Nanobodies or antigen-binding fragments against porcine epidemic diarrhea virus and uses thereof
By screening and preparing highly specific nanobody fragments, the challenges of prevention and treatment of porcine epidemic diarrhea virus (PEDV) have been solved, achieving efficient diagnosis and treatment of PEDV and reducing morbidity and mortality in suckling piglets.
Patent Information
- Application Number
- CN202411922960.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-12-25
AI Technical Summary
Current technologies lack effective means of preventing, diagnosing, and treating diseases caused by porcine epidemic diarrhea virus (PEDV), especially the high morbidity and mortality rates in suckling piglets.
A nanobody or antigen-binding fragment targeting porcine epidemic diarrhea virus (PEDV) with specificity and high affinity has been developed. By screening specific amino acid sequences such as CDR1, CDR2, and HCDR3 and combining them with appropriate FR and CH2 and CH3 regions, polynucleotide molecules, expression vectors, engineered bacteria, and host cells are prepared for the preparation of pharmaceutical compositions and formulations for the diagnosis and treatment of related diseases.
We have developed nanobodies with excellent specificity and affinity for PEDV S protein, which can effectively prevent and treat porcine epidemic diarrhea virus infection, and reduce the morbidity and mortality of the disease.
Smart Images

Figure CN119708213B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to a nano antibody or antigen binding fragment for porcine epidemic diarrhea virus and application thereof. BACKGROUND
[0002] Porcine epidemic diarrhea (PED) is an acute and contagious enteric disease of pigs caused by porcine epidemic diarrhea virus (PEDV), and the clinical symptoms are watery diarrhea, vomiting, dehydration, metabolic acidosis and the like and show a high mortality rate. Pigs of various ages and breeds are susceptible, but there is a great difference in clinical symptoms and mortality rate after infection of pigs of different ages, and the morbidity and mortality rate are inversely proportional to the age of pigs, and the morbidity and mortality rate gradually decrease with the increase of the age of pigs. The disease is extremely harmful to nursing piglets, and the morbidity rate is as high as 80% to 100%, and the mortality rate of newborn piglets is more than 90%.
[0003] Diseased pigs and virus-carrying pigs are the main sources of transmission and prevalence of the disease, and the main transmission routes are oral and digestive tract transmission, direct contact or fecal-oral contact of healthy pigs and diseased pigs to realize direct transmission or indirect infection of the virus, and semen and emulsion transmission is a potential route. There is also a high content of virus in the respiratory tract secretions discharged by diseased pigs, and air transmission is also one of the influencing factors in breeding farms with repeated outbreaks and imperfect ventilation facilities. Therefore, it is necessary to develop a product for preventing, diagnosing or treating diseases related to porcine epidemic diarrhea virus infection.
[0004] An antibody is a protein that can specifically recognize an antigen, and it can recognize and neutralize a virus by specifically recognizing viral envelope proteins, structural proteins or enzymes, and it is one of the current technical means for diseases related to viruses. Therefore, it is of great significance to develop an antibody against porcine epidemic diarrhea virus for preventing, diagnosing or treating diseases related to porcine epidemic diarrhea virus infection. SUMMARY
[0005] The application is to screen a nano antibody or antigen binding fragment against porcine epidemic diarrhea virus (PEDV), which has excellent specificity and affinity for PEDV S protein.
[0006] In order to achieve the above purpose, the application can adopt the following technical scheme:
[0007] In one aspect, the present application provides a Nanobody or antigen-binding fragment against porcine epidemic diarrhea virus (PEDV), the Nanobody or antigen-binding fragment comprising a CDR1, a CDR2 and a HCDR3, the amino acid sequence of the CDR1 being as set forth in SEQ ID NO: 1, the amino acid sequence of the CDR2 being as set forth in SEQ ID NO: 2, and the amino acid sequence of the CDR3 being as set forth in SEQ ID NO: 3.
[0008] Preferably, the Nanobody or antigen-binding fragment further comprises a FR1 having at least 80% identity to the sequence set forth in SEQ ID NO: 4 and / or a FR2 having at least 80% identity to the sequence set forth in SEQ ID NO: 5 and / or a HFR3 having at least 80% identity to the sequence set forth in SEQ ID NO: 6 and / or a FR4 having at least 80% identity to the sequence set forth in SEQ ID NO: 7.
[0009] Preferably, the Nanobody or antigen-binding fragment comprises a variable region having at least 70% identity to the sequence set forth in SEQ ID NO: 8.
[0010] Preferably, the Nanobody or antigen-binding fragment further comprises a CH2 region and a CH3 region of a mouse IgG1 subtype.
[0011] Preferably, the CH2 region comprises a sequence having at least 70% identity to the sequence set forth in SEQ ID NO: 9; and / or the CH3 region comprises a sequence having at least 70% identity to the sequence set forth in SEQ ID NO: 10.
[0012] In another aspect, the present application provides any one of the following: (i) a polynucleotide molecule comprising a nucleotide sequence encoding the Nanobody or antigen-binding fragment of the present application; (ii) an expression vector comprising the polynucleotide molecule of (i); (iii) an engineered bacterium comprising the expression vector of (ii); (iv) a host cell comprising the expression vector of (ii); (v) a product for detecting porcine epidemic diarrhea virus, comprising the Nanobody or antigen-binding fragment of the present application or the polynucleotide molecule of (i) or the expression vector of (ii) or the engineered bacterium of (iii) or the host cell of (iv); (vi) a pharmaceutical composition comprising the Nanobody and / or antigen-binding fragment of the present application and / or the polynucleotide molecule of (i) or the expression vector of (ii) or the engineered bacterium of (iii) or the host cell of (iv); (vii) a pharmaceutical preparation comprising the Nanobody and / or antigen-binding fragment of the present application and / or the polynucleotide molecule of (i) or the expression vector of (ii) or the engineered bacterium of (iii) or the host cell of (iv) or the pharmaceutical composition of (vi).
[0013] Preferably, the pharmaceutical composition of the above-mentioned substance is a diabody, a multibody, an ADC or a fusion protein.
[0014] In still another aspect, the application provides use of the Nanobodies and / or antigen binding fragments in the application and / or the polynucleotide molecules in (i) and / or the expression vectors in (ii) and / or the engineered bacteria in (iii) and / or the host cells in (iv) in the preparation of a product for diagnosing porcine epidemic diarrhea virus infection disease.
[0015] In still another aspect, the application provides use of the Nanobodies and / or antigen binding fragments in the application and / or the polynucleotide molecules in (i) and / or the expression vectors in (ii) and / or the engineered bacteria in (iii) and / or the host cells in (iv) in the preparation of a medicament for preventing or treating porcine epidemic diarrhea virus infection disease.
[0016] Preferably, the porcine epidemic diarrhea virus infection disease is porcine epidemic diarrhea.
[0017] The beneficial effects of the application include: the Nanobodies or antigen binding fragments against porcine epidemic diarrhea virus (PEDV) provided by the application have excellent specificity and affinity to PEDV S protein. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 PCR amplification conditions for PEDV S protein;
[0019] Figure 2 Purification of PEDV S protein by HisTrap Excel column;
[0020] Figure 3 Purification of PEDV S protein by HiLoad Superdex 200 10 / 300 gel chromatography column;
[0021] Figure 4 SDS-PAGE protein identification gel staining by Coomassie brilliant blue;
[0022] Figure 5 Western Blot identification of purified PEDV S protein;
[0023] Figure 6 Partial PCR identification results of recombinant phage;
[0024] Figure 7 Amino acid sequence alignment results of Nanobodies;
[0025] Figure 8 ELISA verification of the reactogenicity of prokaryotic expressed Nanobodies;
[0026] Figure 9 Western Blot identification for partial prokaryotic expression of Nanobodies;
[0027] Figure 10 IFA identification for 18 Nanobodies;
[0028] Figure 11 Flow cytometry identification for 18 Nanobodies;
[0029] Figure 12 Virus microneutralization test for Nanobody 3Nb17;
[0030] Figure 13 SPR identification for Nanobody 3Nb17. DETAILED DESCRIPTION
[0031] The examples are provided to better illustrate the present application and should not be construed as limiting the present application only to the specific examples. Therefore, the skilled in the art, based upon the disclosure of the present application, can make modifications and variations to the embodiments without departing from the scope of the present application.
[0032] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, integers, operations, elements, components, parts, and / or combinations thereof, but do not preclude the presence or addition of one or more other features, integers, operations, elements, components, parts, and / or combinations thereof. As used herein, " / " can be interpreted as "and" or "or" depending on the situation.
[0033] In the present application, the term "antigen-binding fragment" refers to an antigen-binding fragment of an antibody and antibody analogs, which generally includes at least a portion of the antigen-binding region or variable region of the parent antibody, such as one or more CDRs; the fragment of the antibody retains at least certain binding specificity of the parent antibody.
[0034] The embodiments of the present application provide a Nanobody or antigen-binding fragment against porcine epidemic diarrhea virus (PEDV), the Nanobody (hereinafter also referred to as 3Nb17) or antigen-binding fragment comprises CDR1, CDR2 and HCDR3, the amino acid sequence of CDR1 is shown as SEQ ID NO: 1, the amino acid sequence of CDR2 is shown as SEQ ID NO: 2, and the amino acid sequence of CDR3 is shown as SEQ ID NO: 3.
[0035] It should be noted that the nanobody in the present application can be a humanized antibody, or an animal source antibody, such as a mouse source, a rabbit source or a camel source; in addition, the HCDR3 in the above-mentioned antibody belongs to the hypervariable region of the heavy chain variable region, and the stability is weaker than that of HCDR1 and HCDR2.
[0036] In some specific examples, the above-mentioned nanobody or antigen binding fragment further comprises FR1 having at least 80% identity with the sequence shown in SEQ ID NO: 4 and / or FR2 having at least 80% identity with the sequence shown in SEQ ID NO: 5 and / or HFR3 having at least 80% identity with the sequence shown in SEQ ID NO: 6 and / or FR4 having at least 80% identity with the sequence shown in SEQ ID NO: 7.
[0037] It should be noted that the FR (FR1, FR2, FR3, FR4) of the above-mentioned nanobody is a framework region, which is used to connect the CDR region and is relatively stable; in addition, the sequence of the FR region of the heavy chain in the above-mentioned antibody and the sequence of the CDR region can be arranged as FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, respectively, to constitute the heavy chain variable region of the above-mentioned two antibodies; in addition, the at least 80% identity in the present application includes ≥80%, ≥85%, ≥90%, ≥95% or 100% identity and the like.
[0038] In some specific examples, the above-mentioned nanobody or antigen binding fragment comprises a variable region having at least 70% identity with the sequence shown in SEQ ID NO: 8.
[0039] It should be noted that the at least 70% identity refers to an identity of ≥70%, such as 75%, 80%, 85%, 90%, 95% or 100%; of course, it should be understood that the sequence with at least 70% identity has a similar function as the above-mentioned sequence.
[0040] In some specific examples, the above-mentioned nanobody or antigen binding fragment further comprises CH2 and CH3.
[0041] In some specific examples, the above-mentioned CH2 comprises a sequence having at least 70% identity with the sequence shown in SEQ ID NO: 9; and / or CH3 comprises a sequence having at least 70% identity with the sequence shown in SEQ ID NO: 10.
[0042] It should be noted that the nanobody or antigen binding fragment in the present application comprises CH2 and CH3 in addition to the above-mentioned variable region, and the source of CH2 and CH3 can be human or other animal sources (such as rabbit source, pig source and the like animal sources).
[0043] It is also to be understood that, as mentioned above, at least 70% identity means that the identity is ≥ 70%, such as 75%, 80%, 85%, 90%, 95% or 100%; it is of course to be understood that a sequence having at least 70% identity has similar functions as the above-mentioned sequences.
[0044] The present application also provides any one of the following:
[0045] (i) a polynucleotide molecule comprising a nucleotide sequence encoding a Nanobody or antigen binding fragment according to the present application; in particular, the polynucleotide molecule according to the present application is obtained by translating a Nanobody or antigen binding fragment according to the present application according to conventional methods; in addition, it can also be a nucleotide sequence obtained by further modifying the sequence after translation of the above-mentioned amino acid sequence; the method of modification is a nucleotide modification method known in the art for increasing expression efficiency or other purposes;
[0046] (ii) an expression vector comprising the polynucleotide molecule in (i); in particular, the expression vector according to the present application can be selected from any one of a lentiviral expression vector, a retroviral expression vector, an adenoviral expression vector, an adeno-associated viral expression vector, a DNA vector, an RNA vector and a plasmid. The lentiviral vector can be selected from the following group: human immunodeficiency virus 1 (HIV-1), human immunodeficiency virus 2 (HIV-2), visna-maedivirus (VMV) virus, caprine arthritis- encephalitis virus (CAEV), equine infectious anaemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) and simian immunodeficiency virus (SIV);
[0047] (iii) an engineered bacterium comprising the expression vector in (ii); in particular, the engineered bacterium according to the present application refers to a bacterium that can assist the expression of the above-mentioned expression vector, such as Escherichia coli, and the Escherichia coli comprising the expression vector herein is the Escherichia coli into which the expression vector is introduced;
[0048] (iv) a host cell comprising the expression vector in (ii); in particular, the host cell according to the present application refers to a cell that can assist the expression of the above-mentioned expression vector, such as a yeast cell;
[0049] (v) a product for detecting porcine epidemic diarrhea virus, including the nanobody or antigen-binding fragment of the present application or the polynucleotide molecule in (i) or the expression vector in (ii) or the engineered bacteria in (iii) or the host cell in (iv); in particular, the nanobody or antigen-binding fragment of the present application has strong binding with the surface protein of porcine epidemic diarrhea virus, and based on this, a product for detecting porcine epidemic diarrhea virus can be prepared; the product can be a detection reagent or a detection kit, such as an immunoblotting-based reagent or kit, or an immunoenzyme technology-based reagent or kit, etc.
[0050] (vi) a pharmaceutical composition, including the nanobody and / or antigen-binding fragment of the present application or the polynucleotide molecule in (i) or the expression vector in (ii) or the engineered bacteria in (iii) or the host cell in (iv); in particular, as described above, based on the strong binding of the nanobody or antigen-binding fragment of the present application with the surface protein of porcine epidemic diarrhea virus, a pharmaceutical composition for preventing or treating porcine epidemic diarrhea virus infection can be prepared; the pharmaceutical composition here refers to a pharmaceutical composition in which the nanobody or antigen-binding fragment of the present application is combined with other small molecule compounds, polypeptides, antibodies or proteins that can be effectively used for preventing or treating porcine epidemic diarrhea virus infection; for example, a bi- or multi-antibody combined with other antibodies, an ADC combined with a small molecule compound, a fusion protein combined with other proteins; the selection and use can be made according to specific conditions.
[0051] (vii) a pharmaceutical preparation, including the nanobody and / or antigen-binding fragment of the present application or the polynucleotide molecule in (i) or the expression vector in (ii) or the engineered bacteria in (iii) or the host cell in (iv) or the pharmaceutical composition in (vi); in particular, the above nanobody and / or antigen-binding fragment, etc. and the above pharmaceutical composition can be added to a pharmaceutically acceptable carrier to prepare different dosage forms for different clinical needs; the dosage forms can include sprays, oral liquids, tablets, atomizing agents, granules, capsules or ointments; of course, according to different dosage forms, the selection of the pharmaceutically acceptable carrier is different, and the preparation can be made according to the methods known in the art.
[0052] The embodiments of the present application also provide an application of the nanobody and / or antigen-binding fragment of the present application or the polynucleotide molecule in (i) or the expression vector in (ii) or the engineered bacteria in (iii) or the host cell in (iv) in the preparation of a product for diagnosing porcine epidemic diarrhea virus infection disease.
[0053] It should be noted that it should be understood that the detection of porcine epidemic diarrhea virus can be used for the diagnosis of porcine epidemic diarrhea virus infection disease, that is, the product for detecting porcine epidemic diarrhea virus in the present application is also applicable to the diagnosis of porcine epidemic diarrhea virus infection disease, such as the diagnosis of porcine epidemic diarrhea; in addition, the product for detecting porcine epidemic diarrhea virus includes but is not limited to detection reagents, detection kits, reagent cards or microfluidic chips, etc.
[0054] The present application also provides a use of the nanobody and / or antigen binding fragment in the present application and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacteria in (iii) and / or the host cell in (iv) in the preparation of a medicine for preventing or treating porcine epidemic diarrhea virus infection disease.
[0055] In some specific examples, the porcine epidemic diarrhea virus infection disease described above is porcine epidemic diarrhea.
[0056] In order to better understand the present application, the content of the present application will be further illustrated below in combination with specific examples, but the content of the present application is not limited to the examples below.
[0057] I. Immunization of alpaca
[0058] (I) Preparation and purification of PEDV S protein
[0059] (1) Construction of pCAGGS-PEDV S gene recombinant plasmid and extraction of plasmid
[0060] 1) Primer design: According to the PEDV CH-HB2-2018 strain (GenBank No. MK606369) published on NCBI as a template, the PEDV S gene sequence was codon-optimized, Kozak sequence and human signal peptide were added in N segment, 8×His tag was added in C segment, and EcoR I and Xho I enzyme digestion sites were added in both segments. The gene was synthesized by a company and a pCAGGS-PEDV-S eukaryotic expression plasmid was constructed.
[0061] 2) PCR identification of plasmid: pCAGGS-PEDV-S plasmid was used as a template, and pCAGGS universal primers were used for PCR identification, and the reaction system and amplification conditions are shown in Table 1 and Table 2.
[0062] Table 1 PCR amplification reaction system
[0063]
[0064]
[0065] Table 2 PCR amplification reaction conditions
[0066]
[0067] The amplified gene fragment was 4328 bp in size, as shown in Figure 1 Figure 2, which was consistent with the expected size of the target band. 60 ng of the vector was used for ligation and transformation according to the pmol ratio of the vector to the target fragment of 1:3. Single colonies were picked and sent for sequencing. The sequencing results were analyzed by alignment, and no base mutations were found. Glycerol was used to preserve the bacteria and extract plasmids.
[0068] 3) Plasmid extraction: The pCAGGS-PEDV S clone bacterial solution was inoculated into 200 mL of LB liquid medium containing Amp at a ratio of 1:1000, and cultured at 37°C in a constant temperature shaker for 12-16 h. An endotoxin-free plasmid extraction kit was used to extract the plasmid. Based on the operation according to the instructions, the experimental steps were improved. Isopropanol was pre-cooled at -80°C for 30 min, then mixed with the plasmid extract, and placed at -20°C for 1 h to accelerate plasmid precipitation, which could significantly improve the plasmid extraction amount. After determining the plasmid concentration, it was stored at -20°C.
[0069] (2) Expression of PEDV S protein
[0070] The HEK-293F cell culture bottle was placed in a constant temperature shaker at 37°C, 5% CO2, and 150-175 rpm; after 12 h, the cells were counted, and the cell concentration was 2.5-3.0 x 10 6 / mL for transfection; 400 mL of HEK-293F cells were used for transfection, and 400 μg of DNA was diluted with 150 mM NaCl to a total volume of 10 mL, and gently mixed; 2 mL of Sinofection transfection reagent was diluted with 150 mM NaCl to a total volume of 10 mL, and gently mixed; the diluted DNA and transfection reagent were separately incubated for about 5 min; the plasmid and transfection reagent were gently mixed, the total volume was 20 mL, and incubated at room temperature for 20 min. The mixed solution was added dropwise to the cell culture solution, and the bottle was gently shaken during the addition. After shaking, it was returned to the shaker for continuous culture, and the bottle was tightly capped (i.e. no CO2 was introduced into the cell bottle). After 24 h of transfection, the bottle was loosened to meet the oxygen and CO2 emission requirements for the subsequent high-density growth of cells, to prevent the accumulation of CO2 from causing the pH of the culture solution to be too low (the culture solution was yellow), which would affect cell growth. 14 mL of SMS293-SUPI feed solution was added at 24 h after transfection, and the feed solution (14 mL) was added every 48 h thereafter, and the sample was collected at 7 d after transfection.
[0071] (3) Purification of PEDV S recombinant protein
[0072] PEDV S recombinant protein was expressed using the HEK-293F mammalian cell expression system, and first purified using a HisTrap Excel column, as follows: Figure 2 As shown. The PEDV S protein was further purified using a HiLoad Superdex 20010 / 300 gel chromatography column, as shown. Figure 3 As shown. The sample purified by molecular sieve was identified using an SDS-PAGE protein identification gel. The expected monomer size of the target protein was approximately 180 kDa. After staining the SDS-PAGE protein identification gel with Coomassie Brilliant Blue and destaining, a clear protein band was visible at 180 kDa. Figure 4 As shown, protein samples 6–9 were concentrated and the medium was changed using 100 kDa protein concentrators. Figure 5 As shown, the purified PEDV S protein was identified by Western blotting using a mouse-derived Anti-His-tagged antibody. The His tag was detected at 100 kDa, consistent with the expected target protein size; details are as follows:
[0073] Collect HEK-293F cell culture medium 7 days after transfection. Centrifuge at 8000 rpm for 1 h at 4℃ using a vertical high-speed low-temperature centrifuge. Collect the HEK-293F cell suspension expression supernatant. Filter the supernatant through a 0.22 μm filter membrane under negative pressure to remove cell debris. First, rinse the column with deionized water filtered through a 0.22 μm filter membrane at a flow rate of 2 mL / min. Then, equilibrate 3-5 column volumes with buffer A (20 mmol / L Tris-HCl, 150 mmol / L NaCl, pH 8.0) at the same flow rate. Filter the expression supernatant of PEDVS recombinant protein under negative pressure and transfer it to the HisTrap column. Flow the supernatant at 2 mL / min, being careful not to allow air bubbles to enter. Quickly rinse the A and B pumps of the protein purification instrument with water and buffer A at a flow rate of 10 mL / min, then adjust the flow rate to 2 mL / min and connect the HisTrap. For Excel columns, wash the protein purification instrument with 100% buffer A until the UV value levels up. Elute sequentially with buffer B containing 50 mmol / L, 100 mmol / L, 250 mmol / L, and 500 mmol / L imidazole. Collect the eluent for SDS-PAGE analysis. Transfer the eluent to a protein concentration tube and concentrate and wash three times with sterile PBS buffer. After elution, select an appropriate molecular sieve to purify PEDV S protein based on molecular weight and protein quantity. For Superdex 200 molecular sieve usage: Before installing the column, first set the maximum alarm pressure and flow rate on the Akta. The column pressure for large columns is: column inlet pressure (i.e., system pressure) + 0.15 MPa; flow rate: 0.5–1 mL / min; column volume: 120 mL.
[0074] Before purifying the protein, 40 mL of water and 80 mL of buffer (PBS with pH 7.4) were passed through. After the UV value curve was stable, the sample was loaded on the loop ring. According to the volume of the concentrated protein, the appropriate loop ring (1 / 2 / 5 mL) was selected. After the PBS was flushed through the three loop rings, the protein was absorbed into the loop ring. According to the molecular weight of the protein, the corresponding volume was found in the molecular sieve list. The peak collection was set as 5 mAU 0.8 mL per tube. The collected protein was placed on ice, and the appropriate concentration tube was selected after identification by SDS-PAGE protein gel. The purified PEDV S protein was identified by Western blotting using anti-his tag antibody.
[0075] (ii) Animal immunization
[0076] Immunization procedure: The llama was immunized with purified PEDV S protein three times, with an interval of 15 days each time. One week before cell sorting, a booster immunization was performed, and the llama was immunized a total of four times (as shown in Table 3).
[0077] Table 3 Llama immunization procedure
[0078] Number of immunization Immunization dose (μg / each) Immunization method Adjuvant First immunization 400 Subcutaneous injection in back, in points Freund's complete adjuvant Second immunization 400 Subcutaneous injection in back, in points Freund's incomplete adjuvant Third immunization 400 Subcutaneous injection in back, in points Freund's incomplete adjuvant Boosting 400 Subcutaneous injection in back, in points Freund's incomplete adjuvant
[0079] Before flow sorting specific B lymphocytes, 5 mL of blood was collected from the medial thigh vein of the llama; it was placed in a 4°C refrigerator overnight, centrifuged at 12000 rpm for 1 min, and the serum was taken. ELISA test was performed to test the immune effect, and 2-fold dilution was used to verify the neutralizing effect of the serum. The results are shown in Table 4. After the serum of the llama was diluted 1024000 times, its OD 450nm >cut-off value and P / N≥2.
[0080] Table 4 Llama serum antibody titer detection
[0081]
[0082] II. Isolation and RNA extraction of llama PBMC
[0083] (i) Llama PBMC acquisition
[0084] (1) After the llama was immunized with PEDV S protein, blood (50 mL) was collected from the medial thigh vein of the llama using an anticoagulant tube;
[0085] (2) In the clean bench, the blood sample was transferred from the anticoagulation tube to a 15 mL tube, centrifuged at 2000 rpm for 10 min. After centrifugation, the blood was divided into two layers, the upper layer was light yellow liquid, and the lower layer was red blood cells. Carefully aspirate the upper liquid into a 1.5 mL EP tube and store at -80°C; take a 50 mL tube, add a small amount of PBS to it, then rinse with a 10 mL pipette, insert into the 15 mL tube cell layer to aspirate the cells, and transfer to the 50 mL tube, ensuring that the final blood and PBS are 1:1, and mix well.
[0086] (3) Take the same amount of 50 mL tube as used in the previous step, add 3 / 4 times diluted blood sample lymphocyte separation medium to each tube, and tilt to make the separation liquid fully wet the tube wall. Then tilt the tube with separation liquid and blood sample as much as possible, connect the tube mouth, slowly spread the diluted blood sample on the surface of the separation liquid, and slowly tilt the separation liquid side with both hands. Finally, the liquid is divided into two layers, the blood sample is on the top, and the separation liquid is on the bottom, and the mixing is as little as possible. After balancing, place the 50 mL tube in the centrifuge smoothly, the initial speed is 100 rpm, 40 min, and the speed is increased by 100 rpm manually when the speed is stable until the final speed is stable to 2500 rpm. Adjust the centrifugation time to 25 min.
[0087] (4) When the centrifugation is left for 5 min, start to manually reduce the speed (need to adjust the speed from 2500 rpm to 0 rpm within 5 min, so every 12 s reduce the speed by 100 rpm), and further extend the speed reduction frequency and time when the last few hundred rotations. After centrifugation, it can be observed that the liquid is divided into three layers, the upper layer is light yellow and clear liquid, the middle layer has cloud-like liquid which is PBMC layer, and the lower layer is red and opaque which is blood cell layer. Take a 15 mL tube and add 1 mL PBS in advance. Then insert the pipette into the PBMC layer and start to aspirate the PBMC from top to bottom, rotate and transfer to the 15 mL tube with 1 mL PBS.
[0088] (5) Calculate the actual volume of PBMC, add 3 times the amount of PBS to PBMC, if the 15 mL tube volume is insufficient, it can be transferred to a 50 mL tube in advance. Mix gently up and down, centrifuge at 2000 rpm for 5 min, discard the supernatant. Resuspend the cells with 2 mL PBS and transfer to a 15 mL tube, add PBS to 15 mL, gently mix up and down to wash the cells, centrifuge at 2000 rpm for 5 min, discard the supernatant, repeat the operation, a total of two times.
[0089] (II) RNA extraction
[0090] After thawing the alpaca B lymphocytes, centrifuge and add 1 mL of Trizol; vortex for 30 seconds, and stand at room temperature for 5 minutes; add 0.2 mL of chloroform to 1 mL of Trizol, tightly cover the EP tube cap, shake vigorously in the hand for 15 seconds, and stand at room temperature for 5 minutes (do not vortex, because it will cause DNA breakage and contaminate RNA, and two EP tube clamps are used to mix the EP tube); centrifuge at 12000g at 4°C for 15 minutes, carefully take the upper aqueous phase (0.5 mL) and place it in a new EP tube, and add an equal volume (0.5 mL) of isopropanol to the aqueous phase; two EP tube clamps are used to mix the EP tube upside down, stand at room temperature for 10 minutes, and centrifuge at 12000g (4°C) for 10 minutes, discard the supernatant with a 1 mL range pipette, add 1 mL of 75% ethanol, use your fingers to pop up the bottom RNA, centrifuge at 7500g (4°C) for 5 minutes, discard the supernatant with a 1 mL range pipette (residual 10-50 μL of 75% ethanol), centrifuge again for a short time, and use a 100 μL range pipette to suck the residual 75% ethanol; let the precipitated RNA dry naturally at room temperature; dissolve the RNA precipitate with 20-50 μL of RNase-free water.
[0091] III. Amplification of Nanobodies
[0092] (I) Reverse transcription and gene enrichment (5' Race)
[0093] 5' Race: First, pre-bind the RNA with the primer, take the PCR tube, add the following prepared solution (6 μL system), then vortex and centrifuge, 72°C for 3 minutes, 42°C for 2 minutes, 4°C forever, and stand on ice for standby; 2 μL of the above RNA; 2 μL of 5'-RACE CDS Primer A; 2 μL of dNTP mix (10 mM each); RT Mix configuration ratio, for example, Table 5.
[0094] Table 5 RT Mix configuration ratio
[0095]
[0096]
[0097] Mix the RNA and primer pre-binding system with the RT Mix, shake and centrifuge, and perform the following operations in the PCR instrument (as shown in Table 6).
[0098] Table 6 Reverse transcription PCR amplification system
[0099]
[0100] The RT product was taken as a template to amplify and enrich the ds cDNA, and the enrichment conditions are shown in Table 7. The high-fidelity enzyme amplification procedure was 98°C for 30 s; (98°C for 10 s, 65°C for 15 s, and 72°C for 15 s) for 10 cycles; 72°C for 10 min; 4°C forever; 3-5 tubes were amplified under the above conditions, and after the amplification, all the positive hole enriched cDNA was collected together as PCR 1, and vortexed to mix, to serve as the template for the next round of PCR 2.
[0101] Table 7 Configuration ratio of enrichment system
[0102] Ingredients Volume (μL) Phusion DNA Polymerase (2 U / μL) 0.2 5* Phusion HF buffer 4 sscDNA 5 dNTP (10 μM) 0.4 Nested Universal Primer A 1 CALL002 / AL.CH2.2 / AL.CH2 (Table 18) 1 H2O 8.4 Total 20
[0103] (II) Nesting PCR to amplify and expand the VHH gene segment of the llama antibody
[0104] Primer selection: the first round of PCR 1 product was taken as a template to amplify and expand the VHH gene segment by nest PCR. The VHH gene was amplified by 9 pairs of upstream primers and 6 pairs of downstream primers randomly arranged and combined (Table 8) to expand the VHH gene segment. The PCR system was prepared according to Table 9. The amplification procedure was 98°C for 30 s; (98°C for 10 s, 65°C for 15 s, and 72°C for 15 s) for 30 cycles; 72°C for 10 min; 4°C forever; the positive hole was recovered after running the gel (after cutting and mixing together for recovery).
[0105] Table 8 Amplification primers of the llama nanobody VHH gene
[0106]
[0107]
[0108] Table 9 Configuration ratio of PCR system
[0109] Ingredients Volume (μL) Phusion DNA Polymerase (2 U / μL) 0.2 5* HF buffer 4 dNTP 5 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 1 cDNA template 1 Sterile ddH2O 8.4 Total volume 20
[0110] (III) Enzymatic digestion and transformation
[0111] The VHH segment recovered by PCR 2 and the pComb3XSS empty vector were respectively double-digested by Sfi I endonuclease, and the enzyme digestion system was as shown in Table 10, and then T4 DNA ligase was used for ligation. The ligation product was transformed into Top 10 competent cells by heat shock method, and 4 tubes of Top 10 competent cells were repeatedly transformed, and were coated on a 15 cm solid plate for culture. 1 mL of liquid medium was added, and all the colonies in the 4 dishes were scraped off with a glass rod, washed clean, and then centrifuged to collect the bacteria. After the supernatant was discarded, the plasmid was directly eluted, dissolved with deionized water, and the concentration was about 1000 ng / μL. 1-2 mL was used for storage, and the plasmid pComb3XSS-VHH was stored.
[0112] Table 10 Enzyme digestion system configuration ratio
[0113] Ingredients Volume (μL) 10* Buffer 5 Sfi I 1 VHH fragment / pComb3XSS (500 ng / μL) 8 sterile ddH2O 36 Total volume 50
[0114] (IV) Construction of phage antibody display library
[0115] (1) Two 0.2 cm electrotransformation cups were washed with alcohol for 3 times, and then washed with double distilled water for 3 times. The cups were dried in an oven and then covered with a lid and placed on ice;
[0116] (2) 30 μg of the plasmid was taken (the volume should not exceed 30 μL) and added to 200 μL of TG1 competent cells. After mixing, the mixture was added to the electrotransformation cups, and the cups were gently tapped. The two cups were labeled;
[0117] (3) 1 mL of soc was prepared and inserted into a 15 mL centrifuge tube for standby;
[0118] (4) The electrotransformation instrument was set to EC2 1.8 KV 4.9 S interval. After the electrotransformation cups were placed in the electrotransformation instrument and a normal drop sound was heard, 1 mL of soc prepared in advance was quickly added. The mixture was suctioned and added to a 15 mL centrifuge tube (labeled in advance);
[0119] (5) After 37°C, 180 rpm, and 40 min, 10 mL of Amp medium was added (1 mL was taken out and the phage titer was determined according to step 6);
[0120] (6) After 1 h, 50 μL of help phage was added and reacted for 30 min;
[0121] (7) The mixture was transferred into a 300 mL Amp + , Kan + 2YT medium, and incubated for 4 h;
[0122] (8) 1:3000 IPTG (2 mg / μL) was added, and the mixture was incubated at 30°C and 180 rpm overnight;
[0123] (9) The mixture was centrifuged at 7000 g and 4°C for 10 min, and the supernatant was collected (the precipitated bacteria can be used for plasmid extraction);
[0124] (10) 1 / 5 volume of PEG8000 was added to the supernatant obtained in the previous step, and the mixture was placed on ice in a refrigerator or ice box for 4 h to precipitate the phage;
[0125] (11) The mixture was centrifuged at 16000 g and 4°C for 20 min, and the supernatant was discarded. The obtained precipitate was the amplified phage;
[0126] (12) The precipitate was resuspended with 20 mL of PBS;
[0127] (13) Resuspend 1h after lysis, repeat centrifugation at 7000g, 4°C for 10 min, collect the supernatant, add 1 / 5 volume of PEG8000, and place on ice for 3-4h to precipitate the phage;
[0128] (14) 12000g, 4°C centrifugation for 10 min, discard the supernatant, resuspend the precipitate with 10 mL 50% glycerol PBS, mix thoroughly, and store in aliquots.
[0129] (V) Phage titer determination
[0130] Take 10 μL of amplified phage and add to 990 μL of PBS (prepare 10 -2 phage dilution), then take an eight-row, add 180 μL of PBS to each well, and dilute 10-fold in 10 -2 phage dilution, add 20 μL to the first well 180 μL of PBS, and sequentially perform 10-fold dilution, dilute to the 8th well, take the last 4 titers for infection test, take 20 μL of phage after 10-fold dilution to infect 180 μL of ss320 cells for 10 min, only infect the last 4 wells, and coat Amp + LB plates. Count: how many single colonies are there on the last plate, and the phage concentration is N*10 12 / mL.
[0131] (VI) Enrichment screening of phage antibody library
[0132] The antigen used for enrichment screening of phage antibody library is crucial. In general, the purified soluble protein has high purity and large content, and can be directly coated on the ELISA plate, which is the best choice for screening specific antibodies. In addition, the virus particles purified by ultracentrifugation are beneficial to retain the conformation of the antigen epitopes that produce neutralizing antibodies and remove the interference of cell components. This is very beneficial for us to find neutralizing antibodies and reduce non-specific reactions.
[0133] (1) Coating: Take the purified target protein and place it in an ice box to slowly melt. After it is completely melted, dilute it with coating solution at a ratio of 1:100 to coat a 96-well plate, and place it in a 4°C refrigerator overnight for coating;
[0134] (2) Blocking: After overnight coating, discard the coating solution in each well (note that do not mix wells). Wash away the unabsorbed antigen with 0.1% PBST solution, add 200 μL of 0.5% BSA (0.5g BSA is added to 100 mL coating buffer and mixed, then filtered with a filter to remove bacteria) to each well, and incubate at room temperature for 1h. Then discard the blocking solution and wash the plate three times (add 0.1% PBST, incubate for 10 min, shake at 500 rpm for 2 min, and discard);
[0135] (3) Binding: Take 1 mL of the phage solution from the previous round of purification and mix it in 9 mL of 0.1% PBST. Add 100 μL to each well using a multichannel pipette and incubate at room temperature. Shake the plate at 250 rpm for 120 min. Discard the phage solution from the wells and wash the plate 9 times with 0.1% PBST;
[0136] (4) Elution: Add 50 μL of Elution buffer (50 mL of 0.2 mol / L glycine + 32.4 mL of 0.2 mol / L HCl, pH = 2.2) to each well using a multichannel pipette. Shake the plate at 450 rpm for 5-10 min. During the waiting period, prepare 3 2 mL centrifuge tubes containing 300 μL of 1 M Tris (15.01 g of glycine + 1 L of water, 1.66 mL of HCl + 100 mL of water);
[0137] (5) Mix the Elution buffer from each of the 32 wells together. This gives 96 / 32 = 3 tubes of 50 x 32 = 1600 μL of phage. Mix each tube of phage with the 300 μL of 1 M Tris buffer prepared in the previous step and collect in a 2 mL centrifuge tube. Make sure the pH is adjusted to 7.
[0138] (6) Determine the phage titer as described above in (5).
[0139] (7) Phage library amplification
[0140] (1) Take 1 tube of XL1-Blue competent cells (about 100 μL) and inoculate into 5 mL of liquid LB medium. Shake until the OD 600nm is between 0.6 and 0.8.
[0141] (2) Add 2 mL of phage to the 5 mL of bacterial solution and transfer to a 50 mL sterile centrifuge tube. Incubate at 37°C for 1 h at 220 rpm. Let stand at room temperature for 30 min.
[0142] (3) Add 13 mL of LB Amp + (1 / 1000) liquid medium. The final volume is now 20 mL. Incubate at 37°C for 1 h at 220 rpm. The OD 600nm value should be around 0.8.
[0143] (4) Add helper phage M13KO7 (9 x 10 12 pfu / mL) at a ratio of 1:1000 (20 μL). Incubate at 37°C for 30 min at 220 rpm.
[0144] (5) Pour the entire bacterial solution into a 500 mL bacterial flask (total liquid volume 80 mL). Add 60 mL of LB (Amp+ / kan + / Tet + ), shaking 4 hours, OD 600nm =1, IPTG (0.8 mol / mL, ratio 1:5000) was added, 30°C overnight;
[0145] (6) 5000g 4°C centrifugation for 20 min, collect supernatant (the precipitated bacteria can be used for plasmid extraction);
[0146] (7) 4 mL PEG8000 was added to the supernatant obtained in the previous step, and the mixture was placed in a 4°C refrigerator or ice box overnight to precipitate the phages;
[0147] (8) 8000g 4°C centrifugation for 20 min, discard the supernatant, and the obtained precipitate is the amplified phages;
[0148] (9) The obtained precipitate was resuspended with 2 mL PBS and then divided into 1.5 mL centrifuge tubes;
[0149] (10) 12000g room temperature centrifugation for 10 min, discard the precipitate, and transfer the supernatant to a 2 mL centrifuge tube, add 200-300 μL PEG8000 to precipitate the phages, and place the mixture in a 4°C refrigerator or ice box for 6-8 h or overnight;
[0150] (11) 8000g room temperature centrifugation for 20 min, discard the supernatant, and resuspend the precipitate with 200-500 μL PBS;
[0151] (12) Determine the phage concentration.
[0152] PEDV S protein was used as a coating antigen for solid-phase affinity screening using a phage antibody library. After three rounds of screening, a recombinant phage solution was obtained. The recombinant phages were diluted and plated before and after each round of screening to determine the titers, and the input and output of each round of phage selection were calculated to obtain the phage yield of each round of selection (as shown in Table 11). The recombinant phages after amplification and concentration in the third round of selection were used to infect SS320 in the logarithmic phase, which was plated on Amp + LB solid plates, and regular single colonies were picked, and 192 single colonies were named (3Nb1, 3Nb2, 3Nb3, …, 3Nb192).
[0153] Table 11 Titration determination before and after phage enrichment
[0154]
[0155] (Eight) Colony PCR identification
[0156] (1) After the colonies grow, select an appropriate amount of single colony (for example, 70 in the second round, 100 in the third round), transfer into 2 mL EP tube (containing 600 μL Amp-resistant LB medium), and incubate at 37°C for about 2 h;
[0157] (2) The reaction system of bacterial liquid PCR: 20 μL system, PCR reaction conditions as shown in Table 12, and the primers used as shown in Table 13;
[0158] (3) 1% agarose gel electrophoresis to identify PCR products: if there is a band at 1000 bp, it can be considered as a positive clone; send the positive clone for testing, preserve the bacteria, and inoculate the bacteria;
[0159] The positive situation of recombinant phage is detected by colony PCR, and the target band at 750 bp is positive, and vice versa. The results are as shown in Figure 6 Among the selected 192 clones, 184 were positive colonies, with a positive rate of 95.83%, indicating that a good enrichment effect was achieved.
[0160] Table 12 Colony PCR identification system
[0161]
[0162]
[0163] Table 13 VHH gene identification primers and eukaryotic plasmid construction primers
[0164] Primer name Base sequence (5'-3') ss320F TATGTTGTGTGGAATTGTGAGCGG ss320R GTTTGCCATCTTTTCATAATCAAAATCAC VHH-1-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-1-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCTG VHH-2-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-2-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCTG VHH-3-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGGTGGTGG VHH-3-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-6-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGGTGGTGG VHH-6-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-10-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGGTGGTGG VHH-10-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-11-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGGTGGTGG VHH-11-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-14-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCTACCGTGGCCCAGG VHH-14-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCAG VHH-21-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGCTGGTGG VHH-21-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCAG VHH-39-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-39-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-42-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGGTGGTGG VHH-42-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-74-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGGTGGTGG VHH-74-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCTG VHH-90-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-90-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-96-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCTACCGTGGCCCAGG VHH-96-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG
[0165] (Eight) Nanobody sequence analysis
[0166] Subsequently, 184 PCR-positive single phage clones were preserved and sent to the company for sequencing analysis. The sequencing results were analyzed by IMGT, and it was determined that the 184 antibody sequences were all alpaca VHH base sequences. The amino acid sequences of the 184 different nanobodies were analyzed by sequence alignment using MEGA 11 sequence analysis software, and finally 138 nanobodies with different amino acid sequences were identified (as shown in Figure 7 ).
[0167] (Nine) ELISA identification of phage
[0168] About 12 mL phage after panning, aliquot in 6 2 mL EP tubes, 1 mL from each tube mixed into 6 mL and put into 15 mL centrifuge tube for subsequent test, other phage preserved; 2 mL from 6 mL mixed phage for subsequent amplification test. Take 20 μL for culture amplification and sequencing, add 180 μL sterilized PBS to each well of 8-row array, take 20 μL mixed phage for 10 times dilution, then go to another 8-row array, add 180 μL ss320 competent to each well, take 20 μL phage from the previous step to 180 μL ss320 competent, infect for 10 min, take 100 μL infected ss320 competent to each of 8 Amp plates, culture for 10 h. Pick single colony and add to 15 mL EP (4 mL Amp LB) tube for amplification culture for 10 h, take 10 μL to 2 mL Amp LB for IPTG induction (1:1000), take 500 μL bacteria after induction for expression, centrifuge to take supernatant for ELISA identification, specific steps as follows:
[0169] (1) Coating: take the purified target protein in ice box and melt slowly, after complete melting, add the target protein to appropriate volume of coating buffer, so that the concentration of dissolved E protein is 2 mg / L; use syringe to add 100 μL coating buffer with dissolved target protein to high-binding Elisa plate, so that the content of target protein in each well is 200 ng. Coating at 4°C refrigerator overnight;
[0170] (2) Blocking: after overnight coating, discard the coating liquid in each well (note not to mix wells). Add 200 μL BSA with concentration of 0.5% (0.5 g BSA added to 100 mL coating buffer, mixed and filtered to remove bacteria) to block non-specific binding sites of phage pIII, after standing at room temperature for 1 h, discard the blocking liquid and wash the plate three times (add 0.1% PBST, stand for 10 min, shake at 500 rpm for 2 min, and pour off);
[0171] (3) Binding: add 100 μL phage PBST solution to each well in order, 6 wells for each sample, and the content of phage is required to be 1 x 10 12 pfu / mL. Record the order of sample loading. Stand at 37°C for 3 h, shake at 500 rpm for 2 min every 0.5 h.
[0172] (4) Elution: elute with 100 μL 0.1% PBST solution, shake at 500 rpm for 2 min, and pour off; wash 3 times;
[0173] (5) Incubate the primary antibody: dilute the primary antibody (mouse anti-Phage pIII) in 0.1% PBST at a ratio of 1:2500, and store in the dark. Add 100 μL of the primary antibody dilution to each well using an automated dispenser, and incubate at room temperature for 1 h;
[0174] (6) Elute: as in step (4);
[0175] (7) Incubate the secondary antibody: as in step (5), the secondary antibody is goat anti-mouse IgG-HRP;
[0176] (8) Elute: as in step (4);
[0177] (9) Develop color: add 50 μL of the color developing solution TMB to each well, and incubate at 37°C for 20 min until the color develops appropriately. Immediately add 50 μL of 2M HCl to stop the color developing reaction;
[0178] (10) Measure the OD value of each well using a spectrophotometer, and record the results. 450nm
[0179] The results are shown in Table 1. Figure 8
[0180] (X) Expression and verification of recombinant nanobodies
[0181] (1) Western Blot identification
[0182] Among the 138 nanobodies, 70 nanobodies with different CDR3 regions were selected for subsequent verification through IMGT sequence alignment analysis. First, the monoclonal strains expressing the 70 nanobodies were expanded and cultured, and IPTG was used to induce prokaryotic expression. After ultrasonic disruption, the supernatant containing the antibodies was obtained. The expression of the prokaryotic induced nanobodies was detected by Western Blot. The results are shown in Table 2. Figure 9
[0183] (2) Indirect immunofluorescence test
[0184] From 106 nanobodies, 18 strains (3Nb8, 3Nb17, 3Nb19, 3Nb20, 3Nb40, 3Nb47, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb78, 3Nb87, 3Nb100, 3Nb108, 3Nb118, 3Nb124, 3Nb137 and 3Nb164) were selected to construct pCAGGS-mIgH eukaryotic expression plasmid with high expression and strong reaction antigenicity. The 18 strains of nanobody eukaryotic expression plasmid were transfected into HEK-293T cells, and the expression supernatant was collected as a primary antibody. The reaction antigenicity of PEDV and nanobody was verified on PEDV infected Vero cells, and the results are shown in Figure 10 Figure A-R: 18 strains of PEDV nanobodies (3Nb8, 3Nb17, 3Nb19, 3Nb20, 3Nb40, 3Nb47, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb78, 3Nb87, 3Nb100, 3Nb108, 3Nb118, 3Nb124, 3Nb137 and 3Nb164); S: PEDV negative serum control; T: PEDV positive serum control; Among the 18 selected nanobodies, 12 nanobodies (3Nb17, 3Nb20, 3Nb40, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb87, 3Nb118, 3Nb124, 3Nb137 and 3Nb164) can cross react with PEDV.
[0185] (3) Flow cytometry detection
[0186] Two 10cm 2 plates of Vero cells were cultured, and after the cells were fully grown, they were digested and stored. PEDV S protein was incubated with different antibodies, and the protein-antibody complex was incubated with Vero cells (5x10 5 ) on ice for 30 min. Anti-His FITC (1:200) and Anti-Mouse IgG APCC (1:200) fluorescent antibodies were incubated on ice for 30 min. The incubated antibodies were discarded, and PBST was used for washing three times. Flow cytometry was used for detection.
[0187] The results of flow cytometry detection are shown in Figure 11As shown in the figure, A-R: 18 PEDV nanobodies (3Nb8, 3Nb17, 3Nb19, 3Nb20, 3Nb40, 3Nb47, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb78, 3Nb87, 3Nb100, 3Nb108, 3Nb118, 3Nb124, 3Nb137 and 3Nb164); S: PEDV negative serum control; T: PEDV positive serum control; Among the 18 nanobodies, 8 nanobodies (3Nb17, 3Nb20, 3Nb40, 3Nb71, 3Nb72, 3Nb87, 3Nb124 and 3Nb137) can block the binding of PEDV S protein and Vero cells, and the blocking effect of 3Nb17, 3Nb20, 3Nb40 and 3Nb124 is the best.
[0188] (4) Virus micro-neutralization experiment of nanobodies
[0189] Recover Vero cells and pass them to 15 cm 2 cell dishes. After the cells are fully covered, wash them 3 times with PBS, take 100 μL of PEDV CH-HB2-2018 strain diluted in 20 mL of DMEM, add it to the cell dishes, and incubate it in a 37°C, 5% CO2 incubator for 1 h, then wash it 3 times with PBS. Add 10 μg / mL of trypsin in DMEM maintenance solution, and after 48 h, collect the sample, freeze it in a -80°C refrigerator for 3 times, and collect the virus. Virus TCID 50 Determination: In a 96-well plate, inoculate an appropriate amount of Vero cells, and when the cells are fully grown, dilute the virus 10 times in an EP tube, wash the 96-well plate cells 3 times, and add the diluted virus solution to the 96-well plate cells in order. After 48 h, observe the cytopathic effect, and calculate the TCID of the virus 50 . In a 96-well plate, inoculate an appropriate amount of Vero cells, and when the cells are fully grown, mix the purified PEDV antibody and virus solution (200 TCID 50 ) uniformly, and incubate it in a 37°C, 5% CO2 incubator for 1 h. Wash the 96-well plate cells with PBS 3 times, add the antibody-virus mixture to the 96-well plate, and incubate it in a 37°C, 5% CO2 incubator for 1 h. After washing 3 times with PBS, add 10 μg / mL of trypsin in DMEM maintenance solution, and after 48 h, observe the neutralization results.
[0190] The virus neutralization experiment is as Figure 12 shown. The selected 8 nanobodies can all neutralize PEDV CH-HB2-2018 strain, and the neutralization titer of 3Nb17 nanobody is the highest, with a half inhibitory concentration (IC 50 ) as high as 0.03271 μg / mL, which is consistent with the identification results of flow cytometry.
[0191] (5) SPR identification of Nanobodies
[0192] Surface plasmon resonance experiments can be used to detect protein-protein interactions in vitro, and the kinetic parameters of the interaction can be obtained, including dissociation constant (affinity), association rate and dissociation rate; the BIAcore3000 was used to determine the kinetic parameters of the in vitro binding of PEDV S protein and its antibody:
[0193] 1) Both proteins that need to be studied for interaction are replaced into the HEPES buffer (0.01M HEPES, pH 7.4, 0.15M NaCl, 3mM EDTA, 0.005% v / v surfactant P20) used for SPR experiments, and the HEPES buffer needs to be degassed by ultrasonic before the experiment;
[0194] 2) The concentrations of the stationary phase and the mobile phase are set to 10 μg / mL and 1 μM-100 μM, respectively;
[0195] 3) The stationary phase is coupled to a channel in the chip, and bovine serum albumin (BSA) is coupled to another channel as a background control, and in some cases a blank channel can also be used as a background control; when coupling proteins, the machine flow rate is generally set to 5 μL / min;
[0196] 4) Estimate the range of affinities of the subject, which can be divided into nanomolar and micromolar levels, and 1 nM and 1 μM of the mobile phase protein can be used for binding experiments to determine the range of affinities;
[0197] 5) Within the affinity range obtained in the previous step, design a series of concentration gradients, dilute the mobile phase protein by a factor of two, and perform a complete on-machine binding experiment; we generally choose the KINJECT mode to determine the kinetic parameters, and the machine flow rate is 30 μL / min, the injection binding time is generally 1-2 min (according to whether the binding curve is saturated to determine the required time), and the dissociation curve collection time is generally 1-5 min (according to the speed of dissociation to adjust the specific time setting);
[0198] 6) Use BIAevaluation software to analyze the kinetic parameters of the subject and plot them.
[0199] The results of SPR are shown in Figure 13 Among the 8 selected Nanobodies (3Nb17, 3Nb20, 3Nb40, 3Nb71, 3Nb72, 3Nb87, 3Nb124 and 3Nb137), Nanobody 3Nb17 has the strongest binding force to PEDV S protein, with a dissociation rate constant (kD) of 7.57 x 10 -10 .
[0200] Finally, it is to be explained that the above embodiments are only used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or equivalently replaced without departing from the purpose and scope of the present application, and all of them should be covered in the scope of the claims of the present application.
Claims
1. A nanobody targeting porcine epidemic diarrhea virus (PEDV), characterized in that, The nanobody includes CDR1, CDR2 and CDR3. The amino acid sequence of CDR1 is shown in SEQ ID NO:1, the amino acid sequence of CDR2 is shown in SEQ ID NO:2 and the amino acid sequence of CDR3 is shown in SEQ ID NO:
3.
2. The nanobody according to claim 1, characterized in that, The nanobody also includes FR1 having at least 80% identity with the sequence shown in SEQ ID NO:4 and / or FR2 having at least 80% identity with the sequence shown in SEQ ID NO:5 and / or FR3 having at least 80% identity with the sequence shown in SEQ ID NO:6 and / or FR4 having at least 80% identity with the sequence shown in SEQ ID NO:
7.
3. The nanobody according to claim 1, characterized in that, The nanobody includes a variable region that has at least 70% identity with the sequence shown in SEQ ID NO:
8.
4. The nanobody according to any one of claims 1 to 3, characterized in that, Nanobodies also include the CH2 and CH3 regions of the mouse IgG1 subtype.
5. The nanobody according to claim 4, characterized in that, The CH2 region contains a sequence that is at least 70% identical to the sequence shown in SEQ ID NO:9; and / or the CH3 region contains a sequence that is at least 70% identical to the sequence shown in SEQ ID NO:
10.
6. Any one of the following substances: (i) A polynucleotide molecule encoding the nanobody as described in any one of claims 1 to 5; (ii) an expression vector, including the polynucleotide molecule in (i); (iv) Host cells, including the expression vectors in (ii); (v) Reagents, kits, reagent cards or microfluidic chips for detecting porcine epidemic diarrhea virus, including the nanobody as described in any one of claims 1 to 5; (vi) A pharmaceutical composition comprising the nanobody as claimed in any one of claims 1 to 5 and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the host cell in (iv); (vii) A pharmaceutical formulation comprising a nanobody as claimed in any one of claims 1 to 5 and / or a polynucleotide molecule in (i) and / or an expression vector in (ii) and / or a host cell in (iv) and / or a pharmaceutical composition in (vi).
7. The use of the nanobody according to any one of claims 1 to 5 and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the host cell in (iv) of claim 6 in the preparation of reagents, kits, reagent cards or microfluidic chips for diagnosing porcine epidemic diarrhea virus infection.
8. The use of the nanobody according to any one of claims 1 to 5 and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the host cell in (iv) of claim 6 in the preparation of a medicament for treating porcine epidemic diarrhea virus infection.
9. The application according to claim 7 or 8, characterized in that, Porcine epidemic diarrhea virus infection causes porcine epidemic diarrhea.
Citation Information
Patent Citations
Antigen binding polypeptides
CN102216328A
Single-domain heavy chain antibody for detecting porcine epidemic diarrhea virus, preparation method and application of single-domain heavy chain antibody
CN108892723A