Application of CENPM gene and its encoded protein as a metastasis marker and therapeutic target for adrenocortical carcinoma

Abstract

This invention discloses the use of the CENPM gene and its encoded protein as a marker and therapeutic target for adrenocortical carcinoma metastasis, relating to the field of biomedicine. The invention provides CENPM, a key regulator of adrenocortical carcinoma metastasis, which has been shown to be highly correlated with tumor prognosis. This invention provides a new marker for the development of products for the diagnosis and prognosis of adrenocortical carcinoma metastasis. Research has shown that inhibiting the expression of the CENPM gene or its encoded protein can effectively reduce the proliferation, invasion, and migration of adrenocortical carcinoma cells, providing a new target for the development of products for the treatment of adrenocortical carcinoma or metastatic adrenocortical carcinoma.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and specifically to the mechanism, prognosis assessment and targeted drug therapy of adrenocortical carcinoma metastasis; in particular, to the application of the CENPM gene and its encoded protein as a marker and therapeutic target for adrenocortical carcinoma metastasis. Background Art

[0002] Adrenocortical carcinoma (ACC) is a rare adrenal cortical endocrine malignancy. Despite occurring in only 0.7-2.0 cases per million people annually, ACC remains an aggressive and lethal tumor due to late diagnosis, local invasion, and the development of distant metastases or recurrence. Distant metastases occur in 66% of ACC cases, with the lung, liver, and bone being the most commonly affected organs. The median overall survival for ACC is less than one year, with a 5-year survival rate ranging from 0-28%. Accumulating evidence suggests that tumor staging, currently the most powerful prognostic indicator, has limitations. Some patients with earlier stages will experience recurrence and metastasis after surgery, while some patients with later stages also achieve long-term survival, highlighting tumor heterogeneity and the need for more accurate prognostic markers. Currently, surgery, radiotherapy, chemotherapy, and mitotane are the mainstays of treatment for ACC, with no reliable targeted therapies available. Summary of the Invention

[0003] In view of this, the present invention aims to provide a method for using the CENPM gene and its encoded protein as a marker and therapeutic target for adrenocortical carcinoma metastasis. The CENPM gene, also known as centromere protein M (CENPM), has been identified as a key gene regulating adrenocortical carcinoma metastasis. The CENPM gene and protein are highly expressed in patients with adrenocortical carcinoma, and expression increases with tumor stage. These genes can be used as new markers for diagnosing adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0004] To achieve the above object, the technical solution of the present invention is as follows:

[0005] Use of the CENPM gene and / or its encoded protein as a target in the preparation of a drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0006] Among them, the sequence of the CENPM gene is shown in SEQ ID NO.1, specifically: 1gctctagggg ctggactcagggcggtttga aagatcggcg cgcaccgcag gagcaacggt61tggtcctgcg gctgtgatgt cggtgttgaggcccctggac aagctgcccg gcctgaacac121ggccaccatc ttgctggtgg gcacggaggatgctcttctgcagcagctgg cggactcgat

[0007] 181gctcaaagag gactgcgcct ccgagctgaa ggtccacttg gcaaagtccc tccctttgcc

[0008] 241ctccagtgtg aatcggcccc gaattgacct gatcgtgttt gtggttaatc ttcacagcaa

[0009] 301atacagtctc cagaacacag aggagtccct gcgccatgtg gatgccagct tcttcttggg

[0010] 361gaaggtgtgtttcctcgcca caggtgctgg gcgggagagc cactgcagcattcaccggca421caccgtggtg aagctggccc acacctatca aagccccctg ctctactgtgacctggaggt

[0011] 481ggaaggcttt agggccacca tggcgcagcg cctggtgcgc gtgctgcagatctgtgctgg541ccacgtgccc ggtgtctcag ctctgaacct gctgtccctg ctgagaagctctgagggccc

[0012] 601ctccctggag gacctgtgag ggtggctggc ccctgggctg ccccttctca tggcttcgtg

[0013] 661ctgactccat aaacattctc tgttgaggat gtccagtcag ggcttgacag gcccaggctc

[0014] 721agcccgccgt ggctgggaag gttccctgca gtgccagtgc tgcagcagggagagctgggc781agaagcagcg aggggggccca gctggcgaga ctgtagcccc ctcccactcccacactcact841cttgcagagc ctgtgtcttt aagcagctgg cgtgttacat ctccatttaaggtttccttt

[0015] 901gaacaaaagg tctgtggcta aaaaaagttt aaaaatca

[0016] The amino acid sequence of the encoded protein is shown in SEQ ID NO.2, specifically:

[0017] 1msvlrpldklpglntatill vgtedallqq ladsmlkedc aselkvhlak slplpssvnr

[0018] 61pridlivfvv nlhskyslqn teeslrhvda sfflgkvcfl atgagreshc sihrhtvvkl

[0019] 121ahtyqsplly cdlevegfra tmaqrlvrvl qicaghvpgv salnllsllr ssegpsledl

[0020] Furthermore, the application is to inhibit the expression of CENPM gene or inhibit the function of protein encoded by CENPM gene.

[0021] Furthermore, the expression of the CENPM gene or the function of the protein encoded by the CENPM gene is inhibited by RNA interference technology or gene editing technology; or the expression of the CENPM gene or the function of the protein encoded by the CENPM gene is inhibited by antisense nucleotide drugs or antibody drugs.

[0022] A second object of the present invention is to provide the use of the CENPM gene and / or its encoded protein as a marker in the preparation of a product for diagnosing adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0023] Furthermore, the product includes a reagent, a kit or a chip for detecting the activity of the CENPM gene or the protein encoded by the CENPM gene.

[0024] Furthermore, the expression level of the marker is positively correlated with adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0025] The present invention also aims to provide the use of the CENPM gene and / or its encoded protein as a marker in the preparation of a product for assessing the severity of adrenocortical carcinoma or a prognostic product; or in the preparation of a product for assessing the severity of metastatic adrenocortical carcinoma or a prognostic product.

[0026] Specifically, the expression of CENPM gene or mRNA in adrenocortical carcinoma is detected by using reverse transcription PCR, real-time quantitative PCR, digital PCR, in situ hybridization, Northern blot, and high-throughput sequencing platforms to evaluate the prognosis and treatment effect of the tumor.

[0027] Immunohistochemistry, western blot, and enzyme-linked immunosorbent assay were used to detect the expression of CENPM gene-encoded protein in the adrenal cortex and to evaluate the prognosis and treatment effect of the tumor.

[0028] The present invention also aims to provide use of an agent for inhibiting the expression of the CENPM gene and / or inhibiting the protein encoded by the CENPM gene in the preparation of a drug for treating adrenocortical carcinoma.

[0029] The present invention also provides a drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma, wherein the drug is:

[0030] 1) siRNA to knock down CENPM gene expression;

[0031] 2) DNA or RNA that blocks the expression or transcription of CENPM-encoded proteins;

[0032] 3) Inhibitors targeting CENPM-encoded proteins, including small molecule compounds, antibody drugs, proteins, nucleic acid molecules, polypeptides, lipids, carbohydrates or combinations thereof.

[0033] Furthermore, the sequence of the siRNA for knocking out CENPM gene expression includes at least one of the following:

[0034] siCENPM-1:

[0035] sense(5'-3')GGAAGGCUUUAGGCCACCTT,

[0036] antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT;

[0037] siCENPM-2:

[0038] sense(5'-3')GAUCGUGUUUGUGGUUAAUTT,

[0039] antisense(5'-3')AUUAACCACAACACGAUCTT;

[0040] Furthermore, in the above application, for metastatic adrenocortical carcinoma, the metastatic organs include the liver and / or lungs.

[0041] The beneficial effects of the present invention include at least:

[0042] (1) Currently, tumor staging is the most reliable indicator of prognosis for adrenocortical carcinoma. Although the survival rate of advanced adrenocortical carcinoma is very low, there are still some long-term survivors, which shows the heterogeneity of metastatic adrenocortical carcinoma and the need for accurate prognostic indicators. The present invention provides CENPM, a key regulator of adrenocortical carcinoma metastasis, which shows a high correlation with tumor prognosis and provides a new marker for the preparation of products for the diagnosis and prognosis of adrenocortical carcinoma metastasis.

[0043] (2) Currently, the main treatments for metastatic adrenocortical carcinoma are chemotherapy and radiotherapy, and there is a lack of specific targeted therapeutic drugs. The present invention provides CENPM, a key regulatory factor for adrenocortical carcinoma metastasis. Through research, it was found that inhibiting the expression of the CENPM gene or its encoded protein can effectively reduce the proliferation, invasion and migration of adrenocortical cancer cells, providing a new target for the preparation of products for the treatment of adrenocortical carcinoma or metastatic adrenocortical carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1A "Salmon Red" gene module associated with adrenocortical carcinoma metastasis was discovered by WGCNA. A) WGCNA analysis; B) Gene dendrogram obtained by hierarchical clustering, with genes clustered into 12 color-coded modules; non-clustered genes are shown in gray; C) Hierarchical clustering dendrogram and adjacency heatmap of module signature genes and sample phenotypes. The "Salmon Red" gene module has high adjacency with "cancer" and "metastasis"; D) Pearson correlation analysis between the gene module and clinical phenotypes. The "Salmon Red" gene module is positively correlated with "cancer" (cor = 0.70) and "metastasis" (cor = 0.41), and negatively correlated with "survival" (cor = -0.49) and "normal" (cor = -0.70); E) Scatter plot of "Salmon Red" module members and their correlation with GS of cancer traits. The "Salmon Red" gene module is highly correlated with cancer traits; F) Scatter plot of "Salmon Red" gene module members and their correlation with GS of metastasis traits. The “Salmon Red” module was highly correlated with metastatic traits.

[0045] Figure 2 CENPM is a node gene in the "Salmon Red" module. A) GO function enrichment analysis of the "Salmon Red" module; B) GSEA enrichment analysis of normal adrenal glands and adrenocortical carcinoma. Signals for "Mitotic Sister Chromatid Separation," "Sister Chromatid Segregation," "Nuclear Chromosome Segregation," and "Mitotic Spindle Organization" are significantly upregulated in adrenocortical carcinoma. C) Venn diagram of a gene (GO:0007059) that is also present in the "Salmon Red" module and upregulated in adrenocortical carcinoma and is involved in chromosome segregation. D) PPI network based on 78 genes. The largest PPI network consists of eight CENP family members. Genes with node degrees less than 1 are excluded. E) Node diagram of the eight CENP family members in the above PPI network. CENPM ranks second among all nodes. F) Spearman analysis of the correlation between the expression of the eight CENP family members and overall survival in adrenocortical carcinoma. CENPM shows the strongest negative correlation with overall survival in adrenocortical carcinoma.

[0046] Figure 3 CENPM mRNA expression is upregulated in adrenocortical carcinoma and is associated with poor prognosis in patients with adrenocortical carcinoma. A) CENPM mRNA expression in normal adrenal glands and adrenocortical carcinoma. B) CENPM mRNA expression in adrenocortical carcinoma at different pathological stages; C-F) CENPM mRNA expression in four adrenocortical carcinoma GEO datasets (GSE10927, GSE75415, GSE12368, and GSE143383); G-H) Kaplan-Meier survival analysis of OS and DFS in adrenocortical carcinoma. *P < 0.05, **P < 0.01, ***P < 0.001.

[0047] Figure 4 Immunohistochemical analysis of CENPM protein expression in adrenocortical carcinoma. **P<0.01, ***P<0.001.

[0048] Figure 5 Figure 2. Changes in proliferation, migration, and invasion of adrenocortical carcinoma cells after in vitro knockdown of CENPM. H295R and SW-13 cells were transfected with siCENPM-1 or siCENPM-2. A) Western blot analysis of CENPM protein expression; B) Refractive index quantitative PCR analysis of CENPM mRNA expression after transfection; C) Colony formation assay; D) Transwell invasion assay; E) Wound healing assay. *P < 0.05, **P < 0.01, ***P < 0.001.

[0049] Figure 6 The effect of CENPM knockout on tumor metastasis in adrenocortical carcinoma cells in vivo. A) Mouse model establishment; B) Bioluminescence imaging of mice bearing adrenocortical carcinoma xenografts; C) Gross image of an adrenocortical carcinoma liver metastasis; D) HE staining of an adrenocortical carcinoma liver metastasis; E) Ki67 staining of an adrenocortical carcinoma liver metastasis. **P < 0.01. DETAILED DESCRIPTION

[0050] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0051] In addition, the technical solutions between the various embodiments of the present invention can be combined with each other, but it must be based on the fact that ordinary technicians in this field can implement it. When the combination of technical solutions is mutually contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0052] The solution proposed by the present invention is described in detail below through specific embodiments:

[0053] Example 1 WGCNA analysis of weighted gene co-expression networks of adrenal tissues from patients with adrenocortical carcinoma and healthy subjects, and functional enrichment analysis of “Salmon Red” module genes

[0054] 1. Research subjects

[0055] 77 patients with adrenocortical carcinoma from the TCGA database and 127 healthy subjects from the GTEx database.

[0056] 2. Experimental Methods

[0057] Weighted gene co-expression network analysis (WGCNA) is a commonly used systems biology method for analyzing gene expression data based on mathematical models. It can be used to identify gene sets with highly coordinated changes and to identify candidate biomarker genes or therapeutic targets based on the connectivity of gene sets and the association between gene sets and clinical phenotypes.

[0058] RNA sequencing results from 77 patients with adrenocortical carcinoma were retrieved from the TCGA database, and RNA sequencing results from 127 healthy individuals were retrieved from the GTEx database. The data were downloaded, and one healthy adrenal specimen, which differed significantly from the other specimens, was excluded. A weighted co-expression network of 18,000 genes was analyzed using the R programming language. After automatic exclusion, a weighted co-expression network of 12,035 genes was finally analyzed. Gene ontology (GO) functional enrichment analysis and gene set enrichment analysis (GSEA) were performed on genes in the "Salmon Red" module.

[0059] 3. Experimental Results

[0060] The WGCNA results show that 12,035 genes are clustered into 12 functional gene modules. Different gene modules are distinguished by color, and genes that cannot be clustered are displayed in gray ( Figure 1 AB). The module eigengene of “Salmon Red” has a high proximity with “Cancer” and “Metastasis” ( Figure 1 C). Pearson correlation analysis showed that the "Salmon Red" gene module was significantly positively correlated with the clinical phenotypes of "cancer" (correlation coefficient 0.70) and "metastasis" (correlation coefficient 0.41), and significantly negatively correlated with "survival" (correlation coefficient -0.49) and "normal" (correlation coefficient -0.70). Figure 1 D). GS (gene significance), that is, calculating the significance of genes in the module and the corresponding clinical phenotype. Module Membership (MM), is the correlation between the eigengene of the module and the gene expression spectrum. The MM-GS correlation scatter plot represents the correlation between MM and GS. When the result is closer to 0, it is considered that the gene module is not related to the clinical phenotype. The closer the result is to 1 or -1, the more we believe that the gene module is highly positively or negatively correlated with the clinical phenotype. The results show that the "Salmon Red" gene module is highly positively correlated with "cancer" (correlation coefficient is 0.78) and "metastasis" (correlation coefficient is 0.80) ( Figure 1 EF).

[0061] GO analysis and GSEA analysis of the "Salmon Red" module genes showed that these genes were enriched in the process of "chromosome separation" ( Figure 2 AB). In the "Salmon Red" gene module, 78 genes were upregulated in adrenocortical carcinoma and involved in the chromosome segregation process ( Figure 2 C). The protein interaction network of these 78 molecules was constructed. The largest protein interaction network contained 8 CENP family molecules ( Figure 2 D), CENPM and the other 7 CENP molecules are ranked second ( Figure 2 E), but CENPM is the molecule most associated with poor prognosis among these 8 molecules ( Figure 2 F).

[0062] 4. Experimental Conclusion

[0063] CENPM is a key gene regulating adrenocortical carcinoma metastasis.

[0064] Example 2 Analysis of CENPM gene expression in adrenocortical carcinoma and normal adrenal tissue

[0065] 1. Research subjects

[0066] 77 patients with adrenocortical carcinoma from the TCGA database, 127 healthy human adrenal tissues from the GTEx database; four datasets from the GEO database: GSE10927, GSE75415, GSE12368, and GSE143383.

[0067] 2. Research Methods

[0068] We retrieved RNA sequencing results from 77 patients with adrenocortical carcinoma from the TCGA database and 127 healthy individuals from the GTEx database. We downloaded the data and analyzed RNA-seq expression differences between adrenocortical carcinoma and healthy individuals. We also analyzed expression across different adrenocortical carcinoma stages (ECOG stages) and compared survival between patients with high and low CENPM expression.

[0069] 3. Research Results

[0070] The expression of CENPM in adrenocortical carcinoma is higher than that in healthy human adrenal tissue ( Figure 3 A); the expression level of CENPM in stage IV is higher than that in stages I, II and III ( Figure 3 B). GSE10927, GSE75415, GSE12368, and GSE143383 datasets all showed that the expression of CENPM in adrenocortical carcinoma was higher than that in healthy human adrenal tissue ( Figure 3CF). The overall survival and disease-free survival rates of patients with high CENPM expression were lower than those of patients with low CENPM expression ( Figure 3 GH).

[0071] 4. Experimental Conclusion

[0072] The CENPM gene is highly expressed in patients with adrenocortical carcinoma and is associated with poor prognosis.

[0073] Example 3: Immunohistochemical analysis of CENPM protein expression in normal adrenal tissue, adrenocortical tumors, and patients with different stages of adrenocortical carcinoma

[0074] 1. Research subjects

[0075] Paraffin sections of 13 normal adrenal glands, 13 adrenocortical tumors, and 14 adrenocortical carcinomas.

[0076] 2. Experimental Methods

[0077] Immunohistochemistry was used to detect CENPM protein expression in adrenal tissue. The following steps were performed: paraffin sections were placed in a 65°C oven for 2 hours before dewaxing; fixed sections were retrieval in antigen retrieval solution for 15 minutes; repaired sections were placed in a 3% H₂O₂ solution for 15 minutes to remove endogenous peroxidase; diluted primary antibody working solution (CENPM antibody, Affinity, 1:50) was added dropwise, incubated overnight at 4°C, washed with TBST, and the remaining solution was removed. Horseradish peroxidase (HRP)-conjugated secondary antibody was added dropwise, incubated at room temperature for 2 hours, and developed with DAB colorimetric solution.

[0078] 3. Experimental Results

[0079] CENPM protein is highly expressed in patients with adrenocortical carcinoma, and the higher the tumor stage, the higher the expression of CENPM ( Figure 4 ).

[0080] 4. Experimental Conclusion

[0081] CENPM protein is highly expressed in patients with adrenocortical carcinoma, and its expression increases with tumor stage.

[0082] Example 4: Knockdown of CENPM expression in adrenocortical cancer cell lines and detection of changes in cell proliferation, migration, and invasion abilities

[0083] 1. Research subjects

[0084] Adrenocortical carcinoma cell lines H295R and SW-13 were provided by the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0085] 2. Experimental Methods

[0086] (1) Cell culture

[0087] H295R cells were cultured in DMEM medium containing F12 medium (DMEM / F12) supplemented with 10% fetal bovine serum (FBS), 0.5% insulin-transferrin-selenium (ITS-G) solution, and 1% penicillin / streptomycin (P / S) solution. SW-13 cells were cultured in Leibovitz L-15 medium containing 10% FBS and 1% penicillin / streptomycin.

[0088] (2) Preparation of small interfering RNA (siRNA)

[0089] siRNA targeting CENPM was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd., including two siRNAs targeting CENPM (siCENPM-1, siCENPM-2) and one control siRNA (siNC):

[0090] siCENPM-1:

[0091] sense(5'-3')GGAAGGCUUUAGGCCACCTT,

[0092] antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT;

[0093] siCENPM-2:

[0094] sense(5'-3')GAUCGUGUUUGUGGUUAAUTT,

[0095] antisense(5'-3')AUUAACCACAACACGAUCTT;

[0096] siNC:

[0097] sense(5'-3')UUCUCCGAACGUGUCACGUTT,

[0098] antisense(5'-3')ACGUGACACGUUCGGAGAATT.

[0099] (3) siRNA transfection

[0100] H295R or SW-13 cells were seeded into a 24-well plate and maintained at 50% cell confluency after 24 hours. When cell confluency reached 50%, the medium was replaced with 500 μl of serum-free medium. GP-transfect-Mate transfection reagent was placed at room temperature and gently mixed before use. To a 1.5 ml sterile centrifuge tube, 50 μl of serum-free medium and 1.5 μl of GP-transfect-Mate transfection reagent (Shanghai Jima) were added. Gently mix with a pipette and let stand at room temperature for 5 minutes. Simultaneously, to another 1.5 ml sterile centrifuge tube, 50 μl of serum-free medium was added and 40 pmol of siCENPM-1, siCENPM-2, or siNCsiRNA was added. Gently mix with a pipette and let stand at room temperature for 5 minutes. The GP-transfect-Mate-medium mixture was added dropwise to the siRNA-medium mixture. Gently mix with a pipette and let stand at room temperature for 15-20 minutes before transfection. Replace the complete medium 4-6 hours after transfection. After 48 hours, the expression of CENPM mRNA was detected by Q-PCR, and after 72 hours, the expression of CENPM protein was detected by western blot.

[0101] (4) Q-PCR detection of CENPM mRNA expression

[0102] Cellular RNA was extracted using the Trizol method, and total mRNA was reverse transcribed into cDNA. The mixture was prepared in the dark with the following proportions: a. SYBR-Green qPCR Mix 10 μl; b. Forward Primer 0.5 μl; c. Reverse Primer 0.5 μl; d. cDNA 2 μl; e. deionized water 7 μl, for a total of 20 μl. Three replicate wells were added to each sample and the reaction was performed on the machine. The reaction procedure was: a. 95°C, pre-denaturation for 5 minutes; b. 95°C, denaturation for 15 seconds; c. 60°C, annealing; d. 72°C, extension for 30 seconds; e, b, d, for a total of 40 cycles. Statistical analysis was performed using 2 -ΔΔ C t Methods Gene expression levels were converted into fold relationships for data organization and analysis.

[0103] (5) Western blot detection of CENPM protein expression

[0104] Total protein was extracted using RIPA lysis buffer containing a cocktail and quantified using a BCA protein assay kit. Proteins were separated by SDS-PAGE gel electrophoresis and then transferred to a PVDF membrane. The membrane was incubated with a CENPM primary antibody (Invitrogen, 1:1000) at 4°C overnight, followed by incubation with the corresponding HRP-conjugated secondary antibody for 1 hour at room temperature. Protein signals were detected using a Gelview 1500 pro (BLT).

[0105] (6) Cell proliferation, migration and invasion assays

[0106] Cell proliferation was assessed using a colony-forming assay. 72 hours after siRNA transfection, 1,000 cells were seeded in each well of a 6-well plate and cultured for approximately 20 days. Colonies were stained with crystal violet solution. Cell migration was assessed using a wound-healing assay. 72 hours after siRNA transfection, cells were incubated in PBS for 10 minutes, scratched with a 100-μL pipette tip, and cultured in medium containing 2% FBS for 72 hours. Cell invasion was assessed using a transwell invasion assay. Transfected cells were placed in the upper layer of a Matrigel chamber containing serum-free medium, and medium containing 25% FBS was placed in the lower layer.

[0107] 3. Experimental Results

[0108] Knockdown of CENPM inhibited the expression of CENPM mRNA and protein levels in H295R and SW-13 cells ( Figure 5 AB). Knockdown of CENPM inhibited the colony formation of H295R and SW-13 cells ( Figure 5 C), cell invasion ( Figure 5 D) and cell migration ( Figure 5 E).

[0109] 4. Experimental Conclusion

[0110] Knockdown of CENPM inhibited the proliferation, invasion and migration of adrenocortical cancer cells.

[0111] Example 5: Knockdown of CENPM expression in adrenocortical cancer cell lines and detection of changes in adrenocortical cancer metastasis in xenografted mice

[0112] 1. Research subjects

[0113] Six 4-week-old male NPG mice were purchased from Beijing Weitongda Biotechnology Co., Ltd.

[0114] 2. Experimental Methods

[0115] (1) Construction of recombinant lentivirus

[0116] Recombinant LV-luciferase-shCENPM-Puro and LV-luciferase-shScramble-Puro (negative control) lentiviruses were synthesized by Shanghai Jima Biotechnology Co., Ltd.

[0117] Sequence of shCENPM: GGAAGGCTTTAGGGCCACC;

[0118] Sequence of shScramble: TTCTCCGAACGTGTCACGT

[0119] (2) Lentivirus infection and screening of stable transfected strains

[0120] SW-13 cells were cultured at 2.0 × 10 5 Cells were seeded at a density of 100 cells / mL in 6-well plates. When cells reached 50% confluence, they were infected with recombinant lentivirus diluted in serum-free medium in the presence of 5 μg / mL polybrene (GenePharma, Co., Ltd, China) at an MOI of 20. After 24 hours of incubation, the medium was replaced with complete growth medium containing 10% FBS. Stable clones were selected with 1.0 mg / mL puromycin for 10-14 days.

[0121] (3) Construction of xenograft mouse model

[0122] The mice were divided into two groups: LV-shCENPM and negative control. Each mouse was injected intravenously with 2×10 6 SW-13 cells were stably transfected with either LV-luciferase-shCENPM-Puro or LV-luciferase-shScramble-Puro. Twenty-eight days after injection, mice were intraperitoneally injected with D-luciferin sodium salt (Meilun Biotechnology). Twenty minutes after injection, mice were anesthetized with isoflurane and imaged using a small animal in vivo imaging system (PerkinElmer). Afterwards, mice were sacrificed, and vital organs, including the liver, lungs, spleen, and kidneys, were dissected.

[0123] (4) HE staining

[0124] Liver tissue was stained with HE, and the specific steps were as follows: ① Dewaxing: xylene 10 min - xylene 10 min - anhydrous ethanol 5 min - anhydrous ethanol 5 min - 95% ethanol 5 min - 85% ethanol 5 min - 70% ethanol 5 min - pure water 5 min; ② Staining: hematoxylin 4 min - tap water rinse 10 min - hydrochloric acid ethanol differentiation 3 s - tap water rinse 10 min (return to blue) - eosin 25 s to 1 min; ③ Dehydration: anhydrous ethanol 5 min - anhydrous ethanol 5 min - anhydrous ethanol 5 min; ④ Permeabilization: xylene 10 min - xylene 10 min - xylene 10 min; ⑤ Sealing: After sealing with neutral resin, let it dry naturally and then place it under a microscope for observation and photography.

[0125] (5)Ki-67 staining

[0126] The pathological paraffin sections were placed in a 65°C oven for 2 hours and then dewaxed; the fixed sections were placed in antigen retrieval solution for 15 minutes; the repaired sections were placed in a 3% H2O2 aqueous solution for 15 minutes to remove endogenous peroxidase; diluted Ki-67 antibody was added and incubated at 4°C overnight. After washing with TBST, the remaining liquid was removed, and horseradish peroxidase (HRP)-conjugated secondary antibody was added and incubated at room temperature for 2 hours. DAB color development solution was used for color development.

[0127] 3. Experimental Results

[0128] A mouse adrenocortical carcinoma metastasis model was successfully established by injecting SW-13 cells into the tail vein of NPG mice ( Figure 6 A). 28 days after the tail vein injection of SW-13 cells with normal CENPM, strong bioluminescence was observed in the right upper abdomen of mice, indicating the presence of a large number of adrenocortical cancer cells. However, after the tail vein injection of SW-13 cells with knockdown of CENPM, no obvious bioluminescence was observed in the right upper abdomen of mice, indicating the absence of adrenocortical cancer cells. ( Figure 6 B). 28 days after tail vein injection of SW-13 cells with normal CENPM, mice developed numerous adrenocortical carcinoma metastases in the liver. However, intravenous injection of SW-13 cells with knockdown of CENPM significantly reduced the number of adrenocortical carcinoma metastases in the liver. Figure 6 C, Figure 6 D). The expression of Ki-67 in adrenocortical carcinoma metastases of SW-13 cells with normal CENPM injected into the tail vein was higher, indicating that the adrenocortical carcinoma cells had a stronger proliferation ability, while the expression of Ki-67 in adrenocortical carcinoma metastases of SW-13 cells with CENPM knockdown injected into the tail vein was lower, indicating that the adrenocortical carcinoma cells had a weaker proliferation ability ( Figure 6 D).

[0129] 4. Experimental Conclusion

[0130] Knockdown of CENPM inhibited liver metastasis of adrenocortical carcinoma in mice.

[0131] It should be noted that, in this document, the terms "comprises," "includes," or any other variations thereof are intended to encompass non-exclusive inclusion, such that a process, method, article, or apparatus comprising a series of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus. In the absence of further limitations, an element defined by the phrase "comprising a ..." does not exclude the presence of other identical elements in the process, method, article, or apparatus comprising the element.

[0132] The serial numbers of the above embodiments of the present invention are for description only and do not represent the advantages or disadvantages of the embodiments.

[0133] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, and all of these should be included in the scope of the claims of the present invention.

Claims

1. Use of an agent for inhibiting the expression of the CENPM gene in the preparation of a drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma; the agent comprises siRNA for knocking out the expression of the CENPM gene, The sequence of the siRNA for knocking out CENPM gene expression is selected from the following siCENPM-1 or siCENPM-2: siCENPM-1: sense(5'-3')GGAAGGCUUUAGGCCACCTT, antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT; siCENPM-2: sense(5'-3')GAUCGUGUUUGUGGUUAAUTT, antisense(5'-3')AUUAACCACAACACGAUCTT.

2. A drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma, characterized in that: The drugs are: siRNA to knock down CENPM gene expression; The sequence of the siRNA for knocking out CENPM gene expression is selected from the following siCENPM-1 or siCENPM-2: siCENPM-1: sense(5'-3')GGAAGGCUUUAGGCCACCTT, antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT; siCENPM-2: sense(5'-3')GAUCGUGUUUGUGGUUAAUTT, antisense(5'-3')AUUAACCACAACACGAUCTT.

Images