Recombinant nucleotide fragment combination containing multiple rice disease and pest resistance genes, detection primer and application thereof

Abstract

The embodiment of the present application relates to the field of molecular breeding, in particular to a recombinant nucleotide fragment combination containing multiple rice disease and pest resistance genes and a detection primer and application thereof. The recombinant nucleotide fragment combination provided by the present application is selected from at least one of the sequences containing the nucleotides shown in SEQ ID NO. 1-8, or a complementary sequence thereof. The recombinant nucleotide fragment can be used as a specific recognition marker of a major gene, and is applied to molecular marker selection breeding; and can be used as a specific molecular recognition marker for identifying rice materials carrying a broad-spectrum resistance gene.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding, specifically to a combination of recombinant nucleotide fragments containing multiple rice disease and pest resistance genes, and their detection primers and applications. Background Technology

[0002] Rice production faces threats from various biological stresses, including major diseases such as rice blast, bacterial leaf blight, and bacterial leaf streak, as well as major insect pests such as brown planthoppers. These diseases and pests, occurring individually or in combination each year, cause severe yield reductions or even total crop failure. Developing new rice varieties with host resistance is the most economical and effective method for controlling rice diseases and pests. With the development of rice functional genomics and molecular biotechnology, a large number of resistance genes with breeding value have been identified and cloned. Utilizing the sequence polymorphism information of these genes, breeders can effectively identify the genetic information of existing varieties, thereby enabling molecular design improvements based on variety requirements and achieving the goal of precision breeding.

[0003] To date, over 100 rice blast resistance genes / QTLs, at least 47 bacterial blight resistance genes / QTLs, 13 bacterial leaf streak resistance QTLs, and over 40 brown planthopper resistance genes have been identified. Among these genes / QTLs, 23 rice blast resistance genes containing approximately 35 different alleles, 13 bacterial blight resistance genes containing approximately 23 alleles, and 7 brown planthopper resistance genes containing 10 alleles have been cloned. Pi1 and Pi2 are two broad-spectrum rice blast resistance genes located on chromosomes 11 and 6 of rice, respectively, and have been successfully cloned. Studies have shown that merging these two genes can significantly improve the rice blast resistance of recipient rice. The recessive gene xa5, located on chromosome 5 of rice, provides resistance to both bacterial blight and bacterial leaf streak, and has also been successfully cloned. Bph14 and Bph15 are two major resistance genes for brown planthopper, located on chromosomes 3 and 4 of rice, respectively. The Bph14 gene has been successfully cloned, while the Bph15 gene has been finely mapped but has not yet been cloned. Summary of the Invention

[0004] Purpose of the invention

[0005] The purpose of this invention is to provide a combination of recombinant nucleotide fragments containing multiple rice disease and pest resistance genes, along with their detection primers and applications. These recombinant nucleotide fragments were obtained using molecular marker-assisted selection breeding technology to cultivate rice plants containing multiple rice disease and pest resistance genes. The recombinant nucleic acid fragment Rec3-1 contains the 1098 bp sequence shown in SEQ ID No. 1, which is located upstream of and closely linked to the Bph14 gene in rice plants; the recombinant nucleic acid fragment Rec4-1 contains the 1151 bp sequence shown in SEQ ID No. 2, which is located upstream of and closely linked to the Bph15 gene in rice plants; the recombinant nucleic acid fragment Rec4-2 contains the 845 bp sequence shown in SEQ ID No. 3, which is located downstream of and closely linked to the Bph15 gene in rice plants; the recombinant nucleic acid fragment Rec11-1 contains the 796 bp sequence shown in SEQ ID No. 4, which is located upstream of the Pi1 gene in rice plants and closely linked to this major gene; the recombinant nucleic acid fragment Rec6-1 contains the 1048 bp sequence shown in SEQ ID No. 5, which is located upstream of and closely linked to the Pi2 gene in rice plants; the recombinant nucleic acid fragment Rec6-2 contains the sequence shown in SEQ ID No. 1; and the recombinant nucleic acid fragment Rec6-2 contains the sequence shown in SEQ ID No. 1. The 1286bp sequence shown in SEQ ID No. 6 is located downstream of and closely linked to the Pi2 gene in rice plants; the nucleotide sequence of the recombinant nucleic acid fragment Rec5-1 contains the 656bp sequence shown in SEQ ID No. 7, which is located upstream of and closely linked to the xa5 gene in rice plants; the nucleotide sequence of the recombinant nucleic acid fragment Rec5-2 contains the 1266bp sequence shown in SEQ ID No. 8, which is located downstream of and closely linked to the xa5 gene in rice plants.

[0006] During rice hybridization, homologous recombination occurs between genomes from different sources during meiosis, resulting in new DNA sequence combinations. Since genomic recombination is random, theoretically, any new nucleotide sequence produced by recombination from genomes from different sources is unique, exhibiting extremely high specificity. Recombinant DNA sequences located near major genes are tightly linked to them and exist only in the selected recombinant progeny plants, possessing uniqueness. Therefore, on the one hand, because recombinant DNA sequences are tightly linked to specific major genes, they can serve as specific recognition markers for those major genes, applicable to molecular marker-assisted selection breeding; on the other hand, because this recombinant DNA exists only in the selected recombinant progeny plants, it can also serve as a specific molecular recognition marker for that material. By detecting whether the rice material being tested contains this recombinant DNA sequence, it can be determined whether the tested rice material is a selected recombinant rice plant or whether it was bred using rice plants containing this recombinant DNA sequence as parents.

[0007] Solution

[0008] To achieve the objective of this invention, embodiments of this invention provide a combination of recombinant nucleotide fragments, wherein the recombinant nucleotide fragments are selected from at least one of the fragments or combinations thereof (1)-17) below:

[0009] 1) A sequence containing nucleotides 50-1054 of the sequence shown in SEQ ID NO.1, or its complementary sequence;

[0010] 2) Contains the sequence shown in SEQ ID NO.1, or its complementary sequence;

[0011] 3) A sequence containing nucleotides 340-903 of the sequence shown in SEQ ID NO.2, or its complementary sequence;

[0012] 4) Contains the sequence shown in SEQ ID NO.2, or its complementary sequence;

[0013] 5) A sequence containing nucleotides 66-490 of the sequence shown in SEQ ID NO.3, or its complementary sequence;

[0014] 6) Contains the sequence shown in SEQ ID NO.3, or its complementary sequence;

[0015] 7) A sequence containing nucleotides 58-396 of the sequence shown in SEQ ID NO.4, or its complementary sequence;

[0016] 8) Contains the sequence shown in SEQ ID NO.4, or its complementary sequence;

[0017] 9) A sequence containing nucleotides 141-880 of the sequence shown in SEQ ID NO.5, or its complementary sequence;

[0018] 10) Contains the sequence shown in SEQ ID NO.5, or its complementary sequence;

[0019] 11) A sequence containing nucleotides 204-1141 of the sequence shown in SEQ ID NO.6, or its complementary sequence;

[0020] 12) Contains the sequence shown in SEQ ID NO.6, or its complementary sequence;

[0021] 13) A sequence containing nucleotides 52-412 of the sequence shown in SEQ ID NO.7, or its complementary sequence;

[0022] 14) Contains the sequence shown in SEQ ID NO.7, or its complementary sequence;

[0023] 15) A sequence containing nucleotides 117-1059 of the sequence shown in SEQ ID NO.8, or its complementary sequence;

[0024] 16) Contains the sequence shown in SEQ ID NO.8, or its complementary sequence;

[0025] Combinations of any fragments from 17)1)-16).

[0026] In a second aspect, a specific primer is provided for amplifying or detecting combinations of recombinant nucleotide fragments described in the first aspect.

[0027] Furthermore, when the amplification target is a sequence containing positions 50-1054 of SEQ ID NO.1 or a sequence containing the upstream homologous recombination fragment Rec3-1 of Bph14, the primers include primer pairs as shown in SEQ ID NO.9 and 10.

[0028] Furthermore, when the amplification target is a sequence containing positions 340-903 of SEQ ID NO.2 or the sequence shown in SEQ ID NO.2 (Rec4-1, upstream homologous recombination fragment of Bph15), the primers include primer pairs as shown in SEQ ID NO.11, 12 and / or SEQ ID NO.13, 14.

[0029] Furthermore, when the amplification target is a sequence containing positions 66-490 of SEQ ID NO.3 or a sequence containing the downstream homologous recombination fragment Rec4-2 of Bph15, the primers include primer pairs as shown in SEQ ID NO.15 and 16.

[0030] Furthermore, when the amplification target is a sequence containing positions 58-396 of SEQ ID NO.4 or a sequence containing the upstream homologous recombination fragment Rec11-1 of Pi1, the primers include primer pairs as shown in SEQ ID NO.17 and 18.

[0031] Furthermore, when the amplification target is a sequence containing positions 141-880 of SEQ ID NO.5 or the sequence shown in SEQ ID NO.5 (Rec6-1 upstream homologous recombination fragment of Pi2), the primers include primer pairs as shown in SEQ ID NO.19, 20 and / or SEQ ID NO.21, 22.

[0032] Furthermore, when the amplification target is the sequence containing positions 204-1141 of SEQ ID NO. 6 or the sequence shown in SEQ ID NO. 6 (Rec6-2 downstream homologous recombination fragment of Pi2), the primers include primer pairs as shown in SEQ ID NO. 23, 24 and / or SEQ ID NO. 25, 26.

[0033] Furthermore, when the amplification target is a sequence containing positions 52-412 of SEQ ID NO.7 or a sequence containing the upstream homologous recombination fragment Rec5-1 of xa5, the primers include primer pairs as shown in SEQ ID NO.27, 28 and / or SEQ ID NO.29, 30.

[0034] Furthermore, when the amplification target is the sequence containing positions 117-1059 of SEQ ID NO.8 or the sequence shown in SEQ ID NO.8 (rec5-2 downstream homologous recombination fragment of xa5), the primers include primer pairs as shown in SEQ ID NO.31, 32 and / or 33, 34.

[0035] Thirdly, a kit is provided for amplifying or detecting combinations of recombinant nucleotide fragments described in the first aspect, comprising the specific primers described in the second aspect.

[0036] Fourthly, a method for detecting the recombinant nucleotide fragment combination described in the first aspect is provided, comprising the following steps: designing specific primers based on the recombinant nucleotide fragment combination described in the first aspect, performing a PCR reaction using the genome of the sample to be tested as a template, and analyzing the PCR amplification products.

[0037] Furthermore, the specific primer is the specific primer described in the second aspect.

[0038] Fifthly, the invention provides an application of the recombinant nucleotide fragment combination described in the first aspect as a molecular marker in rice breeding containing multiple rice disease and pest resistance genes.

[0039] Furthermore, molecular markers closely linked to the target resistance gene include one or more of 76-2, InD4, M-Pi1, Pi2-4, and RM603.

[0040] Furthermore, the resistance genes include one or more of the following genes: Bph14, Bph15, Pi1, Pi2, and xa5.

[0041] Sixthly, the application of the recombinant nucleotide fragment combination described in the first aspect as a molecular recognition marker in identifying rice materials with rice disease and pest resistance genes is provided.

[0042] Furthermore, the application includes the following steps: identifying whether the rice material contains the recombinant nucleotide fragment combination as described in claim 1.

[0043] In one possible implementation of the method for detecting the recombinant nucleotide fragment described above, the primers are as previously described. That is, using the genome of the sample to be tested as a template, PCR amplification is performed using the aforementioned primers, and then the obtained amplified fragment is sequenced. If the sequencing results show that it includes a sequence consistent with or complementary to the nucleotide sequence of the target gene, then the sample to be tested contains the recombinant nucleotide fragment. By confirming the presence of the recombinant nucleotide fragment in the sample to be tested, it can be determined that the sample to be tested contains a pest resistance gene closely linked to the recombinant nucleotide fragment.

[0044] In one possible implementation of the above-described method for detecting the recombinant nucleotide fragments, Sanger sequencing is used to analyze the PCR amplification products.

[0045] This invention also provides rice plants or seeds containing the recombinant nucleotide fragment.

[0046] This invention also provides plant parts containing the recombinant nucleotide fragment. The plant part refers to any part of a plant derived from material from a rice plant containing the recombinant nucleotide fragment, including glumes, anthers, ovaries, endosperm, rachis, leaves, leaf sheaths, roots, and stems. The plant part can be alive, non-living, renewable, and / or non-renewable.

[0047] This invention also provides commercial products containing the recombinant nucleotide fragments. The commercial products refer to any composition or product made from materials derived from rice plants, seeds, or plant parts containing the recombinant nucleotide fragments, including: rice, rice starch, rice bran oil, germ oil, rice wine, and related food products made from rice. Rice plants, seeds, or plant parts containing the recombinant nucleotide fragments can be used to manufacture any commercial product normally obtained from rice plants, seeds, or plant parts. If any detectable amount of a nucleotide fragment containing the nucleotide sequence shown in SEQ ID NO. 1–8 or the sequence shown in the recombinant nucleotide fragment of SEQ ID NO. 1–8, or its complementary sequence, is present in the commercial product derived from the rice plants, seeds, or plant parts containing the recombinant nucleotide fragments, then the commercial product is within the scope of this invention.

[0048] This invention also provides a method for identifying rice plants, seeds, plant parts, or products containing the recombinant nucleotide fragment, comprising the following steps: detecting whether the genome of the rice plant, plant part, or product to be tested contains the recombinant nucleotide fragment.

[0049] In one possible implementation of the above method for identifying rice plants, seeds, plant parts, or products containing the recombinant nucleotide fragment, the aforementioned primers are used to detect whether the genome of the rice plant, seed, plant part, or product to be tested contains the recombinant nucleotide fragment.

[0050] In one possible embodiment of the above-described method for identifying rice plants, seeds, plant parts, or products containing the recombinant nucleotide fragment, the aforementioned method for detecting the recombinant nucleotide fragment is used to detect whether the genome of the rice plant, seed, plant part, or product to be tested contains the recombinant nucleotide fragment.

[0051] In one possible implementation of the above method for identifying rice plants, seeds, plant parts, or products containing the recombinant nucleotide fragment, the aforementioned kit is used to detect whether the genome of the rice plant, seed, plant part, or product to be tested contains the recombinant nucleotide fragment.

[0052] This invention also provides a method for breeding rice with broad-spectrum disease and pest resistance (containing multiple rice disease and pest resistance genes), comprising the following steps:

[0053] Using the "Huang Huazhan" rice material as the recurrent parent, hybridization was carried out with rice materials containing one or more of the resistance genes Pi1, Pi2, xa5, Bph14, and Bph15 as donor parents. The resulting hybrids were backcrossed with the recurrent parents, and the resulting backcrosses were then self-crossed. Rice plants containing different recombinant nucleotide fragments were then subjected to compound hybridization, followed by self-crossing. The hybrids, backcrosses, and self-crossed plants were selected for foreground and background using molecular markers and rice whole-genome breeding chips, respectively.

[0054] In one possible implementation of the above breeding method, the donor parent is a rice material containing one or more of the resistance genes Pi1, Pi2, xa5, Bph14 and Bph15; optionally, the donor parent is “Hua3234”, “IRBB5” and “HB13001-14-5”.

[0055] Rice plants containing the recombinant nucleotide fragments were obtained through the above-described breeding methods.

[0056] In one possible implementation of the above breeding method, the molecular markers include one or more of M-Pi1, Pi2-4, RM603, 76-2, InD4, RM224, RM144, RM527, AP22, RM153, RM611, RM514, RM16214, RM1305, and 15-6; the rice whole genome breeding chip includes, but is not limited to, Rice6K and GBTS40K.

[0057] In one possible implementation of the above-mentioned breeding method, the following steps are included:

[0058] (1) Using “Huang Huazhan” as the recurrent parent and rice materials containing both Bph14 and Bph15 genes as donor parents, hybridization and backcrossing were carried out. In the BC1F1-BC5F1 generation, all individual plants were tested using positive selection markers 76-2 and InD4. After obtaining individual plants carrying two target genes, homologous recombination screening was performed for Bph14 using upstream and downstream negative selection markers RM514 and RM16214. For Bph15, homologous recombination screening was performed for Bph15 using upstream and downstream negative selection markers RM1305 and 15-6. From the BC3F1 generation onwards, after foreground and recombination selection, background selection was performed on the selected individual plants using the rice whole genome breeding chip Rice6K. The individual plant with the highest background recovery rate was selected for backcrossing. In the BC5F1 generation, individual plants carrying both Bph14 and Bph15 genes and homologous recombination in upstream and downstream were obtained. Optionally, the donor parent was “HB13001-14-5”.

[0059] (2) Using “Huang Huazhan” as the recurrent parent and rice materials containing both Pi1 and Pi2 genes as donor parents, hybridization and backcrossing were carried out. In the BC1F1-BC3F1 generations, all individual plants were tested using positive selection markers M-Pi1 and Pi2-4. After obtaining individual plants carrying Pi1 or Pi2 genes, homologous recombination screening was performed on both sides using upstream and downstream negative selection markers RM224 and RM144 for Pi1, and homologous recombination screening was performed on both sides using upstream and downstream negative selection markers RM527 and AP22 for Pi2. From the BC2F1 generation onwards, after foreground and recombination selection, background selection was performed on the selected individual plants using the rice whole genome breeding chip Rice6K. The individual plant with the highest background recovery rate was selected for backcrossing. In the BC3F1 generation, individual plants carrying only Pi1 and those carrying only Pi2 with homologous recombination in both upstream and downstream were obtained. Optionally, the donor parent was “Hua 3234”.

[0060] (3) Using “Huang Huazhan” as the recurrent parent and rice materials containing the xa5 gene as the donor parent, hybridization and backcrossing were carried out. In the BC1F1-BC3F1 generations, all individual plants were tested using the positive selection marker RM603. After obtaining individual plants carrying the xa5 gene, homologous recombination screening was performed on both sides using the upstream and downstream negative selection markers RM153 and RM611 for xa5. From the BC2F1 generation onwards, after foreground and recombination selection, background selection was performed on the selected individual plants using the rice whole genome breeding chip Rice6K. The individual plant with the highest background recovery rate was selected for backcrossing. In the BC3F1 generation, individual plants carrying xa5 and homologous recombination in both upstream and downstream were obtained. Optionally, the donor parent was “IRBB5”.

[0061] (4) After obtaining recombinant single plants, single plants carrying both Bph14 and Bph15 genes are crossed with single plants carrying Pi1 gene, and single plants carrying Pi2 gene are crossed with single plants carrying xa5 gene. The Bph14, Bph15 and Pi1 genes and the Pi2 and xa5 genes are aggregated respectively. In the MF1 generation of the composite hybrid, all single plants are tested using positive selection markers. True hybrid single plants are selected for self-pollination and seed collection to obtain MF2 generation plants carrying Bph14, Bph15 and Pi1 genes and Pi2 and xa5 genes respectively.

[0062] (5) After the MF2 generation carrying Bph14, Bph15 and Pi1 genes and Pi2 and xa5 genes are planted and seedlings are grown, the target genes are detected again using positive selection markers. The single plants with homozygous Bph14, Bph15 and Pi1 genotypes are selected and crossbred with single plants with homozygous Pi2 and xa5 genotypes to produce the MF1 generation, realizing the aggregation of five target genes in the same rice. In the MF1 generation, all single plants are detected using positive selection markers, and true hybrid single plants are selected for self-pollination and seed harvesting to obtain the MF2 generation.

[0063] (6) After the MF2 generation obtained in step (5) is planted and seedlings are grown, the target gene is detected again using positive selection markers. Single plants with homozygous Bph14, Bph15, Pi1, Pi2 and xa5 genotypes are selected for self-pollination and seed collection. The foreground and background are confirmed using GSR40K chip. Finally, a line with homozygous target gene and the same genetic background as "Huang Huazhan" is obtained, which is tentatively named "ZM2104".

[0064] The embodiments of the present invention also provide the application of the broad-spectrum disease and pest resistant rice obtained by the above-mentioned breeding method as a resistant germplasm resource in the breeding of other rice varieties.

[0065] Beneficial effects

[0066] This invention selects and provides eight recombinant nucleic acid fragments by implementing positive molecular marker selection and whole-genome background selection of target genes. The recombinant nucleic acid fragments provided by this invention are closely linked to known pest and disease resistance genes and can be used as pest and disease resistance resources or molecular markers for the breeding of other varieties.

[0067] The eight recombinant fragments provided by this invention are found only in the obtained recombinant single plant ZM2104, exhibiting extremely high specificity. They cannot be easily removed or masked and are easily detected and identified. Therefore, these eight recombinant fragments can be used as molecular recognition markers to identify whether the rice material to be tested is a rice material (ZM2104) containing the recombinant nucleotide fragments. By detecting whether the rice material to be tested contains the recombinant DNA sequence, it can be determined whether the rice material to be tested is the selected ZM2104, or whether it was bred using rice material (ZM2104) containing the recombinant DNA sequence as a parent. Furthermore, it can be used to track the use of this material (ZM2104) in breeding.

[0068] This invention enables targeted improvement of specific traits in rice varieties. Without altering the original superior agronomic characteristics of the variety, it significantly enhances specific traits, significantly shortens the breeding cycle, and improves breeding efficiency. Specifically, through multiple generations of breeding and gene aggregation, this invention simultaneously introduces fragments containing two brown planthopper resistance genes, two rice blast resistance genes, and one gene that resists both bacterial leaf blight and bacterial leaf streak into the recipient parent "Huang Huazhan." This significantly improves the disease and pest resistance of the "Huang Huazhan" variety, reducing severe yield losses caused by rice diseases and pests during cultivation.

[0069] The recombinant rice material ZM2104 provided by this invention retains the original excellent agronomic traits of the variety "Huang Huazhan" and has significantly improved disease and pest resistance. It can be directly promoted and applied in production to replace "Huang Huazhan", or it can replace "Huang Huazhan" as the male parent of hybrid rice for the production and promotion of hybrid rice seeds. Attached Figure Description

[0070] One or more embodiments are illustrated by way of example with reference to the accompanying drawings, and these illustrative examples are not intended to limit the embodiments. The term "illustrative" as used herein means "serving as an example, embodiment, or illustration." Any embodiment illustrated herein as "illustrative" is not necessarily to be construed as superior to or better than other embodiments.

[0071] Figure 1This is the detection result of the GSR40K whole genome breeding chip of ZM2104 rice in Example 1 of this invention; wherein, the boxes indicated by the horizontal axis represent the 12 chromosomes of rice at one time, the numbers on the vertical axis are the physical locations on the rice genome [in megabases (Mb)], the blank areas represent the genotype of the recipient parent 'Huang Huazhan', the red lines represent the genotypes of the donor parents 'HB13001-14-5' or 'Hua3234' or 'IRBB5', and the black dots represent the location of the target gene. In the diagram, the red line on chromosome 3 indicates the location of the introduced recombinant nucleotide fragment Rec3-1 at the top of the segment; the red line on chromosome 4 indicates the location of the introduced recombinant nucleotide fragment Rec4-1 at the top of the segment; the red line on chromosome 4 indicates the location of the introduced recombinant nucleotide fragment Rec4-2 at the bottom of the segment; the red line on chromosome 5 indicates the location of the introduced recombinant nucleotide fragment Rec5-1 at the top of the segment; the red line on chromosome 5 indicates the location of the introduced recombinant nucleotide fragment Rec5-2 at the bottom of the segment; the red line on chromosome 6 indicates the location of the introduced recombinant nucleotide fragment Rec6-1 at the top of the segment; the red line on chromosome 6 indicates the location of the introduced recombinant nucleotide fragment Rec6-2 at the bottom of the segment; and the red line on chromosome 11 indicates the location of the introduced recombinant nucleotide fragment Rec11-1 at the top of the segment.

[0072] Figure 2 The alignment results of Rec3-1 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent identical bases in the alignment results, ZM2104 in the figure is the obtained new strain, 'HB13001-14-5' is the donor, and 'Huang Huazhan' is the recipient.

[0073] Figure 3 The figure shows the alignment results of Rec4-1 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent the same bases in the alignment results, ZM2104 is the obtained new strain, 'HB13001-14-5' is the donor, and 'Huang Huazhan' is the recipient.

[0074] Figure 4 The figure shows the alignment results of the Rec4-2 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent the same bases in the alignment results, ZM2104 is the obtained new strain, 'HB13001-14-5' is the donor, and 'Huang Huazhan' is the recipient.

[0075] Figure 5The figure shows the alignment results of the Rec11-1 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent the same bases in the alignment results, ZM2104 is the obtained new strain, 'Hua3234' is the donor, and 'Huang Huazhan' is the recipient.

[0076] Figure 6 The figure shows the alignment results of Rec6-1 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent identical bases in the alignment results, ZM2104 is the obtained new strain, 'Hua3234' is the donor, and 'Huang Huazhan' is the recipient.

[0077] Figure 7 The figure shows the alignment results of Rec6-2 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent identical bases in the alignment results, ZM2104 is the obtained new strain, 'Hua3234' is the donor, and 'Huang Huazhan' is the recipient.

[0078] Figure 8 The figure shows the alignment results of Rec5-1 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent identical bases in the alignment results, ZM2104 is the obtained new strain, 'IRBB5' is the donor, and 'Huang Huazhan' is the recipient.

[0079] Figure 9 The figure shows the alignment results of Rec5-2 homologous recombination fragment sequencing in Example 2 of this invention; the indiscriminate rectangular blocks shown in the figure represent identical bases in the alignment results, ZM2104 is the obtained new strain, 'IRBB5' is the donor, and 'Huang Huazhan' is the recipient. Detailed Implementation

[0080] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprising of," etc., will be understood to include the stated elements or components, and does not exclude other elements or other components.

[0081] Furthermore, to better illustrate the present invention, numerous specific details are provided in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In some embodiments, materials, elements, methods, and means well known to those skilled in the art are not described in detail in order to highlight the spirit of the invention.

[0082] The physical locations of the rice genome mentioned in this invention are all based on the MSU / TIGR annotation version 7.0 of the Nipponbare rice genome (http: / / rice.plantbiology.msu.edu).

[0083] Example 1: Breeding individual plants inoculated with fragments of genes Bph14 and Bph15 (resistance to brown planthopper), Pi1 and Pi2 (resistance to rice blast), and xa5 (resistance to bacterial leaf blight and bacterial leaf streak).

[0084] The rice materials used in this embodiment are “Huang Huazhan”, “HB13001-14-5”, “Hua 3234” and “IRBB5”.

[0085] Among them, "Huang Huazhan" was provided by the Rice Research Institute of Guangdong Academy of Agricultural Sciences;

[0086] "HB13001-14-5" is a rice material carrying the brown planthopper resistance genes Bph14 and Bph15, which was independently bred by Huazhong Agricultural University. It has been proven to have good resistance to brown planthoppers and can be obtained from the College of Plant Science and Technology of Huazhong Agricultural University.

[0087] “Hua3234” is a rice material carrying the rice blast resistance genes Pi1 and Pi2, which was independently bred by Huazhong Agricultural University. It has been proven to have good rice blast resistance and can be obtained from the College of Plant Science and Technology of Huazhong Agricultural University.

[0088] “IRBB5” was provided by the International Rice Research Institute and carries the xa5 gene, which is resistant to both bacterial leaf blight and bacterial leaf streak.

[0089] The genomic DNA fragments containing the Bph14 and Bph15 genes from "HB13001-14-5", the Pi1 and Pi2 genes from "Hua3234", and the xa5 gene from "IRBB5" were introduced into "Huang Huazhan". The specific process is as follows:

[0090] (1) Screening of foreground selection markers: By searching relevant SCI literature on the two brown planthopper resistance genes (Bph14 and Bph15 genes), two rice blast resistance genes (Pi1 and Pi2 genes), and one gene that resists both bacterial blight and bacterial leaf streak (xa5 gene) involved in this invention, molecular markers closely linked to the target genes were obtained. From these, molecular markers M-Pi1, Pi2-4, RM603, 76-2, InD4, RM224, RM144, RM527, AP22, RM153, RM611, RM514, RM16195, RM1305, and 15-6 with good polymorphism among the recipient "Huang Huazhan" and the three donor parents were screened. Based on the public database Gramene and other publicly available literature, the following molecular markers were designed and identified:

[0091] The upstream negative marker for Bph14 is determined to be RM514, and the downstream negative marker is determined to be RM16195;

[0092] The upstream negative marker for Bph15 is determined to be RM1305, and the downstream negative marker is determined to be 15-6;

[0093] The upstream negative marker of Pi1 is determined to be RM224, and the downstream negative marker is determined to be RM144;

[0094] The upstream negative marker for Pi2 is determined to be RM527, and the downstream negative marker is determined to be AP22;

[0095] The upstream negative marker for xa5 is determined to be RM153, and the downstream negative marker is determined to be RM611.

[0096] The specific primer information for the above molecular markers is shown in Table 1.

[0097] Table 1 Positive and Negative Selection Marker Information

[0098]

[0099]

[0100] (2) Screening to obtain rice plants carrying both homozygous Bph14 and Bph15 genes: Using “Huang Huazhan” as the recurrent parent and “HB13001-14-5” as the donor parent, hybridization and backcrossing were performed to obtain BC1F1 seeds. After seedlings emerged, all BC1F1 plants were tested using positive selection markers 76-2 and InD4. After obtaining plants carrying both target genes, homologous recombination was detected using negative selection markers upstream and downstream of Bph14 and Bph15 genes. On the other hand, the genetic background of these plants was analyzed using background selection markers obtained in the previous screening. Five plants with the highest degree of background recovery were selected, and these five plants were used as male parents for mixed pollination and backcrossing to obtain BC2F1 generation seeds.

[0101] After the BC2F1 generation seeds matured, all individual plants in the population were tested again using 76-2 and InD4. Individual plants carrying both target genes were obtained, and homologous recombination was detected using negative selection markers upstream and downstream of the Bph14 and Bph15 genes. According to the results, two individual plants underwent recombination on the side of the negative selection marker RM514 upstream of the Bph14 gene. Background detection was then performed on these two individual plants using the rice whole-genome breeding chip Rice6K. Based on the results, the individual plant with the highest background recovery rate was selected as the male parent and backcrossed with the recipient parent "Huang Huazhan" to obtain the BC3F1 generation seeds.

[0102] After the BC3F1 generation seeds were planted and matured, all BC3F1 plants were tested using positive and negative selection markers for the Bph14 and Bph15 genes. Two plants carrying both the Bph14 and Bph15 genes and exhibiting homologous recombination at RM514 were selected. Background analysis was performed on these two plants using the Rice6K chip. Based on the test results, the plant with the highest background recovery rate was selected as the male parent and backcrossed with the recipient parent "Huang Huazhan" to obtain BC4F1 generation seeds.

[0103] After the BC4F1 generation seeds were planted and matured, all individual plants of the BC4F1 generation were tested using positive selection markers 76-2 and InD4, and 13 individual plants carrying both target genes were obtained. At the heading stage, one individual plant with the most similar phenotype to "Huang Huazhan" was selected as the male parent and backcrossed with "Huang Huazhan" to harvest the BC5F1 generation seeds.

[0104] After the BC5F1 generation seeds were planted and seedlings emerged, all individual plants in the population were tested using positive selection markers 76-2 and InD4. Individual plants carrying both target genes were identified, and homologous recombination was detected using negative selection markers upstream and downstream of the Bph14 and Bph15 genes. One individual plant carrying both the Bph14 and Bph15 genes and exhibiting recombination on the side of the negative selection marker RM1305 upstream of Bph15 was selected. Background analysis of this individual plant was performed using the Rice6K chip, and BC5F2 generation seeds were harvested through self-pollination.

[0105] After the BC5F2 generation seeds matured, all individual plants of the BC5F2 generation were tested using positive selection markers 76-2 and InD4 to obtain several plants carrying both heterozygous or homozygous target genes. These plants were then tested using the downstream negative selection marker 15-6 of Bph15, and three plants showing recombination on one side of marker 15-6 were selected. Background detection was then performed on these three plants using the rice whole-genome breeding chip Rice6K. From these three plants, one plant carrying both heterozygous Bph14 and Bph15 genes with the highest background reversion rate was selected for self-pollination and harvesting of self-pollinated seeds.

[0106] The BC5F3 generation was further tested using positive selection markers 76-2 and InD4. Nine plants carrying both homozygous Bph14 and Bph15 genes were selected and harvested from the self-crossed BC5F4 generation. From these plants, the one most phenotypically similar to "Huang Huazhan" was selected for further research.

[0107] (3) Screening to obtain rice plants carrying homozygous Pi1 and Pi2 genes respectively: Using "Huang Huazhan" as the recurrent parent and "Hua 3234" as the donor parent, hybridization and backcrossing were performed to obtain BC1F1 seeds. After seedling emergence, the positive selection markers M-Pi1 and Pi2-4 of the Pi1 and Pi2 genes were used to detect all BC1F1 plants, and plants carrying either Pi1 or Pi2 genes were screened. Subsequently, the negative selection markers RM224 and RM144 upstream and downstream of Pi1, and the negative selection markers RM527 and AP22 upstream and downstream of Pi2 were used to detect homologous recombination in plants containing Pi1 and Pi2 respectively. After screening, one plant with recombination exchange of the negative selection marker RM224 upstream of Pi1 and two plants with recombination exchange of the negative selection marker RM527 upstream of Pi2 were finally obtained. These three plants were used as male parents and backcrossed with "Huang Huazhan" respectively to obtain BC2F1 generation seeds.

[0108] In the BC2F1 generation population, positive selection markers M-Pi1 and Pi2-4 for the Pi1 and Pi2 genes, respectively, were used to screen and obtain target plants. Then, negative selection markers RM144 downstream of the Pi1 gene and AP22 downstream of the Pi2 gene were used to screen the target plants in both populations. Ultimately, two plants with recombination exchange downstream of the Pi1 gene and one plant with recombination exchange downstream of the Pi2 gene were selected. The Rice6K whole-genome breeding chip was used to perform background detection on these three plants. One plant carrying the Pi1 gene with the highest background recovery rate was selected and backcrossed with "Huang Huazhan" to obtain BC3F1 generation seeds. Simultaneously, one plant carrying the Pi2 gene with recombination on one side of marker AP22 was backcrossed with "Huang Huazhan" to obtain BC3F1 generation seeds.

[0109] Two BC3F1 populations were planted separately. Positive selection markers M-Pi1 and Pi2-4 for the Pi1 and Pi2 genes were used for detection, resulting in the selection of 84 individuals carrying the Pi1 gene and 77 individuals carrying the Pi2 gene. Subsequently, the genetic background of these individuals was analyzed using background selection markers obtained in the previous screening. Three individuals carrying the Pi1 gene and four individuals carrying the Pi2 gene were selected for Rice6K microarray analysis. From these, one individual carrying the Pi1 gene with high background reversion and one individual carrying the Pi2 gene with high background reversion were harvested for self-pollination.

[0110] The BC3F2 generation population was further tested using the positive selection markers M-Pi1 and Pi2-4 for the Pi1 and Pi2 genes, as well as background selection markers. The BC3F2 generation single plant carrying the Pi1 gene and with the highest background recovery rate was continuously self-crossed for two generations, and a line carrying the homozygous Pi1 gene and with a genetic background similar to "Huang Huazhan" was obtained in the BC3F4 generation. Another BC3F2 generation single plant carrying the homozygous Pi2 gene and with a genetic background similar to "Huang Huazhan" was also obtained.

[0111] (4) Screening for rice plants carrying the heterozygous xa5 gene: Using "Huang Huazhan" as the recurrent parent and "IRBB5" as the donor parent, hybridization and backcrossing were performed to obtain BC1F1 seeds. After seedlings emerged, the positive selection marker RM603 of the xa5 gene was used to detect all BC1F1 plants and screen for plants carrying the xa5 gene. Then, the negative selection markers RM153 and RM611 upstream and downstream of xa5 were used to detect homologous recombination. After screening, two plants with recombination exchange of the negative selection marker RM153 upstream of xa5 were finally obtained. These plants were then self-pollinated to obtain BC1F2 generation seeds.

[0112] After the BC1F2 generation seeds were planted and seedlings emerged, all individual plants were tested using the positive selection marker RM603 for the xa5 gene and the negative selection marker RM611 downstream of xa5. Finally, one individual plant carrying the xa5 gene and with recombination exchange of the downstream RM611 was selected. Background analysis was performed using the rice chip Rice6K, and this individual plant was used as the male parent and backcrossed with "Huang Huazhan" to obtain the BC2F1 generation seeds.

[0113] The BC2F1 generation population was further tested using the positive selection marker RM603 for the xa5 gene. Then, the remaining background selection markers were used to test the heterozygous xa5 gene individuals. A total of 7 individuals carrying the heterozygous xa5 gene and with the highest genetic background recovery rate were selected. The above 7 individuals were used as male parents for mixed pollination and backcrossed with "Huang Huazhan" to obtain BC3F1 generation seeds.

[0114] After the BC3F1 generation seeds were planted and seedlings were grown, positive selection markers and background selection markers were used for further testing. A total of 11 single plants carrying the heterozygous xa5 gene and with the highest genetic background recovery rate were selected.

[0115] (5) Screening to obtain rice plants carrying Bph14, Bph15, Pi1, Pi2 and xa5 genes simultaneously: Using the BC5F4 generation line carrying homozygous Bph14 and Bph15 genes as the female parent and the BC3F4 generation line carrying homozygous Pi1 gene as the male parent, hybridization was carried out to produce MF1 generation seeds, achieving the aggregation of Bph14, Bph15 and Pi1 genes; at the same time, using one BC3F2 generation single plant carrying homozygous Pi2 gene as the female parent and 11 plants carrying heterozygous xa5 gene with genetic background recovery rate The highest-performing individual plant was used as the male parent to produce MF1 generation seeds, achieving the aggregation of Pi2 and xa5 genes. Two MF1 generation populations were tested using positive selection markers for Bph14, Bph15, and Pi1 genes, as well as positive selection markers for Pi2 and xa5 genes. One individual plant carrying heterozygous Bph14, Bph15, and Pi1 genes and one individual plant carrying heterozygous Pi2 and xa5 genes were selected for self-pollination to obtain MF2 generation. After seedlings emerged, the target genes were tested again using positive selection markers.

[0116] Select one plant carrying homozygous Bph14, Bph15 and Pi1 genes as the female parent, and cross it with one plant carrying homozygous Pi2 and xa5 genes to obtain MF1 generation seeds, so as to achieve the aggregation of Bph14, Bph15, Pi1, Pi2 and xa5 genes in the same rice material.

[0117] After one self-pollination, the selected individual plants were used to obtain the MF2 generation. After seedlings matured, the target genes were detected again using positive selection markers 76-2, InD4, M-Pi1, Pi2-4 and RM603. Individual plants with homozygous target genotypes were selected, and the foreground and background were confirmed using the GSR40K chip.

[0118] Finally, a line homozygous for the target gene and with the same background as "Huang Huazhan" was obtained and named ZM2104. Its GSR40K chip detection results are shown below. Figure 1 In the diagram, the black line on chromosome 3 indicates the location of the introduced recombinant nucleotide fragment Rec3-1 at the top of the segment (located upstream of and closely linked to the Bph14 gene in rice plants); the black line on chromosome 4 indicates the location of the introduced recombinant nucleotide fragment Rec4-1 at the top of the segment (located upstream of and closely linked to the Bph15 gene in rice plants), and the black line on chromosome 5 indicates the location of the introduced recombinant nucleotide fragment Rec5-1 at the top of the segment (located in the xa5 gene in rice plants). The uppermost part of the segment shown by the black line on chromosome 6 is the location of the introduced recombinant nucleotide fragment Rec5-2 (located downstream of the xa5 gene in the rice plant and closely linked to it); the lowermost part is the location of the introduced recombinant nucleotide fragment Rec6-1 (located upstream of the Pi2 gene in the rice plant and closely linked to it); the lowermost part is the location of the introduced recombinant nucleotide fragment Rec6-2 (located downstream of the Pi2 gene in the rice plant and closely linked to it); the uppermost part of the segment shown by the black line on chromosome 11 is the location of the introduced recombinant nucleotide fragment Rec11-1 (located upstream of the Pi1 gene in the rice plant and closely linked to it).

[0119] Example 2

[0120] Determination of homologous recombination fragments after introducing fragments of brown planthopper resistance genes Bph14 and Bph15, rice blast resistance genes Pi1 and Pi2, and the gene xa5 which is resistant to both bacterial leaf blight and bacterial leaf streak.

[0121] To determine the size of the target resistance gene fragments introduced, the homologous recombination regions flanking the five resistance gene fragments introduced into the "Huang Huazhan" background were located and sequenced.

[0122] First, based on the GSR40K chip detection results, the upstream homologous recombination region of Bph14 was located in a 2.2kb region between SNP markers vg0335444190 and vg0335446363 (chromosome 3, 35444190bp-35446363bp); the upstream homologous recombination region of Bph15 was located in a 6.3kb region between SNP markers vg0405864882 and vg0405867497. (5864882bp-5867497bp); the downstream homologous recombination region of Bph15 was located in a 1.4kb region (406967066bp-6968474bp) between SNP markers vg0406967066 and vg0406968474; the upstream homologous recombination region of Pi1 was located in a 1.3kb region (2770bp-5864882bp-5867497bp) between SNP markers vg1127703223 and vg1127704494. The upstream homologous recombination region of Pi2 was located in a 3.7 kb region (9920688bp-9924349bp) between SNP markers vg0609920688 and vg0609924349; the downstream homologous recombination region of Pi2 was located in a 3.2 kb region (10805837bp- 3223bp- 27704494bp) between SNP markers vg0610805837 and vg0610809026. The upstream homologous recombination region of xa5 was located in a 6.5 kb region (270890bp-277381bp) between SNP markers vg0500270890 and vg00500277381; the downstream homologous recombination region of xa5 was located in a 3.2 kb region (483820bp-487026bp) between SNP markers vg0500483820 and vg0500487026.

[0123] To further narrow down the homologous recombination regions upstream of Bph14 and upstream and downstream of Bph15, based on the microarray results, the corresponding DNA sequences were downloaded from the rice reference genome Nipponbare (MSU / TIGR 7.0), and primers were designed manually. Using the recipient parent "Huang Huazhan" and the donor parent "HB13001-14-5" as controls, the homologous recombination regions upstream of Bph14 and upstream and downstream of Bph15 in ZM2104 were sequenced and detected. The homologous recombination in the upstream region of Bph14 was ultimately determined to be between 35445355bp and 35446358bp on chromosome 3 (this position is referenced from the Nipponbare rice genome MSU / TIGR). At position 7.0, the sequences of the three rice materials aligned with the Nipponbare sequence all contained one identical InDel, leading to inconsistencies in the sequencing length of the homologous recombination fragment. Homologous recombination in the upstream region of Bph15 was determined to be between 5865418bp and 5866240bp on chromosome 4 (this position is based on position 7.0 of the Nipponbare rice genome MSU / TIGR; within this interval, the sequences of the three rice materials aligned with the Nipponbare sequence all contained multiple identical InDels, leading to inconsistencies in the sequencing length of the homologous recombination fragment). Homologous recombination in the downstream region of Bph15 was determined to be between 6968050bp and 6968474bp on chromosome 4.

[0124] The sequencing length of the upstream homologous recombination fragment Rec3-1 from Bph14 in ZM2104 is 1098 bp (its sequence is shown in SEQ ID No. 1). The alignment results with the recipient and donor are as follows: Figure 2 Among them, 1-50bp is the genome segment of the recipient 'Huang Huazhan', which has 1 SNP compared with the donor 'HB13001-14-5'; 51-1053bp is the 1003bp segment of homologous recombination; 1054-1098bp is the genome segment of the donor 'HB13001-14-5', which has 3 InDels compared with 'Huang Huazhan'.

[0125] The sequence of Rec3-1, the upstream homologous recombination fragment of Bph14, is shown in SEQ ID No. 1:

[0126]

[0127] The sequencing length of the upstream homologous recombination fragment Rec4-1 from Bph15 in ZM2104 is 1151 bp (its sequence is shown in SEQ ID No. 2). The alignment results with the recipient and donor are as follows: Figure 3 Among them, 1-340bp is the genome segment of the recipient 'Huang Huazhan', which has 1 SNP compared with the donor 'HB13001-14-5'; the 562bp segment of 341-902bp is the homologous recombination segment; and 903-1151bp is the genome segment of the donor 'HB13001-14-5', which has 2 SNPs compared with 'Huang Huazhan'.

[0128] The sequence of the upstream homologous recombination fragment Rec4-1 of Bph15 is shown in SEQ ID No. 2:

[0129]

[0130] The sequencing length of the downstream homologous recombination fragment Rec4-2 of Bph15 in ZM2104 is 845 bp (its sequence is shown in SEQ ID No. 3). The alignment results with the recipient and donor are as follows: Figure 4 Among them, 1-66bp is the genomic segment of the donor 'HB13001-14-5', which has 1 SNP compared with the recipient 'Huang Huazhan'; 67-489bp is a 423bp segment of homologous recombination; 490-845bp is the genomic segment of the recipient 'Huang Huazhan', which has 5 SNPs compared with the donor 'HB13001-14-5'.

[0131] The sequence of Rec4-2, the downstream homologous recombination fragment of Bph15, is shown in SEQ ID No. 3:

[0132] CAGTTTTGTGGCTCAAAATCTGGCCTGCAGCCTTTGTATTTCCTTTTATCATCGATGAACTTATAGTTCTGTGGGCATAAACAACTTGTCGTGTTCTTGGTGCCATCAATGGTGCAGTAACTGTTAAAGCCGCATGCTCCACTACCCACCATTGTTTGTATTGACTGGCAGATGTTTTCTGGAAGTACATCGACTGCAGTCCATTGCTCTGGCCATAAGGGCCTGGCATGTATGTTTTTTGGGTAAACATATTGCCGGAACACACCATCTGTGTCAAGGGTAGCACGATGGAAGAAATCACCCATAGAATCCACCCCTGCAGAAGTGATATTTACCTGTGAACCATTAATTATAGTGAAGTATATCCTTCCAGTTTCATTGAACACTAGCTGTGAGCCATTGTCCACTGTGTTACTAGCCCAATATGGATCGTATAAGTATCCAGAAGGTACAGCATCTGGATACATAACAAGATTACCATCTCGTTGAACTTTTAGTTGAAATCGGCCATTGGAATAGTCTGTGGCGAGGAGACGGCTGTGGAGTGCCGTCCCCAGTGAAAGCACTTGTGTGGGTAGGATGGTATCAGAGGGGTCACCAAAGGACTCCCACTTTGTTGCACCATCGGTGCCTAAAAGCCTGAAATTCCCGGTGTCGAGCATTCTAGCATAGCCCACATCAGTGACTTGTGGATTCCATACCTCATTGCCAGATGGATCGCGAAGAGAGAGTGCTCCATCAGCGAGCTTGAGGACAGAGCCAGATTGGACTTGTACCGGTATTGTATCATCTTTCCCATTGGAGCTAGTCCTTGCGTACCAGACGACGGTCTTGTCAGCGATCTT。

[0133] To further narrow down the homologous recombination regions upstream of Pi1 and upstream and downstream of Pi2, based on the microarray results, the corresponding DNA sequences were downloaded from the rice reference genome Nipponbare (MSU / TIG 7.0), and primers were designed manually. Using the recipient parent "Huang Huazhan" and the donor parent "Hua 3234" as controls, the homologous recombination regions upstream of Pi1 and upstream and downstream of Pi2 in ZM2104 were sequenced and detected. The homologous recombination in the upstream region of Pi1 was ultimately determined to be between 27704156bp and 27704494bp on chromosome 11; the homologous recombination in the upstream region of Pi2 was determined to be between 9922154bp and 9922894bp on chromosome 6 (this position is based on the rice Nipponbare genome MSU / TIG 7.0). At position 7.0, within this interval, the sequences of the three rice materials and the sequence of Nipponbare all have one identical InDel, resulting in inconsistent sequencing lengths of the homologous recombination fragment; the homologous recombination in the downstream region of Pi2 was determined to be between 10808089bp and 10809026bp on chromosome 6.

[0134] The sequencing length of the homologous recombination fragment Rec11-1 upstream of Pi1 in ZM2104 is 796 bp (its sequence is shown in SEQ ID No. 4). The alignment results with the recipient and donor are as follows: Figure 5 Among them, 1-58bp is the genome segment of the recipient 'Huang Huazhan', which has 1 SNP compared with the donor 'Hua3234'; the 337bp segment of 59-395bp is the homologous recombination segment; and the genome segment of 396-796bp is the genome segment of the donor 'Hua3234', which has 1 SNP compared with 'Huang Huazhan'.

[0135] The sequence of the upstream homologous recombination fragment Rec11-1 of Pi1 is shown in SEQ ID No. 4:

[0136] .

[0137] The sequencing length of the homologous recombination fragment Rec6-1 upstream of Pi2 in ZM2104 is 1048 bp (its sequence is shown in SEQ ID No. 5). The alignment results with the recipient and donor are as follows: Figure 6Among them, 1-141bp is the genome segment of the recipient 'Huang Huazhan', which has 1 SNP compared with the donor 'Hua3234'; 142-879bp is the 738bp segment of homologous recombination; 880-1048bp is the genome segment of the donor 'Hua3234', which has 1 SNP compared with 'Huang Huazhan'.

[0138] The sequence of the upstream homologous recombination fragment Rec6-1 of Pi2 is shown in SEQ ID No. 5:

[0139]

[0140] The sequencing length of the downstream homologous recombination fragment Rec6-2 in ZM2104 is 1286 bp (its sequence is shown in SEQ ID No. 6). The alignment results with the recipient and donor are as follows: Figure 7 Among them, 1-204bp is the genomic segment of the donor 'Hua3234', which has 1 SNP compared with the recipient 'HuangHuazhan'; 205-1140bp is a 936bp segment of homologous recombination; 1141-1286bp is the genomic segment of the recipient 'HuangHuazhan', which has 1 SNP compared with the donor 'Hua3234'.

[0141] The sequence of the downstream homologous recombination fragment Rec6-2 of Pi2 is shown in SEQ ID No. 6:

[0142]

[0143] To further narrow down the homologous recombination regions upstream and downstream of xa5, based on the microarray results, the corresponding DNA sequences were downloaded from the rice reference genome Nipponbare (MSU / TIG 7.0), and primers were designed artificially. Using the recipient parent "Huang Huazhan" and the donor parent "IRBB5" as controls, the homologous recombination regions upstream and downstream of xa5 in ZM2104 were sequenced and detected. Ultimately, the homologous recombination in the upstream region of xa5 was determined to be between 274301bp and 274661bp on chromosome 5, and the homologous recombination in the downstream region of xa5 was determined to be between 486077bp and 487019bp on chromosome 5.

[0144] The sequencing length of the upstream homologous recombination fragment Rec5-1 of xa5 in ZM2104 is 656 bp (its sequence is shown in SEQ ID No. 7). The alignment results with the recipient and donor are as follows: Figure 8 Among them, 1-52bp is the genome segment of the recipient 'Huang Huazhan', which has 1 SNP compared with the donor 'IRBB5'; the 359bp segment of 53-411bp is the homologous recombination segment; and 412-656bp is the genome segment of the donor 'IRBB5', which has 2 SNPs and 2 InDels compared with 'Huang Huazhan'.

[0145] The sequence of the upstream homologous recombination fragment Rec5-1 of xa5 is shown in SEQ ID No. 7:

[0146] .

[0147] The sequencing length of the downstream homologous recombination fragment Rec5-2 from ZM2104 is 1266 bp (its sequence is shown in SEQ ID No. 8). The alignment results with the recipient and donor are as follows: Figure 9 Among them, 1-117bp is the genomic segment of the donor 'IRBB5', which has 1 SNP compared with the recipient 'Huang Huazhan'; the 941bp segment of 118-1058bp is the homologous recombination segment; and 1059-1266bp is the genomic segment of the recipient 'Huang Huazhan', which has 9 SNPs and 1 InDel compared with the donor 'IRBB5'.

[0148] The sequence of the downstream homologous recombination fragment Rec5-2 of xa5 is shown in SEQ ID No. 8:

[0149]

[0150] Table 2 Primer information for amplification and sequencing of homologous recombination regions of recombinant DNA fragments.

[0151]

[0152] Note: In the table above, two sets of primers were designed for segmented sequencing of Pi2 upstream, Pi2 downstream, xa5 upstream, xa5 downstream, and Bph15 upstream.

[0153] Example 3

[0154] Resistance identification

[0155] (1) Brown planthopper resistance identification

[0156] To assess the resistance effect of introducing a brown planthopper resistance genome fragment (target plant) into the rice variety "Huang Huazhan," resistance to brown planthoppers was evaluated through indoor cultivation and artificial inoculation of rice varieties "ZM2104," "Huang Huazhan," "TN1," and "B5." "TN1" did not carry any resistance gene, while B5 carried the brown planthopper resistance gene. Both were provided by Professor He Guangcun of Wuhan University (commonly used rice materials, but could also be obtained through other means). The specific methods are as follows:

[0157] Before conducting artificial inoculation identification, artificially captured brown planthoppers were first reared using TN1 material that does not carry any resistance genes. Specifically, a certain number of wild brown planthoppers were captured from the field and reared on pre-planted TN1 seedlings. They were artificially reared and bred for multiple generations to increase the number of brown planthopper nymphs to meet the identification requirements.

[0158] Prepare 100 seeds each of “ZM2104”, “Huang Huazhan”, “TN1”, and “B5”, and soak the soil for sowing in water for 3 days. After soaking the seeds for 24 hours, germinate them at 30℃ for 48 hours. After germination, select 20 seeds with good germination and sow them evenly in seedling trays, randomly dividing each material into three portions. Cover with fine soil and label. Use TN1 and the recipient parent as susceptible controls. When the seedlings reach the 1-leaf-1-heart stage, apply a small amount of urea to promote healthy growth. When the seedlings reach the 2-leaf-1-heart stage, artificially inoculate them with well-reared 2nd-3rd instar brown planthopper nymphs, averaging 10-12 nymphs per seedling. When all TN1 plants have died, observe and record the resistance score of each rice seedling. Then calculate the mean resistance score of the three replicates for each line and determine the resistance level of the line based on the mean.

[0159] The criteria for determining the resistance score of individual seedlings were as follows: Level 0 (healthy plant, undamaged), Level 1 (one leaf slightly yellowed), Level 3 (1-2 leaves also yellowed or one leaf withered), Level 5 (1-2 leaves withered or one leaf died), Level 7 (3-4 leaves withered or 2-4 leaves died, but the plant is still alive), and Level 9 (plant died). The criteria for evaluating the resistance level of the strains were as follows: resistance score 0-0.9 (immune, I); 1.0-1.9 (highly resistant, HR); 2.0-3.9 (resistant, R); 4.0-5.5 (moderately resistant, MR); 5.5-7.9 (susceptible, S); 8.0-9.0 (highly susceptible, HS). The results are shown in Table 3.

[0160] According to the identification results shown in Table 3, all susceptible control TN1 died, showing high susceptibility to brown planthopper (HS), resistant control B5 showed high resistance to brown planthopper (HR), recipient parent "Huang Huazhan" showed high susceptibility to brown planthopper (HS), and recombinant material ZM2104 showed high resistance to brown planthopper (HR). This indicates that after introducing the Bph14 and Bph15 genes, the brown planthopper resistance of "Huang Huazhan" was greatly improved.

[0161] Table 3. Resistance identification of brown planthoppers at the seedling stage.

[0162] strain or name Repeat 1 Repeat 2 Repeat 3 Average resistance TN1 HS HS HS HS B5 HR HR R HR Huang Huazhan HS HS S HS ZM2104 HR HR R HR

[0163] (2) Rice blast resistance identification

[0164] To assess the blast resistance effect of introducing a rice blast resistance genome fragment (target plant) into "Huang Huazhan," blast resistance was evaluated in both indoor cultivation and artificial inoculation of "ZM2104," "Huang Huazhan," "Hua 3234," "Guanglu Ai," and "Sanhuangzhan 2." "Guanglu Ai" did not carry the blast resistance gene, while "Sanhuangzhan 2" did. These plants were collected by the Institute of Plant Protection, Guangdong Academy of Agricultural Sciences ("Guanglu Ai" and "Sanhuangzhan 2" are common rice varieties and could also be obtained through other means). The specific methods are as follows:

[0165] Each variety was potted and cultivated in a dry-land environment. When the rice seedlings reached 3.5–4 leaves, artificial spray inoculation was performed, with an inoculation concentration of approximately 50 spores per 100x microscope field. Thirty-seven strains were used for inoculation (these strains are common and can be obtained through conventional methods), belonging to groups ZA, ZB, ZC, and ZF, with races of groups ZB and ZC predominating. All strains were collected and identified by the Institute of Plant Protection, Guangdong Academy of Agricultural Sciences. Single-strain inoculation was used for each strain. After inoculation, the rice seedlings were cultured in a constant-temperature inoculation chamber at 24℃ for 48 hours, then transferred to a greenhouse and cultured at 25℃–28℃. A survey was conducted 7 days later when the susceptible control variety reached a disease level of 7 or higher.

[0166] The grading criteria for rice blast resistance are shown in Table 4. For each material, the disease severity was graded as follows: 0-3 was resistant (R), and 4-9 was susceptible (S). According to the results shown in Table 5, the susceptible control "Guanglu Ai" showed a total resistance frequency of 37.84% against the 37 tested strains, the resistant control "Sanhuangzhan 2" showed a total resistance frequency of 89.19%, and the recipient parent "Huanghuazhan" showed a total resistance frequency of 78.38%. In contrast, the recombinant material "ZM2104" and the donor parent "Hua 3234" exhibited a total resistance frequency of 100%, indicating that the introduction of the Pi1 and Pi2 genes significantly improved the rice blast resistance of "Huanghuazhan".

[0167] Table 4 Grading Standards for Artificial Identification of Seedling Leaf Blight Resistance

[0168]

[0169] Table 5. Resistance responses of rice varieties to 37 strains of rice blast.

[0170]

[0171]

[0172] (3) Bacterial blight resistance identification

[0173] To assess the resistance effect of introducing the xa5 gene fragment into "Huang Huazhan", artificial inoculation was performed on "ZM2104", "Huang Huazhan", and "IRBB5" to evaluate their resistance to bacterial blight. The specific methods are as follows:

[0174] The rice varieties to be tested were planted in the disease resistance identification nursery of Huazhong Agricultural University. Each variety was planted in 8 rows with 6 plants per row. One strain was inoculated per row, for a total of 8 *Xanthomonas oryzae* strains (PXO61, PXO99, PXO341, and PXO347 are Philippine physiological races; GD1358 is a Guangdong physiological race; ZHE173 is a Zhejiang physiological race; YN11 is a Yunnan physiological race; and FuJ is a Fujian physiological race. These strains are common and can be obtained through conventional methods). When the rice plants entered the booting stage, the strains were inoculated using the leaf-cutting method. Five days before inoculation, the strains stored at -70℃ were removed and activated on PDA slant medium at 28℃ for 2-3 days, followed by transplanting for further culture for 2-3 days. Before inoculation, colonies were washed off with sterile water, and the bacterial suspension concentration was adjusted to 9 × 10⁻⁶. 8 CFU / mL. For artificial inoculation, select sword-shaped leaves with flat surfaces, dip the blade of scissors into the bacterial suspension, hold the scissors flat, and cut off 2-3 cm of the leaf tip. Each strain should have more than 30 leaves cut. Measure the length of lesions after 21 days, investigating lesions on 20 leaves for each strain.

[0175] The resistance evaluation criteria for bacterial blight were as follows: Grade 0 (longitudinal lesion length <1cm, highly resistant, HR), Grade 1 (longitudinal lesion length 1.1cm-3cm, resistant, R), Grade 3 (longitudinal lesion length 3.1cm-5cm, moderately resistant, MR), Grade 5 (longitudinal lesion length 5.1cm-12cm, moderately susceptible, MS), Grade 7 (longitudinal lesion length 12.1cm-20cm, susceptible, S), and Grade 9 (longitudinal lesion length >20cm, highly susceptible, MS). The results are shown in Table 6.

[0176] According to the identification results shown in Table 6, the recipient parent "Huang Huazhan" showed moderate susceptibility (MS) to resistant (MR) to highly resistant (HR) to resistant (HR) to resistant (HR) to resistant (MR) to resistant (HR) to resistant (HR) to resistant (MR) to resistant (HR) to resistant (HR) to resistant (R ...

[0177] Table 6. Identification of resistance to bacterial blight

[0178]

[0179] (4) Resistance identification for bacterial spot disease

[0180] To determine the resistance effect of the xa5 gene fragment introduced into "Huang Huazhan" against bacterial leaf streak, artificial inoculation was performed on "ZM2104", "Huang Huazhan", "IR24", and "IRBB5" for resistance assessment. The specific methods are as follows:

[0181] Potted plants of the tested strains were grown at the potted plant farm of Huazhong Agricultural University, with two replicates. In each replicate, 10 individual plants from each strain were used for inoculation with four Xanthomonas oryzae strains (GX01, RH3, and RS105 were provided by Professor Yuan Meng of Huazhong Agricultural University, and Xoc-S was provided by Associate Researcher Zhao Yancun of the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences; these strains are common and can be obtained through conventional methods). "IR24" and the recipient parent "Huang Huazhan" were used as susceptible controls, and "IRBB5" was used as a resistant control. The strains were cultured using the same method as those for bacterial blight, employing the osmosis method for inoculation. The concentration of the bacterial suspension used for inoculation was 9 × 10⁻⁶. 8CFU / mL. Two fully expanded leaves with identical growth vigor were inoculated onto each plant. Two inoculation points were made on each leaf: one point on one side of the vein, 7-8 cm from the leaf tip, and another point on the other side of the vein, 5 cm from the first point. A total of 40 points were inoculated per sample. During inoculation, the bacterial suspension was drawn up with a syringe, and the syringe tip (without a needle) was held vertically against the leaf, gently pressing the suspension into the intercellular spaces of the leaf mesophyll. The integrity of the leaf must be maintained during inoculation, avoiding mechanical damage to the main vein. After inoculation, the rice plants were transferred to an artificial climate chamber with an average temperature of 28℃ and humidity of 90%. The leaves were sprayed with water in the morning, noon, and evening to increase leaf humidity. Urea was applied once a week. The length of lesions was assessed 14 days after inoculation. Lesions were observed on 20 leaves for each line, and the average length of lesions on the 20 leaves was used as an indicator of the line's resistance. The results are shown in Table 7.

[0182] According to the resistance identification results in Table 7, the resistance levels of the donor "IRBB5" to all four strains were significantly higher than those of the recipient "Huang Huazhan". The recombinant single strain "ZM2104" showed significantly improved resistance levels to strains "GX01", "RH3", and "Xoc-S" compared to "Huang Huazhan", while there was no significant difference in resistance level to "RS105". These results indicate that the introduction of the xa5 gene greatly improved the bacterial streak resistance of "Huang Huazhan".

[0183] Table 7. Identification of resistance to bacterial leaf spot disease.

[0184]

[0185] Note: Data in the table represents the mean length of lesions ± standard deviation, with length in cm. a, b, c - values ​​with the same letter indicate no significant difference at the 5% level using the least significant difference (LSD) analysis.

[0186] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A combination of recombinant nucleotide fragments, characterized in that, The recombinant nucleotide fragment combination is a combination of the following fragments: 2) A nucleotide sequence as shown in SEQ ID NO.1, or its complementary sequence; 4) A nucleotide sequence as shown in SEQ ID NO.2, or its complementary sequence; 6) A nucleotide sequence as shown in SEQ ID NO.3, or its complementary sequence; 8) A nucleotide sequence as shown in SEQ ID NO.4, or its complementary sequence; 10) A nucleotide sequence as shown in SEQ ID NO.5, or its complementary sequence; 12) A nucleotide sequence as shown in SEQ ID NO. 6, or its complementary sequence; 14) A nucleotide sequence as shown in SEQ ID NO.7, or its complementary sequence; 16) The nucleotide sequence shown in SEQ ID NO.8, or its complementary sequence.

2. Specific primers for amplifying or detecting the recombinant nucleotide fragment combination of claim 1.

3. The specific primer according to claim 2, characterized in that, When the amplification target is the sequence shown in SEQ ID NO.1, the specific primers include primer pairs as shown in SEQ ID NO.9 and 10; And / or, when the amplification target is the sequence shown in SEQ ID NO.2, the specific primers include primer pairs as shown in SEQ ID NO.11, 12 and / or SEQ ID NO.13, 14; And / or, when the amplification target is the sequence shown in SEQ ID NO.3, the specific primers include primer pairs as shown in SEQ ID NO.15 and 16; And / or, when the amplification target is the sequence shown in SEQ ID NO.4, the specific primers include primer pairs as shown in SEQ ID NO.17 and 18; And / or, when the amplification target is the sequence shown in SEQ ID NO.5, the specific primers include primer pairs as shown in SEQ ID NO.19, 20 and / or SEQ ID NO.21, 22; And / or, when the amplification target is the sequence shown in SEQ ID NO. 6, the specific primers include primer pairs as shown in SEQ ID NO. 23, 24 and / or SEQ ID NO. 25, 26; And / or, when the amplification target is the sequence shown in SEQ ID NO.7, the specific primers include primer pairs as shown in SEQ ID NO.27, 28 and / or SEQ ID NO.29, 30; And / or, when the amplification target is the sequence shown in SEQ ID NO. 8, the specific primers include primer pairs as shown in SEQ ID NO. 31, 32 and / or SEQ ID NO. 33, 34.

4. A kit for amplifying or detecting the recombinant nucleotide fragment combination of claim 1, comprising the specific primers of claim 2 or 3.

5. A method for detecting the recombinant nucleotide fragment combination of claim 1, comprising the following steps: designing specific primers according to the recombinant nucleotide fragment combination of claim 1, performing a PCR reaction using the genome of the sample to be tested as a template, and analyzing the PCR amplification products.

6. The method according to claim 5, characterized in that, The specific primer is the specific primer described in claim 2 or 3.

7. The application of the recombinant nucleotide fragment combination of claim 1 as a molecular marker in rice breeding containing multiple rice disease and pest resistance genes, wherein the resistance genes include Bph14 Gene, Bph15 Gene, Pi1 Gene, Pi2 Genes and xa5 Gene.

8. The application of the recombinant nucleotide fragment combination of claim 1 as a molecular recognition marker in identifying rice materials with resistance genes for rice diseases and pests, wherein the resistance genes include... Bph14 Gene, Bph15 Gene, Pi1 Gene, Pi2 Genes and xa5 Gene.

9. The application according to claim 8, characterized in that, The application includes the following steps: identifying whether rice materials contain the recombinant nucleotide fragment combination as described in claim 1.

Images