T cells include naive T cells, CD4 + T cells, CD8 + at least one of T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric T cells, and antigen-specific T cells; Optionally, the T cells comprise activated T cells; Optionally, the T cells comprise antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against pathogens causing chronic infection; Optionally, the T cells comprise CD8 + T cells; Optionally, said T cells comprise exhausted T cells.

3. The use according to claim 1 or 2, wherein The chronic infection comprises at least one of bacterial infection, viral infection, fungal infection, protozoan infection and parasitic infection; Preferably, the chronic infection comprises a viral infection.

4. The use according to any one of claims 1 to 3, wherein The T cells are T cells from a subject; and / or, the chronic infection is a chronic infection in a subject; Optionally, the subject is a human or a non-human animal.

5. The use according to any one of claims 1 to 4, wherein The agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product comprises at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex and a small molecule inhibitor; Optionally, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule; Optionally, the polypeptide comprises at least one of an antibody or an antigen-binding fragment thereof, an artificial zinc finger nuclease, and a TALEN system; Optionally, the ribonucleoprotein complex comprises a CRISPR / cas system.

6. The use according to any one of claims 1 to 5, wherein The reagent targeting the Bcor gene or its expression product or the reagent targeting the Zc3h12a gene or its expression product includes a reagent used in any one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology.

7. A modified T cell, wherein: The modified T cells are T cells treated with an agent targeting the Bcor gene or its expression product, or the modified T cells are T cells treated with an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; Optionally, the T cells comprise activated T cells; Optionally, the T cells comprise antigen-specific T cells; Optionally, the T cells comprise CD8 + T cells; Optionally, said T cells comprise exhausted T cells.

8. The modified T cell according to claim 7, wherein The antigen-specific T cells are antigen-specific T cells targeting pathogens that cause chronic infections; Optionally, the chronic infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection; Preferably, the chronic infection comprises a viral infection; Optionally, the chronic infection is a chronic infection in a subject.

9. Use of the modified T cell according to claim 7 or 8 in the preparation of a medicament for preventing and / or treating chronic infection.

10. A composition comprising at least one selected from the following (a) to (c): (a) an agent targeting the Bcor gene or its expression product; (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and, (c) the modified T cell according to claim 7 or 8; Optionally, the composition is a pharmaceutical composition, which further comprises a pharmaceutically acceptable carrier.

Images