Preparation, purification and application of protein compound

Abstract

The invention relates to preparation, purification and application of a protein compound, and belongs to the technical field of biology. The present disclosure provides a protein delivery system comprising a protein complex and a signal peptide wherein the protein complex comprises a structural protein and a regulatory factor, the structural protein and the regulatory factor being from a Xenorhabdus khoisanae MCB strain. According to the present invention, the XkCIS protein complex structure gene and the lysR gene derived from the Xenorhabdus khoissanae MCB strain are expressed in the Escherichia coli, the expression and the assembly of the XkCIS protein complex in the bacteria are achieved, further, the effect protein is selectively fused with the signal peptide, and is loaded to the XkCIS protein complex under the guidance of the signal peptide, such that the XkCIS protein complex structure gene and the lysR gene are obtained, the specific delivery of the effect protein can be realized.

Description

Technical Field

[0001] The present invention relates to the preparation, purification and application of a protein complex, and in particular to a multi-purpose protein delivery system, a preparation method and application, and belongs to the field of biotechnology. Background Art

[0002] The secretion system of microorganisms plays an important role in coping with complex living environments. It stabilizes the physiological processes of microorganisms and maintains the microenvironment by transporting their own effector molecules, thereby achieving colonization, internalization and spread in host cells. Contractile injection systems (CISs), which are widely present in bacteria and archaea, are an important class of protein secretion systems that can form a device similar to the contractile tail of bacteriophages. This device transfers bacterial virulence factors into other host cells, mediates cell-to-cell communication and induces virulence to gain growth advantages. CISs include intracellular CISs and extracellular CISs (eCISs). Intracellular CISs inject virulence factors from the cytoplasm to the outside in a contact-dependent manner, using the type VI secretion system (T6SS) that is widely present in Gram-negative bacteria (A. Vettiger, M. Basler, Type VI secretion system substrates are transferred and reused among sister cells. Cell, 2016, 167(1):99-110; J. Wang, M. Brackmann, D. -Díez,et al.,Cryo-EMstructure of the extended type VI secretion system sheath-tube complex.NatMicrobiol,2017,2(11):1507-1512;MSStietz,X.Liang,H.Li,et al.,TssA-TssM-TagAinteraction modulates type VI secretion system sheath-tube assembly in Vibriocholerae.Nat Commun,2020,11(1):5065.) is represented by the contractile tail of T4 bacteriophage, which has a similar structure to the contractile tail of T4 bacteriophage. After the membrane complex is formed, it is anchored on the bacterial cell membrane, penetrates the inner and outer double membranes, and transports virulence factors into prokaryotic and eukaryotic cells.

[0003] Unlike intracellular CISs, eCISs can be released into the extracellular environment and attack host cells from the external space without the need for direct contact with target cells.Common eCISs include the virulence device Photorhabdus virulence cassette (PVC) in Photorhabdus (P.Ge, D.Scholl, P.G.Leiman, et al., atomic structures of a bactericidal contractile nanotube in its pre-andpostcontraction states. Nat Struct Mol Biol, 2015, 22(5): 377-382.), the antifeeding prophage (AFP) in Serratia entomophila (T.Jank, S.Eckerle, M.Steinemann, et al. Tyrosine glycosylation of Rho by Yersinia toxin impairsblastomere cell behaviour in zebrafish embryos. Nature Communications, 2015, 6(1): 7807.), and the antifeeding prophage (AFP) in Pseudomonas aeruginosa (Pseudomonas aeruginosa). aeruginosa) (M. Mei, J. Thomas, S. P. Diggle, Heterogenous susceptibility to R-pyocins in populations of Pseudomonas aeruginosa sourced from cystic fibrosis lungs. mBio, 2021, 12 (3): e00458-21.), Metamorphosis-associated contractile structure (MAC) secreted by Pseudoalteromonas luteoviolacea (N. J. Shikuma, I. Antoshechkin, J. M. Medeiros, et al., Stepwise metamorphosis of the tubeworm Hydroides elegans is mediated by a bacterial inducer and MAPKsignaling. Proc Natl Acad Sci USA, 2016, 113 (36): 10097-102.), etc.

[0004] Currently, biomacromolecules represented by proteins and DNA / RNA have great potential in the prevention and treatment of major diseases. How to achieve efficient and specific delivery of biomacromolecules is an important scientific and technological issue in this field (J. van Haasteren, J. Li, OJ Scheideler, et al., The delivery challenge: fulfilling the promise of therapeutic genome editing. Nat Biotechnol 2020, 38(7): 845-855.). In terms of protein delivery technology, physical methods such as electroporation and microinjection require the use of instruments to perforate the cell membrane before delivering proteins into the cell, which is inefficient and has limited clinical application. The virus-like protein delivery system eVLPs can be used for efficient in vivo delivery of gene editing protein RNP complexes, and can achieve efficient delivery of therapeutic protein RNP complexes to primary cells and various tissues of mice, and has achieved good therapeutic effects in various disease models (S. Banskota, A. Raguram, S. Suh, et al., Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell, 2022, 185(2): 250-265.). In the early stage, the applicant used PVC as the research object and conducted a detailed analysis of the structure and delivery function of eCIS, such as the preparation and structure of its complete carrier (Jiang Feng, et al., 2019. Cell. 177(2): 370-383e15.); the loading and action mechanism of PVC effector protein (Wang xia, et al., 2022. Science China Life Sciences. 65(3): 618-630.); the discovery of effector protein signal peptide can help PVC recognize, load and transport target proteins, thereby mediating the effective delivery of target proteins to mouse cells and mice (F. Jiang, J. Shen, J. Cheng, et al., Sci Adv 2022, 8(17): eabm2343.). Recently, Zhang Feng's team from the Broad Institute further modified the PVC carrier, which has taken it one step further towards its use in human cell delivery (Joseph Kreitz, et al., Nature 2023.doi.org / 10.1038 / s41586-023-05870-7).

[0005] With the advantages of high efficacy, low toxicity and strong specificity, peptide and protein drugs have gradually entered the public eye and have broad prospects for clinical application. Compared with small molecule drugs, protein drugs are difficult to penetrate the cell membrane into the cytoplasm. Therefore, it is necessary to develop effective protein delivery technology to lay the foundation for the widespread application of protein drugs. Compared with DNA / RNA-based delivery technology, the research on new protein delivery technology has been slow and still requires new breakthroughs. Although physical methods such as electroporation and microinjection have made many breakthroughs, specific delivery research still faces many challenges. Non-specific delivery can easily lead to safety risks, which greatly limits the application prospects of protein drugs and the development of targeted disease treatment. Summary of the invention

[0006] Problem that the invention aims to solve

[0007] Although relevant research has been done, there is currently a lack of effective delivery systems to deliver protein drugs into cells. How to load effector proteins into the delivery system to form protein complexes to achieve effective and specific protein delivery is also an urgent problem to be solved.

[0008] Solutions for solving problems

[0009] [1]. A protein delivery system comprising a protein complex and a signal peptide, wherein:

[0010] The protein complex includes structural proteins and regulatory factors.

[0011] The structural proteins and regulatory factors are from the MCB strain of Xenorhabdus khoisanae;

[0012] Optionally, the protein delivery system is an extracellular contractile injection system.

[0013] [2] The protein delivery system according to [1], wherein the signal peptide is derived from Xenorhabdus khoisanae MCB strain;

[0014] Preferably, the signal peptide comprises one or more of the amino acid sequences shown in SEQ ID NO: 38, 39 or 40 or fragments thereof;

[0015] Optionally, the fragment is a C-terminally truncated fragment of the amino acid sequence shown in SEQ ID NO: 38, 39 or 40;

[0016] Optionally, the signal peptide is linked to the N-terminus of the effector protein;

[0017] Optionally, a linker sequence is further included between the signal peptide and the effector protein.

[0018] [3] The protein delivery system according to [1] or [2], wherein the structural protein is derived from the MCB strain of Xenorhabdus khoisanae;

[0019] Preferably, the structural protein is encoded by the Cis gene cluster;

[0020] More preferably, the Cis gene cluster comprises a nucleotide sequence consisting of sequences shown in SEQ ID NO:47 and SEQ ID NO:57 in the order from 5' end to 3' end, or at least one of its variants having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with the nucleotide sequence consisting of sequences shown in SEQ ID NO:47 and SEQ ID NO:57 in the order from 5' end to 3' end.

[0021] [4] The protein delivery system according to [3], wherein the structural protein is a modified protein obtained by modifying the recognition region of the protein encoded by the Cis gene cluster into another recognition protein.

[0022] [5] The protein delivery system according to any one of [1] to [4], wherein the regulatory factor is derived from the MCB strain of Xenorhabdus khoisanae;

[0023] Preferably, the regulatory factor comprises the amino acid sequence as shown in SEQ ID NO:34, or a variant thereof having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with SEQ ID NO:34.

[0024] [6] The protein delivery system according to any one of [1] to [5], wherein the effector protein comprises any protein;

[0025] Optionally, the effector protein includes any protein of interest to be administered to a subject / cell;

[0026] Optionally, the effector protein includes a virulence factor or reporter protein derived from Xenorhabdus khoisanae MCB strain, a cellular or bacterial virulence protein, a signaling pathway regulatory protein, a hormone or hormone regulatory molecule, a structural protein, a transport protein, an antimicrobial peptide, an enzyme involved in cell metabolism, a gene editing protein, an antigen or immunogen and / or a pharmaceutically active protein.

[0027] [7]. An isolated polynucleotide encoding the protein delivery system described in any one of [1] to [6].

[0028] [8] The polynucleotide according to [7], wherein the polynucleotide comprises one or more of the following:

[0029] i) nucleotides encoding structural proteins in the protein delivery system;

[0030] ii) nucleotides encoding a regulatory factor in the protein delivery system; and

[0031] iii) a nucleotide encoding a signal peptide in the protein delivery system; and,

[0032] Optionally, nucleotides encoding an effector protein.

[0033] [9]. An expression vector comprising the polynucleotide described in [7] or [8].

[0034]

[10] A recombinant host cell comprising the protein delivery system described in any one of [1] to [6], the polynucleotide described in [7] or [8], or the expression vector described in [9].

[0035]

[11] . A method for preparing the protein delivery system described in any one of [1] to [6], comprising the steps of constructing the expression vector described in [9], transforming the expression vector described in [9] into a host cell to construct a recombinant host cell described in

[10] , and culturing the recombinant host cell described in

[10] ;

[0036] Optionally, the method further comprises the step of isolating the protein from the cultured recombinant host cells.

[0037]

[12] The method according to

[11] , wherein the recombinant plasmid is selected from one or more of pBR322, pRK404, pUC, pBluescript, pBBR1MCS-5 or their modified vectors.

[0038]

[13] . Use of the protein delivery system described in any one of [1] to [6], the polynucleotide described in [7] or [8], the expression vector described in [9] or the recombinant host cell described in

[10] in the preparation of drugs, reagents and / or kits for delivering biomacromolecules.

[0039]

[14] . The use according to

[13] , wherein the biomacromolecule comprises a virulence factor or reporter protein derived from the MCB strain of Xenorhabdus khoisanae, a cellular or bacterial virulence protein, a signaling pathway regulatory protein, a hormone or a hormone regulatory molecule, a structural protein, a transporter protein, an antimicrobial peptide, an enzyme involved in cell metabolism, a gene editing protein, an antigen or an immunogen and / or a pharmaceutically active protein.

[0040]

[15] A pharmaceutical composition comprising: the protein delivery system as described in any one of [1] to [6], and

[0041] Optionally, a pharmaceutically acceptable carrier or excipient;

[0042] Optionally, the effector protein, optionally, comprises a virulence factor or reporter protein derived from Xenorhabdus hoisanae MCB strain, a cellular or bacterial virulence protein, a signaling pathway regulatory protein, a hormone or hormone regulatory molecule, a structural protein, a transporter, an antimicrobial peptide, an enzyme involved in cell metabolism, a gene editing protein, an antigen or immunogen and / or a pharmaceutically active protein.

[0043]

[16] A kit for delivering an effector protein, comprising: a protein delivery system as described in any one of [1] to [6], or a pharmaceutical composition as described in

[15] ;

[0044] The effector proteins include virulence factors or reporter proteins derived from Xenorhabdus khoisanae MCB strain, cellular or bacterial virulence proteins, signal pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens and / or pharmaceutically active proteins.

[0045] Effects of the Invention

[0046] The present invention realizes the expression and assembly of the XkCIS protein complex in bacteria by expressing the XkCIS protein complex structural gene and the lysR gene in bacteria. Furthermore, the effector protein is selectively fused with the signal peptide and loaded into the XkCIS protein complex under the guidance of the signal peptide, thereby realizing the specific delivery of the effector protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Schematic diagram of the construction of recombinant plasmid pRK404-XkCIS.

[0048] Figure 2 Schematic diagram of the construction of recombinant plasmid pBR322-Xk-LysR.

[0049] Figure 3 This is a negative-stained electron microscopic observation of the XkCIS protein complex.

[0050] Figure 4 This is the result of SDS-PAGE analysis of XkCIS protein complex.

[0051] Figure 5Schematic diagram of the location of the XkCIS gene cluster and downstream effector factors.

[0052] Figure 6 The Xk1, 2, and 3 signal peptides can guide the TcsT protein to be loaded into the Xk protein complex.

[0053] Figure 7 Xk1 signal peptides of different lengths direct the loading of TcsT protein into the Xk protein complex.

[0054] Figure 8 Xk2 signal peptides of different lengths direct the loading of TcsT protein into the Xk protein complex.

[0055] Fig. 9 Xk3 signal peptides of different lengths direct the loading of TcsT protein into the Xk protein complex.

[0056] Fig.10 Different signal peptides direct different proteins to be loaded into the Xk protein complex.

[0057] Fig.11 Schematic diagram of Xk13 identification region modification. DETAILED DESCRIPTION

[0058] Various exemplary embodiments, features and aspects of the present disclosure will be described in detail below. The word "exemplary" used herein means "used as an example, embodiment or illustrative". Any embodiment described herein as "exemplary" is not necessarily to be interpreted as being superior or better than other embodiments.

[0059] In addition, in order to better illustrate the present disclosure, numerous specific details are given in the specific embodiments below. It should be understood by those skilled in the art that the present disclosure can also be implemented without certain specific details. In other examples, methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the main purpose of the present disclosure.

[0060] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in this disclosure should be understood to include the inevitable systematic errors in industrial production.

[0061] In this specification, the word "may" means both performing a certain process and not performing a certain process.

[0062] In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", etc., mean that the specific elements (e.g., features, structures, properties and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0063] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoints numerical values ​​A and B.

[0064] In this specification, when "normal temperature" or "room temperature" is used, the temperature may be 10-40°C.

[0065] As used in the present disclosure, the terms "polypeptide", "enzyme", "polypeptide or enzyme" or "polypeptide / enzyme" have the same meaning and are interchangeable in the present disclosure. The aforementioned terms refer to a polymer composed of a plurality of amino acids through peptide bonds, which may or may not contain modifications such as phosphate groups and formyl groups.

[0066] As used in the present disclosure, the term "amino acid" may include natural amino acids, non-natural amino acids, amino acid analogs, and all their D and L stereoisomers. Amino acids and their abbreviations and English abbreviations in the present disclosure are as follows:

[0067] Histidine (His, H); serine (Ser, S); glutamic acid (Glu, E); glutamine (Gln, Q); glycine (Gly, G); threonine (Thr, T); phenylalanine (Phe, F); aspartic acid (Asp, D); tyrosine (Tyr, Y); leucine (Leu, L); isoleucine (Ile, I); arginine (Arg, R); alanine (Ala, A); valine (Val, V); tryptophan (Trp, W); methionine (Met, M); asparagine (Asn, N); cysteine ​​(Cys, C); lysine (Lys, K); proline (Pro, P).

[0068] As used in this disclosure, the term "fragment" means a polypeptide or a catalytic or carbohydrate binding module that is missing one or more (eg, several) amino acids from the amino and / or carboxyl terminus of a mature polypeptide or domain.

[0069] As used in the present disclosure, the term "sequence identity" or "percent identity" in the comparison of two nucleic acids or polypeptides refers to the number of sequences that are identical or have a specific percentage of the same sequence when compared and aligned with maximum correspondence using a nucleotide or amino acid residue sequence comparison algorithm or measured by visual inspection. That is, the identity of a nucleotide or amino acid sequence can be defined by the following ratio, which is the ratio of the number of nucleotides or amino acids that are consistent when two or more nucleotide or amino acid sequences are compared in a manner that maximizes the number of consistent nucleotides or amino acids, and gaps are added as needed to compare, to the total number of nucleotides or amino acids in the aligned portion.

[0070] The methods for determining "sequence identity" or "percent identity" contemplated by the present disclosure include, but are not limited to: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987 and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York, 1991 and Carillo, H. and Lipman, D., SIAM J. Applied Biology, 1996. Math., 48:1073 (1988). The preferred method for determining identity is to obtain the largest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining the identity between two sequences include, but are not limited to, the GCG program package (Devereux, J. et al., 1984), BLASTP, BLASTN and FASTA (Altschul, S, F. et al., 1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

[0071] In this disclosure, the terms "nucleic acid molecule", "polynucleotide", "polynucleic acid", and "nucleic acid" are used interchangeably to refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, control regions, isolated RNA of any sequence, nucleic acid probes, and primers. Nucleic acid molecules can be linear or circular.

[0072] In the present disclosure, the term "codon optimization" means that a nucleotide sequence encoding a polypeptide has been configured to contain codons preferred by a host cell or organism to improve gene expression in the host cell or organism and increase translation efficiency.

[0073] As used in the present disclosure, the term "isolated" means a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including but not limited to any enzyme, mutant, nucleic acid, protein, peptide or cofactor, which is at least partially removed from one or more or all naturally occurring components associated with its nature; (3) any substance artificially modified relative to the substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components associated with it in nature (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a promoter stronger than the promoter naturally associated with the gene encoding the substance). The isolated substance may be present in a fermentation broth sample. For example, a host cell may be genetically modified to express a polypeptide of the present disclosure. The fermentation broth from the host cell will contain the isolated polypeptide. "Recombinant polynucleotide" is one of the "polynucleotides".

[0074] As used in this disclosure, the term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0075] As used in this disclosure, the term "expression vector" refers to a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

[0076] As used in the present disclosure, the term "recombinant expression vector" refers to a DNA structure used to express, for example, a polynucleotide encoding a desired polypeptide. A recombinant expression vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into a protein; and iii) a transcriptional subunit that is suitable for transcription and translation initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector may be used, including plasmids, viruses, phages, and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from a combination of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0077] As used in this disclosure, the terms "transformation, transfection, and transduction" have the meanings generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The methods of transformation, transfection, and transduction include any method of introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate (CaPO), and the like. 4 ) precipitation method, calcium chloride (CaCl 2 ) precipitation method, microinjection method, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method and lithium acetate-DMSO method.

[0078] As used in the present disclosure, the term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a mutant polypeptide, a polynucleotide encoding a mutant polypeptide, or a recombinant expression vector comprising the present disclosure.

[0079] As used in the present disclosure, the term "recombinant host cell" encompasses a host cell that is different from the parent cell after the polynucleotide encoding the mutant polypeptide or the recombinant expression vector is introduced, and the recombinant host cell is specifically achieved by transformation. The host cell of the present disclosure can be a prokaryotic cell or a eukaryotic cell. In one embodiment, the host cell refers to a prokaryotic cell, and specifically, the host cell is derived from a microorganism suitable for fermentation production of protein, for example, from Escherichia (Escherichia), Erwinia (Erwinia), Serratia (Serratia), Providencia (Providencia), Enterobacteria (Enterobacteria), Salmonella (Salmonella), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Brevibacterium (Brevibacterium), Bacillus (Bacillus) or Corynebacterium (Corynebacterium) microorganism.

[0080] As used in the present disclosure, the term "linker" may refer to a covalent linker (e.g., a covalent bond), a non-covalent linker, a chemical group, or a molecule that connects two molecules or parts (e.g., two components of a protein complex), for example, two domains of a fusion protein, such as a signal peptide and an effector protein. The linker may be located between or on both sides of two groups, molecules, or other parts, and is connected to each by a covalent bond or a non-covalent interaction, thereby connecting the two. In some embodiments, the linker may be a polynucleotide. In some embodiments, the linker may be a DNA linker. In some embodiments, the linker may be an RNA linker. In some embodiments, the linker may be an amino acid or multiple amino acids (e.g., a peptide or protein). In some embodiments, the length of the joint can be about 5 to 100 amino acids, such as about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90 or 90 to 100 amino acids. In some embodiments, the length of the joint can be about 100 to 150, 150 to 200, 200 to 250, 250 to 300, 300 to 350, 350 to 400, 400 to 450 or 450 to 500 amino acids. Longer or shorter joints are also contemplated.

[0081] The host cells disclosed herein can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0082] As used in this disclosure, "pharmaceutical composition" means containing one or more protein delivery systems described herein (e.g., loaded with effector proteins), as well as other components such as physiological / pharmaceutically acceptable carriers and excipients. The purpose of the pharmaceutical composition is to facilitate administration to an organism, facilitate the absorption of the active ingredient, and thus exert biological activity.

[0083] As used in this disclosure, the term "pharmaceutically acceptable" (or "pharmacologically acceptable") refers to molecular entities and compositions that do not produce adverse reactions, allergic reactions or other untoward reactions when administered to animals or humans, as appropriate. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, etc. that can be used as media for pharmaceutically acceptable substances.

[0084] As used in this disclosure, the terms "individual" and "subject" are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual is a human.

[0085] The terms "treatment", "treatment" refer to clinical interventions intended to reverse, alleviate, delay the onset of, or inhibit the progression of a disease or disorder or one or more symptoms thereof, as described herein. As used in the present disclosure, the terms "treatment", "treatment" refer to clinical interventions intended to reverse, alleviate, delay the onset of, or inhibit the progression of a disease or disorder or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have been formed and / or after the disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, for example, to prevent or delay the onset of symptoms or to inhibit the onset or progression of a disease. For example, treatment may be administered to susceptible individuals before the onset of symptoms (e.g., in view of the history of symptoms and / or in view of genetic or other susceptibility factors). Treatment may also continue after the symptoms subside, for example, to prevent or delay their recurrence.

[0086] The technical solution of the present disclosure is described in detail below:

[0087] <Protein Delivery System>

[0088] The present disclosure provides a protein delivery system, which comprises a protein complex and a signal peptide; wherein,

[0089] The protein complex comprises structural proteins and regulatory factors, and the structural proteins and regulatory factors are from the MCB strain of Xenorhabdus khoisanae;

[0090] The signal peptide is used to direct the loading of the effector protein into the protein complex, and the signal peptide is derived from the MCB strain of Xenorhabdus khoisanae.

[0091] In some specific embodiments, the protein delivery system is an extracellular contractile injection system.

[0092] (Signal peptide)

[0093] In some embodiments, the signal peptide is used to direct the loading of the effector protein into the protein complex, and the signal peptide is from the MCB strain of Xenorhabdus khoisanae.

[0094] In some embodiments, the signal peptide comprises one or more of the amino acid sequences shown in SEQ ID NO:38, 39 or 40 or fragments thereof. In some specific embodiments, the fragment may be a C-terminal truncated fragment. In some specific embodiments, the C-terminus may be truncated to any length. In some exemplary embodiments, the C-terminal truncated fragment may be one or more of the 1-10, 1-20, 1-30, 1-40, 1-50, 1-60, 1-70, 1-80, 1-90, 1-100, 1-110, 1-120 or 1-130 amino acids of the amino acid sequence shown in SEQ ID NO:38, 39 or 40, for example, the amino acid sequence shown in SEQ ID NO:44, 45 or 46.

[0095] In some specific embodiments, the signal peptide is linked to the N-terminus of the effector protein; optionally, a linker sequence is further included between the signal peptide and the effector protein.

[0096] In some specific embodiments, the effector protein can be any protein, such as any target protein to be administered to a subject / cell, such as, but not limited to, virulence factors or reporter proteins of Xenorhabdus khoisanae MCB strain, cellular or bacterial virulence proteins, signaling pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens, pharmaceutically active proteins, etc., including polypeptides or proteins.

[0097] The present disclosure has discovered that the use of the signal peptide comprising the above sequence can effectively load the effector protein into the protein complex.

[0098] (Protein Complex)

[0099] Structural proteins

[0100] In some embodiments, the structural proteins from Xenorhabdus khoisanae MCB strain (NCBI RefSeq assembly: GCF_001037465.1), also referred to herein as the Xk protein complex or the XkCIS protein complex, include proteins expressed from the Cis gene cluster.

[0101] In some specific embodiments, the complete sequence of the Cis gene cluster is shown as a nucleotide sequence consisting of the sequences shown in SEQ ID NO: 47 and SEQ ID NO: 57 in the order from 5' to 3'. In some preferred embodiments, the structural protein comprises a protein encoded by a polynucleotide consisting of the sequences shown in SEQ ID NO: 47 and SEQ ID NO: 57 in the order from 5' to 3'.

[0102] In some embodiments, the structural protein comprises 16 subunits, referred to as Cis1 to 16 (also referred to as XkCis1 to 16 in this specification). The nucleotide sequences encoding Cis1 to 16 are shown in SEQ ID NOs: 1 to 16, respectively.

[0103] Furthermore, Cis1 to 16 of the structural protein respectively comprise the amino acid sequences shown in SEQ ID NOs: 17 to 32, or at least one of their variants having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with any one or more of SEQ ID NOs: 17 to 32.

[0104] In other embodiments, the structural protein is obtained by transforming the recognition region of the protein encoded by the Cis gene cluster into other recognition proteins. In some exemplary embodiments, the recognition region is contained in Cis13, and optionally, the recognition protein is connected to the 355th amino acid of Cis13 (and the amino acids after the 356th amino acid of Cis13 are deleted); the recognition proteins include AD5RGDPK7, AD5knob, E01, CD4, etc.

[0105] Regulatory Factors

[0106] In some embodiments, the regulatory factor is from Xenorhabdus khoisanae MCB strain. In some specific embodiments, the regulatory factor comprises a protein expressed by the lysR gene of Xenorhabdus khoisanae MCB strain, also referred to herein as Xk-LysR.

[0107] In some specific embodiments, the regulatory factor comprises an amino acid sequence as shown in SEQ ID NO: 34, or a variant thereof having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with SEQ ID NO: 34; in some preferred embodiments, the regulatory factor comprises a protein encoded by a polynucleotide as shown in SEQ ID NO: 33. In some more preferred embodiments, the complete sequence of the regulatory factor comprises a sequence as shown in SEQ ID NO: 49.

[0108] <Polynucleotide>

[0109] The present disclosure provides an isolated polynucleotide encoding the above-mentioned protein delivery system.

[0110] In some specific embodiments, the polynucleotide comprises one or more of the following:

[0111] i) nucleotides encoding the structural proteins in the above-mentioned protein delivery system;

[0112] ii) nucleotides encoding the regulatory factor in the above-mentioned protein delivery system; and

[0113] iii) a nucleotide encoding a signal peptide in the above-mentioned protein delivery system; and,

[0114] Optionally, nucleotides encoding an effector protein.

[0115] In some embodiments, the nucleotide sequence encoding the protein delivery system is codon optimized. This type of optimization may require mutation of the nucleotide sequence encoding the protein delivery system to mimic the codon preference of the intended host organism or cell while encoding the same protein.

[0116] <Expression vector>

[0117] The present disclosure provides an expression vector comprising the above-mentioned polynucleotide.

[0118] In some specific embodiments, the carrier comprises one or more of the following:

[0119] i) nucleotides encoding the structural proteins in the above-mentioned protein delivery system;

[0120] ii) nucleotides encoding the regulatory factor in the above-mentioned protein delivery system; and

[0121] iii) a nucleotide encoding a signal peptide in the above-mentioned protein delivery system; and,

[0122] Optionally, iv) nucleotides encoding an effector protein.

[0123] In some embodiments, any two or more of the above (i) to (iv) may be in the same expression vector. In other embodiments, the above (i) to (iv) may be in different expression vectors.

[0124] <Recombinant Host Cell>

[0125] According to the protein delivery system provided by the present disclosure, the present disclosure provides a recombinant host cell comprising the protein delivery system, a polynucleotide, and an expression vector.

[0126] In some embodiments, the host cell may include bacteria, microorganisms, plants or animal cells. Easily transformed bacteria include members of the family Enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis. Suitable microorganisms include Saccharomyces cerevisiae and Pichia pastoris. In some preferred embodiments, the host cell is derived from Escherichia, more preferably Escherichia coli, including Escherichia coli DH10B, Escherichia coli Top10, Escherichia coli Trans T1, Escherichia coli BL21 (DE3), etc.

[0127] <Method for preparing protein delivery system>

[0128] According to some embodiments of the present disclosure, the present disclosure provides a method for preparing the above-mentioned protein delivery system, which includes the steps of respectively constructing recombinant plasmids for expressing structural proteins, expression regulatory factors, and effector proteins fused with expression signal peptides, and the steps of jointly transforming the recombinant plasmids into host cells to construct the recombinant host cells as described above, and the step of culturing the recombinant host cells as described above.

[0129] In some specific embodiments, the gene cluster encoding the structural protein is constructed onto the expression vector A to obtain a recombinant plasmid A; the gene encoding the structural protein is derived from the strain Xenorhabduskhoisanae MCB; further, the gene encoding the structural protein comprises a polynucleotide sequence consisting of the sequences shown in SEQ ID NO:47 and SEQ ID NO:57 in the order from the 5' end to the 3' end. In other embodiments, the gene encoding the structural protein comprises a polynucleotide sequence as shown in SEQ ID NO:1-16, and the structural protein comprises an amino acid sequence as shown in SEQ ID NO:17-32, or a variant thereof having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with any one or more of SEQ ID NO:17-32. In other embodiments, the structural protein is obtained by transforming the recognition region of the protein encoded by the Cis gene cluster into other recognition proteins. Optionally, the expression vector A comprises pBR322, pRK404, pUC, pBluescript, pBBR1MCS-5 or a modified vector thereof, preferably pRK404.

[0130] In some specific embodiments, the gene encoding the regulatory factor is constructed onto the expression vector B to obtain a recombinant plasmid B; the gene encoding the regulatory factor is derived from the strain Xenorhabdus khoisanae MCB; the gene encoding the regulatory factor comprises a polynucleotide sequence as shown in SEQ ID NO:33, and the regulatory factor comprises an amino acid sequence as shown in SEQ ID NO:34, or a variant thereof having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with SEQ ID NO:34. Optionally, the expression vector B comprises pBR322, pRK404, pUC, pACYC184, pBBR1MCS-5 or a modified vector thereof, preferably pBR322.

[0131] In other specific embodiments, the nucleotide encoding the signal peptide is operably linked to the gene encoding the effector protein, and then linked to the expression vector C to construct a recombinant plasmid C. The signal peptide is selected from the effector protein or a fragment thereof in the Xenorhabduskhoisanae MCB strain, and the effector protein comprises a sequence as shown in SEQ ID NO:38, 39 or 40. In some specific embodiments, the fragment can be a C-terminal truncated fragment. In some specific embodiments, the C-terminus can be truncated to any length. In some exemplary embodiments, the C-terminal truncated fragment can be one or more of the 1-10th, 1-20th, 1-30th, 1-40th, 1-50th, 1-60th, 1-70th, 1-80th, 1-90th, 1-100th, 1-110th, 1-120th or 1-130th amino acids of the amino acid sequence shown in SEQ ID NO:38, 39 or 40. As an example, the signal peptide comprises the 1st to 70th or 1-130th amino acid sequence as shown in SEQ ID NO:38, 39 or 40. For example, when comprising the 1st to 130th amino acid sequence as shown in SEQ ID NO:38, 39 or 40, the signal peptide may comprise the sequence as shown in SEQ ID NO:44, 45 or 46. Optionally, the expression vector C comprises pBad, pRK404, pVTRA', pBluescript, pBBR1MCS-5 or a modified vector thereof, preferably a pBBR1MCS-5 vector or a modified vector thereof, more preferably, the restriction site NdeI is introduced into the LacZα gene of the pBBR1MCS-5 vector to generate a new start codon at the starting position of the LacZα gene, and an expression vector pBBRN (pBBRN plasmid is disclosed in the document Jiang et al., N-terminal signal peptides facilitate the engineering of PVC complex as a potent protein delivery system. Sci Adv. 2022Apr 29; 8(17): eabm2343, which is incorporated herein by reference) is constructed and used for the fusion expression of the signal peptide and the effector protein.

[0132] In some specific embodiments, the effector protein is selected from one or more of virulence factors or reporter proteins derived from the Xenorhabdus khoisanae MCB strain itself, cellular or bacterial virulence proteins, signaling pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens, and pharmaceutically active proteins; in some exemplary embodiments, the effector protein is TcsT protein, BlaM, Cre, and RluC, etc. Specifically, the TcsT protein is encoded by the nucleotide sequence shown in SEQ ID NO:48.

[0133] In some optional embodiments, the method further comprises the step of isolating the protein from the cultured recombinant host cells.

[0134] In some other optional embodiments, the method further comprises the steps of purifying the separated protein and removing endotoxin.

[0135] <Pharmaceutical composition, kit, use and method>

[0136] According to some embodiments of the present disclosure, there is provided a pharmaceutical composition, which contains the protein delivery system according to the present disclosure and, optionally, a pharmaceutically acceptable carrier or excipient.

[0137] The term "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic or other untoward reactions when appropriately administered to animals or humans.

[0138] Illustratively, some substances that can serve as pharmaceutically acceptable carriers or their components are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers, such as wetting agents, such as sodium lauryl sulfate; colorants; flavorings; tableting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solutions and phosphate buffers, etc.

[0139] In some embodiments, the composition of the present disclosure can be prepared into various dosage forms as needed, and the physician can determine the dosage that is beneficial to the patient based on factors such as patient type, age, weight, general disease condition, and administration method. The administration method can be injection or other treatment methods.

[0140] According to some embodiments of the present disclosure, a kit for delivering an effector protein is provided, which contains the protein delivery system according to the present disclosure, or the pharmaceutical composition as described above.

[0141] In some specific embodiments, the effector protein is selected from one or more of virulence factors or reporter proteins derived from the Xenorhabduskhoisanae MCB strain itself, cellular or bacterial virulence proteins, signaling pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens, and pharmaceutically active proteins; in some exemplary embodiments, the effector protein is TcsT protein, BlaM, Cre, and RluC, etc. Specifically, the TcsT protein is encoded by the nucleotide sequence shown in SEQ ID NO:48.

[0142] According to some embodiments of the present disclosure, the use of the above-mentioned protein delivery system in the preparation of drugs, reagents and / or kits for delivering biomacromolecules is provided. According to some embodiments of the present disclosure, the use of the above-mentioned protein delivery system for delivering biomacromolecules is provided. According to some embodiments of the present disclosure, the present disclosure also provides a method for delivering biomacromolecules to a subject / cell, which includes administering the above-mentioned protein delivery system loaded with biomacromolecules to the subject / cell. According to some embodiments of the present disclosure, the present disclosure also provides a method for preventing and / or treating a disease, which includes administering the above-mentioned protein delivery system to a subject, and the protein delivery system loads a therapeutically effective amount of biomacromolecules. The disease can be determined according to the function of the biomacromolecule used.

[0143] In some specific embodiments, the biomacromolecules include one or more of virulence factors or reporter proteins derived from the Xenorhabdus khoisanae MCB strain itself, cellular or bacterial virulence proteins, signal pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens, and pharmaceutically active proteins.

[0144] In some embodiments of the present specification, biological macromolecules, effector proteins, and target proteins have the same meaning.

[0145] Example

[0146] The embodiments of the present disclosure will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present disclosure and should not be considered to limit the scope of the present disclosure. If no specific conditions are specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0147] Example 1: Construction, assembly and purification of XkCIS complex

[0148] 1. Construction of bacterial expression system

[0149] 1. Construction of structural protein recombinant plasmid

[0150] The structural protein gene XkCIS is derived from the Xenorhabdus khoisanae MCB strain, and there are 16 genes in total, namely XkCis1, XkCis2, XkCis3, XkCis4, XkCis5, XkCis6, XkCis7, XkCis8, XkCis9, XkCis10, XkCis11, XkCis12, XkCis13, XkCis14, XkCis15, and XkCis16. The gene base sequences and the corresponding expressed protein sequences are shown in Table 1. The complete sequence of the Cis gene cluster is shown in the nucleotide sequence composed of the sequences shown in SEQ ID NO:47 and SEQ ID NO:57 in the order from the 5' end to the 3' end. The complete sequence of the gene cluster was constructed on the pRK404 plasmid (the pRK404 plasmid has been disclosed in the literature Jiang Feng, et al. Cryo-EM Structure and Assembly of an Extracellular Contractile Injection System. Cell, 2019. 177 (2): 370-383e15., which is incorporated into the present disclosure by reference) to obtain the recombinant plasmid pRK404-XkCIS ( Figure 1 ).

[0151] Table 1. XkCIS structural gene sequence

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161] 2. Construction of regulatory factors

[0162] The regulatory factor gene lysR is derived from the Xenorhabdus khoisanae MCB strain. The gene base sequence and the corresponding expression protein sequence are shown in Table 2. The complete sequence of Xk-LysR is shown in SEQ ID NO: 49. Through the BamHI / SalI restriction site, the complete sequence of Xk-LysR was connected to the pBR322 plasmid to obtain the recombinant plasmid pBR322-Xk-LysR ( Figure 2 ).

[0163] Table 2. Xk regulatory factor gene sequence and protein sequence

[0164]

[0165] 3. Construction of protein expression strain

[0166] The XkCIS structural gene recombinant plasmid pRK404-XkCIS constructed in the above steps and the recombinant plasmid pBR322-Xk-LysR containing the Xk regulatory factor Xk-lysR were transformed into Escherichia coli strain (DH10B, Thermo Fisher Scientific, EC0113) and screened in a dual-resistance solid LB medium supplemented with ampicillin and tetracycline.

[0167] 2. Protein Extraction and Purification

[0168] 1. Bacterial Culture and Collection

[0169] The constructed XkCIS expression strain was picked from the solid LB plate medium and cultured overnight at 37°C and 220 rpm in 3 ml triple-resistance liquid LB medium supplemented with ampicillin, tetracycline and gentamicin. Then, the strain was transferred to 200 ml triple-resistance liquid LB medium supplemented with ampicillin, tetracycline and gentamicin at a ratio of 1:100 and cultured at 30°C and 220 rpm for 24 hours.

[0170] After 24 hours of culture, transfer the bacterial suspension to a 500ml centrifuge bottle and centrifuge at 4℃, 12000×g for 10 minutes. After centrifugation, discard the supernatant, re-select the bacterial precipitate with 30ml PBS solution, transfer the resuspended liquid to a 50ml centrifuge tube, and centrifuge at 4℃, 3500×g for 30 minutes. After centrifugation, discard the supernatant and store the bacterial precipitate at -80℃ overnight.

[0171] 2. Bacterial disruption and removal of bacterial fragments

[0172] Prepare P buffer, the formula is shown in Table 3. Add 10 ml of pre-cooled P buffer to the bacterial precipitate collected from every 200 ml of bacterial liquid, and incubate in a 37°C water bath for 30 minutes to lyse the bacteria. Centrifuge at 4°C and 27,000 × g for 10 minutes to remove bacterial debris. Keep the supernatant for subsequent protein purification.

[0173] Table 3. P buffer recipe

[0174] Element concentration Tris 25mM NaCl 140mM KCl 3mM Lysozyme 200μg mL-1 DNaseI 50μg mL-1 Triton X-100 0.004％ MgCl2 5mM protease inhibitor(MCE) 1％

[0175] 3. Protein Purification

[0176] Collect the supernatant and centrifuge at 4°C, 15,000-25,000 × g for 60 minutes. After centrifugation, discard the supernatant and resuspend the precipitate with 1 ml of pre-cooled PBS. Transfer the resuspended solution to a 1.5 ml centrifuge tube and centrifuge at 4°C, 14,000 rpm for 10 minutes.

[0177] Collect the supernatant again and centrifuge at 4°C, 15000-25000×g for 60 minutes. After centrifugation, discard the supernatant and resuspend the precipitate with 200μl pre-cooled PBS. Transfer the resuspended solution to a 1.5ml centrifuge tube and centrifuge at 4°C, 14000rpm for 10 minutes.

[0178] The supernatant was collected, the protein concentration was determined, and the supernatant was stored at 4° C. At this time, the supernatant contained the XkCIS protein complex, which was the extracted protein solution.

[0179] 4. Removal of endotoxins

[0180] In the present disclosure, a commercial endotoxin removal reagent is used to remove endotoxin from the protein solution. The protein solution and the endotoxin removal reagent are pre-cooled, and 50 μl of the endotoxin removal reagent is added to 500 μl of the protein solution. After thorough mixing, the mixture is placed in an ice bath for 10 minutes, in a 65°C water bath for 20 minutes, and then centrifuged at room temperature and 14,000 rpm for 10 minutes to collect the supernatant.

[0181] 3. Results

[0182] Through this scheme, after the XkCIS structural gene and lysR gene are transferred into Escherichia coli, they can be expressed in bacteria and assembled into an XkCIS protein complex ( Figure 3 , Figure 4 ) and can be used for subsequent cell or animal experiments.

[0183] Example 2: Downstream effectors of the Xk gene cluster can be loaded into the Xk protein complex, and the N-terminus has a signal peptide function

[0184] 1. Construction of cargo loading plasmid

[0185] The XkCIS structural genes cluster in Xenorhabdus khoisanae MCB strain contains three effector proteins (XkCIS effectors, Xk1, Xk2 and Xk3) ( Figure 5 ), the base sequences of effector protein genes and the corresponding expressed protein sequences are shown in Table 4.

[0186] Table 4. Xk effector protein gene sequence and protein sequence

[0187]

[0188]

[0189] In order to verify whether the N-terminus of the effector protein in the XkCIS gene cluster (i.e., the Cis gene cluster) has a simple signal peptide that can guide the protein to be loaded into the Xk protein complex, taking the TcsT protein as an example, the N-terminal fragments of three effector proteins with different lengths were inserted into pBBRN through NdeI / BamHI double restriction digestion, and fused with the TcsT protein with a flag tag inserted through the BamHI / HindIII restriction site to express, and construct fusion proteins of different lengths to test whether the N-terminus of the effector protein can be used as a signal peptide. The 1-130 amino acid sequences of the N-terminal signal peptides of the three effector proteins Xk1, Xk2, and Xk3 are shown in Table 5, and their sequences are SEQ ID NOs 44, 45, and 46, respectively. SEQ ID NOs 44, 45, and 46 are selected, respectively. NO: 38, 39 or 40 No. 1-30 (respectively represented by Xk1N30-TcsT, Xk2N30-TcsT, Xk3N30-TcsT), 1-50 (respectively represented by Xk1N50-TcsT, Xk2N50-TcsT, Xk3N50-TcsT), 1-70 (respectively represented by Xk1N70-TcsT, Xk2N70-TcsT, Xk3N70-TcsT), 1-90 (respectively indicated as Xk1N90-TcsT, Xk2N90-TcsT, Xk3N90-TcsT), 1-110 (respectively indicated as Xk1N110-TcsT, Xk2N110-TcsT, Xk3N110-TcsT), 1-130 (respectively indicated as Xk1N130-TcsT, Xk2N130-TcsT, Xk3N130-TcsT) amino acids were fused and expressed with TcsT. At the same time, a TcsT without signal peptide was used as a negative control to test the guiding effect of the signal peptide on TcsT loading.

[0190] Table 5. Xk signal peptide gene sequence and protein sequence

[0191]

[0192] 2. Construction of protein expression strain

[0193] The obtained pBBRN plasmid was transferred into the Escherichia coli strain containing the XkCIS structural gene recombinant plasmid and the Xk-lysR recombinant plasmid, and screened in a triple-resistance solid LB medium supplemented with ampicillin, tetracycline and gentamicin.

[0194] 3. Protein Expression and Purification

[0195] The method is the same as that of Example 1.

[0196] IV. Results

[0197] The signal peptide sequence is derived from the N-terminal sequence of the XkCIS effector protein, including the N-terminal 1-130 amino acids, and the truncated sequence based on it. Figure 6 As shown, in the absence of a signal peptide, the TcsT protein could not be loaded into the Xk protein complex, whereas in the presence of Xk1, 2, and 3 signal peptides, the TcsT protein was loaded into the Xk protein complex. Figure 7 to Figure 9 It is shown that the different lengths of the N-termini of the effector proteins Xk1, Xk2, and Xk3 can all guide the loading of the TcsT protein into the Xk protein complex.

[0198] Example 3: Signal peptides guide the loading of different proteins into the Xk protein complex

[0199] In order to verify whether the N-terminal signal peptides of the Xk protein complex effector proteins Xk1, Xk2 and Xk3 can guide other different proteins to be loaded into the Xk protein complex, the inventors constructed Escherichia coli, in which the Xk protein complex structural gene, Xk-lysR, and the N-terminal 70 amino acids of Xk1, Xk2 and Xk3 (amino acids 1 to 70 of the sequences shown in SEQ ID NOs: 44 to 46, respectively) were co-expressed, and the fusion expression of BlaM, Cre, RluC with a FLAG tag at the C-terminus, and the GFP protein without a flag tag at the C-terminus were co-expressed. The specific method is as follows.

[0200] 1. Construction of recombinant plasmid and protein expression strain

[0201] The N-terminal 210bp base sequences of Xk1, Xk2 and Xk3 were respectively inserted into the NdeI / BamHI restriction site, and BlaM, Cre and RluC proteins were respectively inserted thereafter, and a FLAG tag was introduced at the C-terminus and connected to the pBBRN plasmid (the pBBRN plasmid is disclosed in the document Jiang et al., N-terminal signal peptides facilitate the engineering of PVC complex as a potent protein delivery system. Sci Adv. 2022Apr 29; 8(17): eabm2343, which is incorporated into the present disclosure by reference). The GFP protein was also inserted into the NdeI / BamHI restriction site, but there was no FLAG tag at the C-terminus.

[0202] The recombinant plasmid for expressing the structural gene and the recombinant plasmid for expressing the regulatory factor constructed above were co-transformed into Escherichia coli, and the protein expression strain was screened in a solid LB medium supplemented with corresponding double resistance.

[0203] 2. Protein Expression and Purification

[0204] The method is the same as that of Example 1.

[0205] 3. Results

[0206] like Fig.10 As shown, the three signal peptides can guide different proteins such as BlaM (the nucleotide sequences of the encoding genes are shown in SEQ ID NO: 54), Cre (the nucleotide sequences of the encoding genes are shown in SEQ ID NO: 55), GFP, and RluC (the nucleotide sequences of the encoding genes are shown in SEQ ID NO: 56) to be loaded into the XkCIS protein complex.

[0207] Through the above-mentioned technical scheme, the effector protein (including Xk's own virulence factors or reporter proteins, cellular or bacterial virulence proteins, signal pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens, pharmaceutically active proteins, etc.) fused with the expression signal peptide is loaded into the XkCIS protein complex under the guidance of the signal peptide.

[0208] Example 4: Modification of XkCIS13 to enable Xk protein complex to specifically target cells

[0209] In order to make the Xk protein complex specifically target cells to deliver proteins, the inventors replaced the recognition region of XkCIS13 with other recognition proteins ( Fig.11 ), and co-expressed the modified XkCIS13 and other Xk protein complex structural genes, as well as Xk-lysR and fusion expression TcsT with a signal peptide at the N-terminus and a flag tag at the C-terminus in Escherichia coli.

[0210] The specific method is as follows:

[0211] 1. Transformation of XkCIS13 structural gene plasmid construction

[0212] By homologous recombination, AD5RGDPK7, Ad5-knob ( Fig.11 The Ad5 knob domain in the protein, E01, CD4 (SEQ ID NOs: 50-53) and other sequences were connected to the 355th amino acid of Xk13 (i.e., XkCIS13) to replace the recognition region (Receptor binding domain) of Xk13, and the modified XkCis structural gene plasmid was constructed using the same method as in Example 1.

[0213] 2. Construction of protein expression strain

[0214] The modified XkCis structural gene plasmid was transferred into the Escherichia coli strain containing the recombinant plasmid of signal peptide-TcsT protein and the recombinant plasmid of Xk-lysR, and screened in a triple-resistance solid LB medium supplemented with ampicillin, tetracycline and gentamicin.

[0215] 3. Protein Expression and Purification

[0216] The method is the same as Example 1.

[0217] Some of the sequences used in this disclosure:

[0218] The complete sequence of the XkCIS gene cluster (Cis gene cluster) (the underlined part is the coding region, the nucleotides 1 to 7714 are shown in SEQ ID NO: 47, and the nucleotides 7715 to 19853 are shown in SEQ ID NO: 57):

[0219] ATTCCTGGATTGCGCCAAATTATGTCTTAAGAAATTTCTAACCCCCAATTATCACATCTACACCTCCCTATTATTTATCTATTAACAACTTTAACATTCGATCTTTTATTTAATCTTTATTTCACTATTAATATTTTACATTTTATCTATTAAATCATTTTTAACACGCATTAATTAAATGTCATTAAGCAATTCTTAAACAACTTCTTATTTTAAGAAAAATAA AATTGCATAAAAAGCAATTTGCATTATTGGCAATGTACTCATTATAAATTTTTCGGCACGATAAATATCGATATAAGCCTGATACAGCCACATACAATTTTTTCAGAGTGAAGTTTTTTTCAGAATGAAGTTTACTTTCATTTTGTGGCGGTAGCTTTATCTGAGCATATATTTTCTGCATCCTATTTAATCAATTACAACCATTTTTATTTAAAAAAGAGGCTACT A TGTCTACAAGCACATCTCAGATTGCTGTTGAATACCCTATTCCTTCTTATCGTTTCGTTGTTTCCGTCGGAGATGAA CATATTCCATTTAATAGTGTTTCAGGGCTGGATATTAATTATGAAACCATTGAATACCGTGATGGCGTGGGTAGTTG GTTTAAAATGCCGGGTCAGCGTCAGCCGATTAATATTACCCTGCGTAAAGGTGTTTTTTCCGGGCAAAACTGAATTAT TTGACTGGATTAATTCTATCCAACTTAATCAGGTTGAGAAAAAAGATATTTCCATTAGTTTAACCAATGACGCAGGC ACTGAATTATTAATGACCTGGAATGTTGCTAATGCTTTCCCTACCTCATTGACGTCTCCTTCCTTTGATGCCACCAG CAATGATATTGCCGTTCAGGAAATTACCCTGACAGCCGATCGCGTCACCATGCAGGCTGTTTGA GGCATTAATAGTTAATCATTTCGTATAAAGGATTTTTTT ATGACAACCGTTACCAGTTATCCTGGCGTTTATATTGAAGAATTAAATAGC CTGGCATTATCCGTATCAAATAGTGCCACCGCCGTTCCTGTTTTTGCAGTGAACAAAGAAAACAAACAGATTAATGA AGAGACTGCACACCGAATTAATTCCTGGATGGATTATCTTAATCTGGTAGGCAACTTTGACAATGAGGATAAATTGT CAGTTTCTCTGCGGGCTTATTTTACCAATGGCGGGGTTATTGTTATCCATCAAAACCCCAAATTTAGAAAAACTT ATTCCAACCTTAGATGATGTCACTTTGCTGGTTGCGGCAGGTGAAGATATTAAACAGCCGCGGCAACTTTATGTCA GCCGGGAAAAGGGTTATTTGCCATTTTTGATGGCCCTGAAGGAAGCGTTGACCATCGCGAATGCAGAAACAGTCAAGA ACAAATATGACGCCACCGCGTTCGCCGCAGTTTACTACCCGTGGCTGAAAACGGATTGGGCAAAAATCACCATTCCA CCGAGTGCGGTTATGGCAGGCGTTTACGCCTCCGTCGATCTCTCCCGTGGCGTGTGGAAAGCTCCCGCCAATATCGC ATTGAAAGGCGGACTGGAACCTGCATTTTTGATCACGGATGAAGTTCAGAGTGCATATAACTCCGGTCGTGCCATCA ATATGATTCGGAATTTCAGCAATACCGGTGCCACCGTTTGGGGAGCAAGGACGCTGGAAGATAATGACAACTGGCGC TATGTCCCTGTGCGTCGCTTATTCAATACCGTCGAGCGGGATGTTAAGCGCGCTATGAGCTTTGCCATGTTTGAACC TAACAGCCAACCAACGTGGGAACGTGTCAGGGCGGCAATCAGCAATTACCTTCATAGCCTGTGGCAACAAGGGGGAT TGGCTGGCAGCAAAGAAGATGCCTATTTCGTGCAGATTGGCAAAGGAATTACGATGACGCCAGACCAAATTAAT CAGGGACAAATGATAGTAAAAATCGGCCTGGCGGCCGTTCGACCGGCAGAATTTATCATCCTCCAGTTTACGCAAGA TGTAGAACAGCGTTAA TCACATTAATTGATGAGGAATTATC ATGCCAGCTAATCTAAAAACGCCCGGCGTTTATATT GAAGAAGATGCTTCCCTTGCATTATCGGTCAGCAACAGTCCCACTGCCGTGCCTGTTTTTTATTGGTAAGTTCACCCC AAAAACTGCGGAGCCAACCCAAACCTGTATTCGTATCAGCAATTGGCTTGAATTTACTTCCTCTTTTTCTTTGGCAC CAGTGACAGAAATTGTCATCCGCTCTAGTCTTGAAGCCTCTTCTGATGGCGCAACAAAAAAAGAACAGGCCAAAAAA GAAAAAGTCGAAAATAAAGAGACTGCAACCCAAGAAACTCCCAAAGTTCAAACTCTCTCGGCAGCCGAAGAAGAACC CAAAAAATGGATTCACAATATTGAGAGAGTCAATCTATCTCAAGCCGTAGAAGCCTTGAAGCTCTATTTTCAAAATG GAGGCGGGGCTTGTTATATCTACCCATTAAACAATATTAATGGCGAGTCGGCTCTGGACCCCATTCCTAAGGTGATA GAACAAAAAGGGGATATCACTCTGTTGGTTTGTCCAGAAGAAGATCAGGGTTATAAAAACAGAGTCTACAGTGCAGT CAGCCCCCTATTGAATAGTGATAACAAAAAAGTGGGCTATTTCCTGATTGCAGATAGCCTTGATGGTAAATCGGTGT CTGGCATGGCAAATAGCACCAAGATCGCCGCCTATTATCCTCAGTTGGAAACAAACCTGAAATTCTCCACCTTGCCC GACGATCAGAACATTGTTATCAGTGGTTATGAGAACGCATCAGGCAAGGACAAGCTGAAAACTCTGGATAAACTTAG GGAAACAGATAAAGCGCTGGCACAAGAAATTGATATCAGATTGCAAGAAATACAACAAGATAATCTCACCCTTTCAC CCAGTGCTGCCATCGCAGGAATTTATTGCCAAACTGATAGCCAGCGTGGCGTCTGGAAAGCTCCCGCCAACGTTGCA CTCAGCGGAATCAAAGGTCTGACTGATAAAGTCGATGACGAACGGCAAGGCACCATGAATGAGAATGGCATCAATGT CATCCGTTCATTTACCGGCCGTGGCTTGATGGTTTGGGGGGCGCGTACTTATGCTCAGAACGGTGAGATCAACTGGC GTTACATTCCTGTCCGTCGCCTGTTCAATTCCGTTGAACGTGATATCCGTCAGGCACTGCGTGCCGTGTTATTTGAA ACCAATAATCAACCGACATGGATGCGCGCCAAGGCTGCCGTTGACCAATATCTTTATGCCCTCTGGCAAAAAAATGC CCTGATGGGGAACAGCCCGGAAGAGGCTTATTTTGTCCATATCGGTCAGGATATCACCATGTCTGATGCAGATATCA AACAAGGCAAAATGATCATGAAAGTAGGTCTGGCCGCAGTGCGACCGGCTGAATTTATCGTCCTGCAATTTACGCAG GATGTCGCTCAGTAA TCTCCGTGATTAAACACCGGGCACTGTATTAACAGTGCCTATCTCACCCAATTAAAGGAGATGATG ATGGAAAGAATTCAACCGGGCGTGACCTTGACAGAAAGTATAATTACCACAGGCCAGCAAGAGATACCCAGCG CAGTGCCGGTATTTATTGGCTATACCGTCCGCAATCAACAACAAGCAAAAACCGCAGTTCGTATCGACAATCTGGCG GAATATACCCAGCGATTTGGCGACGATCATCTGATGGCATTGGCGGTAAGGCACTATTTCGATAATGGCGGACAACG GGCTTTTGTTTTGCCACTGTCAGGAAATATGCCCTCAGCAAACATGACCCAAGCGGAAGCCGAAGCACTGATGGCGG CATTAAGCTCTGACATGGTGCAAGAAGCCATTGGTGGGGAAACGCAGATCACCCTGATTTTGGCACCGGATATCGCC CGACTGAATGACAATGTGACTGATGAGCAACAAACTTTAGTCAATTTGTGGTCACAGGGTTGGAGTACACTGCTGCA ACTAAGCCAGATCCGCACGAATCTCTTTGTGCTGCTGGATGCGCCGGATGAGGTTGAACAGGCACGGCAATGTCTGG AAGGACTCTCGTCAGAGTATCGCCAATGGGGAGCCGCTTATTGGCCTCGTCTGGAACCACTTATCAGGCTACATCC AGTTCCAAAAATTATGCTCTCCCCCACTGCCGCTATCGCAGCACTTATCCAACACACGGATAGCGAAGTTGGTGT ATGGAAAGCGCCAGCCAATATTGCCCTGTCTCAGGTTATCGGCCGGTTAAGTCGTATCTTCAAGGGAGTGTACTGT TTGACACCAATGGCACTTCGCTCAATGTGATCCGCACTTTCCCCGGCAAAGGCATACGCGTATGGGGATGCCGCACA CTGGAAAACACAGATAACACGCAGTGGCGTTACCTACAAACACGACGTCTGGTTTCTTATGTCACCGTACATTTGGC GCAATTAGCCCGTATGTACATCTTTGAACCTAATAACGAACTGACGTGGATGAAATGCAAGGGACAAAGTTACAACT GGCTACGGCAACTGTGGTTACAGGGTGGCTTGTACGGCTCACGGGAAGATGAGGCATTTACTGTGCTGTTAGGCGTC AATGAAACGATGACCGAAGAGGATATTCGTGCCGGGAAAATGATAATGAAAGTCGCCTTAGCCGTATTGTCTCCCGC GGAATTTATCGAGATCAGTTTGGTATTTGATACCCAAACGGGCGCGCTTTTGTCTTAA AAAGGAAAGAGCACA ATGA ACGATTATTACACCCCCGTGGTATCCCACCGTTTTATGGCGAGCTTTATTTTTAATGGCATTCCTGATCCACTGGAT ATCCGTTTTCAACGTATTTCCGGCCTGAACCGGGGAACTTCAGGTCACCCAGCACAGCCAAGGCGGTGAAAACGCCCG CAATAACTATCTGGCTGAAAAAATCCAACACGGCACATTAACGCTGGAGCGCGGTGTGATGACGGTTTCTCCTTTGA CCTGGATGTTTGACCGTGTATTGCGTGGAGAAATATCGCCTATGCGGATGTGGTGATTATGCTGTTAAACGAAAAT TCGCTGCCCTTGTCCAGTTGGACGCTGAGCAATGCCTTACCGGTACGCTGGCAGACCAGCGATTTTGACGCGAACAG TAATGCCATTCTGGTGAATACCCTTGAATTGCGTTATCAGGATATGTGCTGGCTGGGAGTCAAAGTATGACCGTCGA AATCAGAGAATTAATTATTCAGGCAAAAGTGGTTTCATCATCACCAATACTCCCAACACAAGCAACTGAATCACATC AACAAAGCCATTCTTTGATTCAGGAAAGTCTGGATGAGGCAGCTTTAGTTGAAAAAATTAAACGCGAAGTGCTGGCT GCATTACGCGATGAGGAAGGATGGCGCCCATGAGTTTAATTGAACGTGGTTTAGCGAAGCTGACGATTAACGCTTAT AAAGACAGGGAAGGAAAAATACGGGCTGGCACCATTCAGGCCATGTATAACCCTGATTCCCTGCAACTGGATTACCA AACGGATTACCAACAATCCCAGGCAATTAATAGCGAAAAGCAGAGCAGCATTTATGTACAGGCCAAGCCTGCCGGGT TATCCCTTGAGCTGATTTTTGACGCCACAATGCCGGGCAACAAAACCCCTGTTGAAGCTCAGTTAATGCAGCTCAAG CAGTTGTGCAGCGTGGATGCCACCAGTAACGAAACGCGGTTCCTGCAAATCAAATGGGGAAAAATGCGTTGGGAAAA CCGCGGCTATTTTGCTGGCAGGGCGAAAGGTTTGTCTGTGAATTACACCTTGTTTGATCGTGATGCCACGCCATTGC GGGCGCGGGTCATCCTGACATTGGTGGCGGATGAAAGTCTGGTCTTACAGGAGACAGAGCAAAACCTGAAATCGCCG GCGAAAATTGCCTTACGGGTACAGGATGGTGTTTCGCTGGCCCTGATGGCGGCAAGCACCGCATCAACGCTGTCTGG TGGTGTTGATTACCTGACGCTGGCCTGGCAAAACGGTCTGGATAATCTTAACGGATTTGTACCGGGTGAGATATTGC AGGCCACCAGAGGAGATGCCTGATGAGCCATCAACTGAAAATCATTGCCGATGGCAAGGCACTGTCTTTGCTGGCCG CCGTTGATGTCGATACTTACTGCCGCGTTAACAGCATCCCTTCCGCAACGCTGAAACTCAGCCTGCCGGACAGCCCT CTTTCCTCTTTCAGCCAAACGGATGTACAGGCAGAACTGGCCCATTGTCAGGCAGGGAAAACCCTGCGTCTGGAATT GACTGACAGCGGCAGAAAATCAGTGCTGTTTAACGGCCTGATTACCCGTAACTCTTTGAAGATAAAAAACAAGCAAT TATTGCTTACTTTGGTTGTCCGACATCGGTTGCAACTGATGGCAGATACTCAGCACTCACAACTGTTTAAGGCCAGT AATGAAAAAACCATTCTGAACACCTTATTGAATCAGGCGGGTATCAAGGCTCGTTTTGAGCGGATAGACGCACTGGA TCAAAAACATGAACAGATGGTGCAATTTCGCTGTTCAGACTGGCGTTTTCTGTTGTGCCGACTATCGGCAACCGGCG TATGGCTGTTACCCACGACAGAAGGTGCTCAGCTTGTCCAGCCTAACACCCTGAAATCCAACCCAACCCATACCCTG AAAAGCCGGGGAGATGAGAAAAAAGATATCATCGTCAAGGATGCCAACTGGCAGTTTGATAACCATCTTAACCCTGC TTCGCTGGAAGTCAGCGGCTGGGATATCAGTAAACAGCAAGAATTATCAGGTGGTCGCCACGGCAGTGTTGCCATGG GCAAAGCCGCACTTTCTCCTGACAGGCTGGCGTCTTTAAATAAAACAAGCTGGGACATTCGCTACAGCAGCCCGTTA ACCACCCAAGAGAGTGGCTATCTGGCACAGGGACTGTTGTTGAATCAGCGCATTTCTGGTGTTACAGGCGAATTCCT GCTTAAAGGTGATGGACGTTATCAGTTAGGGGACAACATTCAATTAACGGGATTTGGTTCACAGCTGGATGGAACAG CAAGCATTACTGCGGTTCGCCATCGTTTTAACCGGCGAATTGATTGGGAAACCACTTTAAGCATTGGCTTACCACAG GAATATCTGCCGATGCTACCCGATGCCACCGGACTCCATATTGCGACAGTCGCGAAGTATCAGCAGGACAAGGCAGC CCTGAACCGCATTCCGATTATTCTGCCGGTACTGAATCGTCCGAATGAATTCTTGTGGGCCAGATTAGGGAAACCTT ACGCCAGCCACGAAAGTGGTTTCTGTTTTTACCCAGAACCCGGTGACGAAGTGATTGTCGGCTTTTTTGAAAATGAT CCTCGTTATCCGGTGATTCTGGGGGCAATGCACAACCCGAAAAATAAAGCGCCTTTAGAACCCACCCAGGATAATCA GGAAAAAGTCTTGGTGGTGAAAAAAGGAGAAATCCAACAACAAATCATGATTAATCGCAAAGAGAAAACTATTCAAA TGAGTGCAGGAGAAAACCAGATAATGCTCCAGCAGGATAAAGATATTTCGCTGTCAACGAAAAAAGAATTAACACTG AAAGCGCAGACCATGAATGCCGAAATGGAGAAATCACTCAATATTTCTGGCAAAAACAGTGTTGAGATCAAAGGCAG CAAAATTAATCTTACCCAATGA AREA ATGGAAAACCAAATACTGACACAGCTTTATGGTCGTGGCTGGGCT TTTCCTCCCGTCTTTTCCCTTGAAAAGGGGGTGGAAATGGCTGAGGGGACAGAAGATGTGCGCCAAAGTTTGCATAT TCTGTTCAGTACTGAGCCGGGGGAACGCCTGATGCGCGAAAATTACGGCTGTGGATTAAATGATTTTATGTTTGAAA ATATCCGCAACGAACTGTTTGCTGAAATTGAATCCCATATCCATGACAGCGTATTACGTTATGAATCACGGGCAGAT ATTACCGATATCCAAGTTCGTCAGTCGCCAAATAGCAAAAATACCTTGCAAGTGCAGGTGATGTATCGCCTGCGGGG CAGCGATATCAATCAGCAAATTCAAGGAACACTGGCGCTGGGTGAAGGCCAGGGAATGGAGGTGGTATGAGTGAACC CATTGTAACTGACGGCGACACATTACAGTTTGAGCCCCAATTTGAGAGTCGAAAGGTGAACATTCCCGGATTGATTA AAAATCAATGGAACAGGTCATGCACAGGTCAACGGCAAAAAAGTTTGCATTTTGGGAGACGAGAAACGGGTTACTGTT TCTGCAACTTATACCACAACAACTCATATGACACCGGGAACTGGCACCATTACTATCACGGCGTTAGATAGCAGCCA GCAAGCCCTTCAATGTACCAGTGATGCTGCTTTAATTATCAAAGGGAAAAAATTTACGGCCATATTTACGCCTCAAT CACCAGCCATAAATGGTAATGTGAATCCACCTCAACCTGATCCTAATTACCCAAGCCCTTCATCAGGCAAAGGCAGT TTTATCACCCAACAAAACTTTGCCACTGTGAATTAAGGCATTGGCTGAATTAAATAGAAATTAAAGGGTGTGAATAA GTATTTATTCACAGAGGAATCGCTGTGCCACACAGGTGATATTATGGAATTAACTGAGTTAAATAAAAAATTGTCAG ATTTGGTGCCGATGAGCGATTTTAAATTAGATAGCCGAACCAGTTTGCAATTACTCCAATATATTGAGGAGTACACT AAAATAATTCCCTTTAATCAAACCGATAAGCATTGGAATGATTTTTTCTTTAAGAAAGATAGTACGCCAGAGAAACT GGCCGAATTATATCAAGGGAAAATCGAAGCCAATGGGAATTTATTACCTCATCAAGCTTTTCTACTAGCGGTATTAC GATTACTGGAAACACCAATATCCTTATTGAATACCTTACCGGCGGCGCATCGCAATCTCTATTATCGGGCGCTTTTG GGGCTATCTCCCCGTCCGGCTCGACCTGATCAAGTTGCCTTATCTGTAGAACTGAATACCACAGTCACAGAACAACT ACTCACTAAAGGCACTTTATTTGAAGCAGGGCAAGATGAACACGGCAATGCCTTGCAATATGCGCTGGATACCAGTT TGCTGGCAAACCGTGGCTATATTAGTGAATTGCGCTGGCTCCGTAAAAAAGAACAACAGCAATGGATCACCGCGACT CCCTGGAATTCACAGGCACAATTATCATTGCCATCTGGTGGAATACGGTTATTCAGTGAAACTGATTTGGATAAATC GGTACTGGGCGGGATGTTGATCACTTCCAAACATCTGGCGATGGAAGAAGGAGCAAGAGAGATAACGATTACCTTTG ATAAGGACATGGATAGCCAGAATTTGGTGGCACAAATCAGAAGTGGTAATCAATGGCTAACTTTACAAGTTGAGAAA AATACAGCTGAGAGAAATAAAAAAGAAGTCATAATGATGCTGGCAGATAAAGAGCCAGCAACCCGTGCACCAGAGGA TCTGGATAACCTGATTTTCAGTGAGCCAGTACTCAGGCTACAGGGAAAAAACAGCCAACCACTGCCTACAGTCACCG CACTAAAGGTGCAAAAAACAACTATAGATAAAGCTTCATTCAAGACATTTCACTTAACCCCCTTTGGTTATAGCCCT GAAATTGAACCATTGGAAGAAAACCCCGCATTATACCTTGGTATCACTGACGTCAAGCCGGGACAAACCCTATCGCT GTATTGGAAATTAAAATCGCCACAGCAACCCGAAAACGTTTTCTGGTATTACCTGAATAATAAGAATCAATGGGTTG CATTAGATGCGTGGGTCAAAGATGAAACCAAATATCTGTATCAAGATGGCATCTGGCAAGTTGTATTGCCTGCGGAT GCTTCTGCTTCTGCTGAAGAAATTACCCGGATGCCAACAGGGCGCTATTGGTTAAAGGCAGTCATGGTTATCCCCAC ACACAAAGGTTCATGGGGAAAAACTCCTTGGTTAGACGGCTTGATCTATAACGCCATGACAGCGACATTAACGAATG CCGATAGCATCAGCAACAGCCATTTCTTGACGCCATTACCGGCAGACACTATTCAACGTCCCGTTGAGCCTATCATG GAGGTGGCTTCGATCAGTCAGCCTTGGCCGTCGTGGAATGGGCGTGTACCGGAATCCTACAGCGCTTTTTTTGCACG GGGAGCTCAACATCTGTCCCACCGTAACCGCGCCTTAACCTGGGGCAATATGGCGACACTGTTAAAAGAGCGTTATG TCAGCATTTTTGATGTTAAGTACCCCGGCCATGATGAACTCACGCGAGTCCCCGCACTGGAGAAACAGCAACTGACC ATCATTCCGGCTAACCAATACAACGACAGCGATGATCCTTTGCGTCCGGTGTTAAACCCTGCCCGCCTGCAAGGAAT GGCCGAATGGTTACAGCAAAAAGGCTCTCCATGGGCTGAGATTGAGATCAGCAATCCTCAATACATTGATGTAAAAA TCAATTACAACGTGATTTTTAAGCCGGATGTTAACGAAGATTTTGGTTATCGCCAGCTACGACAGCAACTCAGCGAG ACATATATGCCCTGGAGCGTCGATGAGAAACGCCCCGTCACGCTGAATAACAGCATTAGTTATTACCAATTACTGGC AACTATCCAACAGCAGCCGCTGGTTGAGCGGGTCACTTGTCTGACGCTGCGTCGGTCGGAAGCGGCTAAAGACAGTG ATATCACCGCATCAGTGGAAGCCAAAGATAATGAAGTGCTGATTTTGGTCTGGGAAGCAGATGACAAGCTGCAATGC CGAGGAAATAACTATGAGTAATCAAGATGCACTATTTCACAGTGTGAAAGACGATATTCACTTTGATACCTTGCTGG AACAGGCTCATCAGGTGGTTGAGCAACAGGCAGGAAAATTGTGGAGCGACACAGCGGAACACGATCCCGGTATCACC TTTCTGGAAGGACTCAGTTACGGTGTGTCAGATTTAGCTTACCGTCATACTCTTCCTCCGACAGACTTACTGACCCC TGCCCCTAATGAGCAGAAACAGCAAGATGGAATTTTTCCCGCTGAATTTGGCCCCCACAATACACTGACTTGTGGGC CAATCACCACTGATGATTATCGGAAGGCATTACTTGATCTGCATAGCAGTGACTGGACAGGAGCAAAGCCAGAGTCA GAACAGGACAAAGGGGATTTTCTGTTCCGTAACGTGCAACTGGTACGTGAACCGGAAACACAACGCTATACCTATTG GTATGATGCCACCAAAAGGGAATATAGCTTTGTCGAGCGTAAAGATGCGAAAAAGTTTACCCTGCGGGGAAATTATT GGCTTTATCTGGAACCGACCCGTCGTACTCAGGAGAATTTGGATAATGCTACCCAACAATTAATCGATTTTTTGACT CAAAACCGCAATATTGGTGAATTGGTCAGTCAGAGAATCTGGACAAAACCGGTTGATTTTCCGCTATTACTGGATAT TGAACTGGATGACGATGTGCAAAATGTCGCTGGTATTTTTGCTGCCGTCTATAGCACAGCAGAACAGTATCTGATGC CTGAGGCGCAGCGTTTCAGTACCGAAACACTACAAGATGCGGAAATGCGTAATGATGAAATCTTTGAAGGACCACGA TTAGAACATGGCTGGATCCCTGAATTGCCGACAGCCCGTGATTATACCAAACGGCTCAAGCTCAATCTTAGCCGGCT GGTCAATAAGCTGCTTGAGATTAAGGGAATACAGAATGTAAATCGTCTTCGACTGAATGAAAATTTTGATAAGACCC TGATTGAGCCGATTAAAGGGGATAGCTGGTCATGGTCAATAAAAGAAGGCTACTACCCTCGTTTGTGGGGTAAAGAT CCGATTCATCAATTGGCACAACATGATGGCCCACTGAGGGTGATCGCCAAAGGTGGGATCAGCGTTACGGTTGATGA AAACAGCATTCGAAAAAGTTTATCCTTATCCCATCCTCCTCTTATTCAGAATAAACCTGTGCTATTGGCTTATGGTC GGCATCGCGATGTGGGTCGCTATTACCCCGTCAGCGATACGTTGCCCGCTTGCTACAAATTACAGCAGCCTTTATCT GAAAGTGAACATGCGCAACGCCTGTTATCACTTCATCAATTTATGCTGCCATTTGAACAATTGTTGGCTTGCGGCTG CCAGCAAATTGCCATGCTGCCAAAATTGTTGGCTTTTAAGCGTGAGGGATATGAAGTTTGGGGTGATCAATGGCCAT TTAAGCCGGGTTCTGTCAATGATGATGCCCACCAAAATTACGCTTACGAATTAAAGAAAGTACTAAAAGAGATTGCA CACGATAACGATCACGAATTGGATATTGTCAATTATCTGCTCGGATACTTTGGCACTCAGCGAGCACCACGTACCTT TACCACCAACATCAGTGATTTTCGTGCCGTGCAACAAGGCTATCTGGCTCAACAACCGACATTAACTTATCACCGAG CCAATATTCGGATCGATCAAGTTTCGTCGCTACAAAAGCGCATTGCTGCCCGTATGGGGTTAGGGGGTGAATTATTT AAACCAAAGCCTGACTTGAGCAAACTGCCTTTTTATCTGGTAGAACATCGGGCATTGCTGCCAGTCAAACCCAACAG CCAGTTTGATGAAGAGCAGAAGCCAGATTCGGTGACAGAAGAAAGGAACTATCAAAATGATCAATATTACTTGGTGA TTAAGCAAGCCGGTATTGATGGAAAACTGATACAGGGACAGGTAATTGATTTAGTTCTCTATGAAGGAGAACAGAAC GAAAACCGATTTACCGTGCGTGGTCAAATGATCACTAAAACCACAGGAGATCAGTTTTGGCTGGACGTGAGCAACAG TACTCAACTGGAATACAATCTGGAACGGGTAATGACCGCCGCCAAAGGGAAAAAACTCGTCTGGCAAAATAGCCCGG TATGGATGGAAGATATGAACTACCGGCTGGCCTATGATAGTGATCAATCCTCATTGCCTGAAAACCAGCGGCGCCTG ACCCGCACAGCACAAACCCCCTTCCCGGCCCTGATTGCCGCAGGTAATGAAATTACCCTGACAAAACAGTTGGGGGG AGTGGGTTTGGAGCAAGAATCTTCTAATGAATCAGAAAAATTATATGCAAAAGTTGTCAGCTTTGATCGCATCAAGG GAACTTTGATTATTGAGCGTCAGAAACATTCTACACTGGCATTCCCTGCCGCAGAAGAAGCCTGGCGGCACAGTTGG CATTTTTCGGGTAAGGAATATGAAAATACGGACCGTTTCTCATTTGTGATTAGCGTGGTGGTAAATAGTGATTTAAT TAAATCACGTGAGCTCAAAGTTGATCCATATCAATTGGAAGAGTGGGTTAAGGAAACTATTCTCACCGAATTCCCTG CCCATATTTCCATGATTATTCACTGGATGGATCGGGAGCCATTTTTAAACTTCGGCAATACGTATCAACGTTGGCAA AATAATGGCGCACCATTAGGGGATGCCGCTTATTCGATTCTGGAAAGTTTGACGCTGGGTAAATTACCTTCCGCTTT CAAAGGAATTGGGTCAATGCGTATTGCCACACCACATCAGAGAGAGGAAGTTGTTGGTAAGAATGGTGAACAATGGA ATACCAATAGAATAAAACAAAACGAATTATTCTATATTCCGAAAGAGAAAGAATAA AAAACAATTAGCGACTAACCAACATTTTAAATTAAAAATATTTTATGGAGTTAACA ATGAAAGAAATTCGTTATTCTGCAAAAATACAAGAACAACAA ACATTATCTGACGCAAAAGGTGTTGGACCTGATATTGATAAATTAAAAGATAAGTTTAAAGAAGGCAGTATTCCCTT ACAAACCGATTTCAATCAATTAATTGATATTGCCGATATTGGGCGTAAAGCGACTGGACAGGCTCCCAATCAAAATG GCCCGGCAAAAGGAATGCGTTTGGGCGAAGATGGGCTTTTACAGTTAAAGTTAGATGAGAAATACGCTCATGCAAAT TACAGTCCATTAAGATTGCATGATGATGCATTGGTTGTAGGAGTAGGCAATGGTTTGATAAATTTTAAAAAATCAAA TGAAATAGGTGTTAATGATGGAAATGGTATTAGGATAGATGATAATAAGGTTGCAGTAGAACTGGCTGATAATAAAG GTTTGGTTGTTGATAGCAATGGTATCGCCATAAAACCAGGCAATGGGGTGAAGTTTAGTTCAGATGGTGCATTAACA GTAAATTCGGCTGATTCAACTATTAAAGTTGATGGCTCAGGAATAAAAGTTGCTACAGGTTGGGGAGTTAAAGTTGG TGGTGAAGGTTTGGATGTAAATGTCCGCACGGATGGTGGTATTGGTAATGATTCGTCAGGTATTTATGTTAAAACAG GTAATGGTATTAAGTTAGAATGATCAAGTTGCAGTAGACTAGCTGATAATAAAGGTTTAGTTGTTGATAGTAAT GGTATCGCCATAAAACCCGGCGATGGAATGCAATTTAGTTCAGATGGTGCATTACAGTTAAAATTAAATAAGAATTA TGCCGATAGATTTTATAGCCCTTTAATATTGCGTAATGATGTATTGGCTGTAGGTATAAGCCATGGTTTGACAACTT ATCAAGGATCATATGCAATAGGTGTTAATCCAGGAAATGGTCTTAGGATAAATGACGATAGTGTTGCAGTGAAACTA GCTGATAATAAAGGCTTGGTTGTTGATAGCAATGGTATCTCCATAAAACCAGGCAATGGAATTAAGGTAGATGCTGA TGGTGTGGCTATCGATCCTAATACTGTATTGCCACGTGGTATGATTATGATGTTTTCTGGTAATAGCGTACCAGAAG GTTGGGCTATTTGTGATGGCTATAATAATACACCAGATTTTCTAATAGATCTATTGAGGGAAATACTAGGAATATT AAAGTAAATTGGTATAGATATGACTATACAATATACTGCAATATATATCATGAAATTATAA TTAACATTAAACATGGCAATGAGCGTTTTAAAATACGCTCATTGACCAATTTTTGGCAAGGTGGAATTTGCGGGTTTT ATGATGACCAACA CTGATAAATATGGTGTTAATCTTATTAATAGAATAACTATCTCCATTGATATGTTATATTTTAACGATGATAACATA ATGGAGAACTGCTCATCTATATTTAATAGAAAACTAAAAAATATCATCAATAAAAATATCAAAAACCTGACATTGAA TGTAAATGGGAAGTTATCTCTTGAAAGGGTAACTCTGGATCTGGGAAATATTGAAATTGATTTATTTGAAAGGGAAA TAACAAGAAGATTGGAAATAGAATTAAAAGAACTTAAGAAATCATTATGGTTACTCTCAATGTATTTTAAATAAA GAGAAAATATATCCACACCAATCAGAAAGAAGAAAATAGATTTTTATTAATAAGAAGAATAGATCATTACTTACATAA GGGAAACTGGTTATCTGATCACAGAAAGCATCATATTACAAATACTGTGCATATTAATAATGAATTATGGCAACAGA TTAACCACCAGCCACAACAATGGCTACCTATGTTAGCCAAACACTGCTTACAGCCTGCGGGGCTAAGTCGCTTAATT CAACTCTGCCAGCCAGACGTTCTTGCTATGCTTTGCCAGTTATTTACTGAAACAACAACATCCGAATTTGTTAATTC GCAAGCGCAGGTAATTACAGATAAAAAAGTGAAACCAGAAAAATTGAGTTTGGCTGCGGAATATTATCTGCAACATC AGGTGAAATATCCCCATGCCACACAACAAGCACTTGCACAACAAACTCAAAATAAGCAAACACCGACAATAAATATT ATTCAGAATAATAACAGTCTATTAAAACAGACTTACAATGAAACTGATATGCAGATGGATACAGTACTGCCATTTGC AACATACCATCAGCCAACAGCTACGCAACAGCATTATGGTCTTATAAAAGAGGCGGTAAAACAAAGTCTTCCAACTT TACAAAACAGAGAGCAACATAAGGAATTACCGAGATCAACTTCACCAGCGAAAATATCATCCATACAACCCAGTAAT GGAATTCAGACTCCATCATCACAATCCGTTTTAACCATCAGCAATGCCGGTTGCATGATTTTATGGCCGTTATTGCC CATATTTTTCCGTACCTTTGATTTACTGGAAAAGAATCAATTTATCAGCCTTGAAGCACAAAGAGAGGCGGTCTGTT TACTTGATTGGCTGATTTGGGAAGAAGAGGAAATACCTGCATGGCGATTGACTCTCAATAAAATACTTTGTGGATTA CCCATACATGACAACGCGCGATGGCGTACCCCAAAGCCAGAACAACAAATTGCCATCAACCAATGGCTGGAAAAAAT CATCGAACAACTTCCAGCCTGGAAAAAAATGGGAATAAACGATGTGCGACACTTATTTCTGCAACGTTCCGGGGAAT TAAGTGAGTTAAATGGAATAAAAAACATCCATATTAAACCCGAAGTTTATGATGCACTGATAAGCGAATGGGCGTGG CCAATGAATATCGCGAGCTTTAGCTGGTTGCAACACCCTATCACCATAACGTGGTCATAA CCATCAAACACAGTAAATTAGTCTGAGTAAAAATTT ATGAATACAGCGCCTGTTTTCCCTGATTTATTTCAGCAACATAATGATCCTCATTTAA TGTTCTTATATAGCCAACTGGAACGCATCGATCTCGTTCTGCAATACCATTTCCATTGCATATCAGGCCAGAAAGGT GACCTCCTTGATGAGTTCTTGTTAAGCGAAGAAGATGTGATAAACAGACTGGATAACCCTCTGGGAAAACCTCATTG GCTCACCGATGATTGCCTGACAATACCGCACACCGTCACGCCCGTGGCATCCCGATTAACTGACCTGATTACACATT TTGAACTGACTGATTTTGAAAGGGATGTTTTGTTGTTAGGTTTACTGCCCCATTTCGATAACCGCTACTATCACCTG TTTGCTCTGGTTCAGGGAGAACAACAATCTCGGCTGCCCGCTTTTGCGTTGGCTTTGGAACTGTTTTGCCACTCAAT GCTGGAAAAACAGGCACAGCAGGCCAGTTTTTTACACCAGGCTCCCTTGGTTGGCTGCCAACTGTTATCTATTGATA GTCGTCAGAAAACGTTATCCTGGCTCCAGACACCCTTTATCACAGACAGCAGCGTATATCATTTTTTACTTGGGCAT CACTATATTGCACCTGCTCTGGAACATTGTGTTGAGTGGATAACGCCCACAGAAATCGGCAATTATCCAGCAGGATT AAAACAAGCGTTGGGTAATGTACTGTTATCTGATCATGATGATATCCGGCCCGTTATCTTACTGCGGGGCATGGCCG ATAGTGCCAGATCCCATGTCGTTGCTAATATGATGGCATCAGAACAACGGCAAACGCTGCTTGTGGATATCGCCAGC TTAGCTGATAACGATGACAACTCCCTGTTTTGCCATATAAAAGCCATTTTGCGAGAAATTCGTATGCGTGGTGCCTG TTTATTGTTACGAAACTTTTGCTTATTTGCAGAACAGAATAAACACTTGCTGGATCCCCTGTCAGCCTTATTAAACC AATCTGAATTAAGGGTTATCTGTCTGGTTGAACCACACTCACCGTTAGTATGGCTGAAAAAGATATCGACATACTG ATCGAAATGCCCGCTTTCACTTCGGTGGAAAAAAGCAAGATTATTGACGGCCCATTTACCCAATCACTGTGCAAATGA TATAGATGCAATAACCTTAAGCCAACGTTACGCATTTAATCCTGAAACCCTGCCATTAATTTTACAAGAGGCGAAAC TTTACCAGCAACAGCGAGATCCTTCAGGTATTTTGCAGCAATGTGATATCCATAAGGCACTCAATTTACGGCCCAG CAAAATTTTGGTCAATTGGCACAACGCATTACCCCTAAACGTTCATTAAAAGATTTATTGGTATCTGATGATATTGC TCAACAGATACAAGAAATACTCGCAGCCATTAAGTATCGGGAACACGTCCTGGCGGGAGGTTTTAAAGATAAGATTG GTTATGGTACGGGTATCAGCGCCCTGTTTTATGGTGATTCTGGCACCGGAAAAACTATGGCAGCAGAAGTGATTGCC AATTACATTGGCGTTGACTTAATCAAAGTGGATTTATCTACCGTCGTGAATAAATACATCGGCGAAACAGAGAAAAA CTTATCCCGTATCTTCGATTTGGCAGAACAGGATGCCGGTGTTTTATTCTTTGATGAAGCGATGCGTTATTTGGTA AACGCAGTGAAACCAAAGATGCGCAAGACCGACATGCCAATATTGAAGTCTCTTATCTACTGCAACGGCTGGAGAAC TATCCGGGGTTGGTTATTTTATTCCACCAATAATCGTAGCCATTTGGACAACGCCTTTAATCGCCGTTTTACCTTTAT TACCCGCTTTACTTACCCGGATGAAACCATCCGCAAGAAAATGTGGCAGGCAATCTGGCCTGAAAATATAAGTCG CCCAGGATGTGGATTTCGATAAATTAGCTCAACGAACAAGCGTAACAGGGGCGAATATTCGTAATATTGCTTTTATTG TCTTCACTGTTTGCCGCAGAGAATAACCATAATGAAGTCAGTAATAAAAATATTGAAACAGCATTATCACGAGAATT AGCCAAAGTAGGCCGTTTAATTTTTTAA AATTTATAGCAATGCAAATATCTAACAATTAAATGTACTGATAGGTTAATTGTTATTACCATTATAAATTAAGAGGATTTTTT ATGTTAAACGCAAACCATTATTGATGTCAATAACGCAATGA AAACTATGCTGGAGAAATATCTGGATAATAAAATTGCAATTCGTTTTGACTTACCTGAATTAGATACCGTGCAATCT GATGCGATGGTGAGTGTCTTTCTGTATGATATCCACGAAGATCTACAGCTTCGTTCGACAGAATCCAGAGTGTTTAA TGCCACTTCAGGGAGATTATTGCCGGGTTGGGTCAATATTAAATGTAATTACCTGATTACCTATTGGGAATCGGCTC AACCAGCAACCGATTCCAACAGCTCAGAATGTCTACCGGATAATCAGGCAATAAAAGTCATGTCACAAGTCTTGAAT GCTCTGATTAATAATCGCCAATTGGCAGGTATTCCCGGTGCTTATACTCAGGTTGTCCCCCCGAAAGAAAGTTTAAA CAGTTTAGGGAATTTTTGGCAATCACTGGGGAATCGCCCCCGACTTTCTTTAAATTACTCAGTGACAATACCGATTA GCCTCACCGATAAGCAGGATAAGGCGACGCCGGTAAGCACCATTTCTTCTACAGTGGAACAAATTGCATCACTCAGT CAGGAAAAGATTAGCCATACTTTGCGAGAATTATTGATTACGGAACTACAGATACAACCTGTTACAGAATCAGAAAG TGAAGAGAATATCAGGCTGGCACTGAGCAAAGTTGAACTATTAACAATGAAAAAGGCTATAACTCCAGACAATTCAG CAGAAATTTCCATATCCTTGTCTGTATCAGGTATTACCCATCAGAAATATCTACAGGATATCAATAAAATTTTTGAT CGCTGGTTAAATGACAACAAAATTGTTACTACAGTCGATAATTATGGAATCAGGATTAAGGATATAGAAAAAAACCA TCTTTTCGGCATTTAA TTTATTGCTTTTCCATAGCTCATTAAATAACAGTTTATTTAAATCGGAGTATTATT

[0220] TcsT complete coding sequence (SEQ ID NO:48):

[0221] GATGTTAGCTTTCGTCTGAGCGGGGCAACCAGCAGCAGCTATGGTGTTTTTATTTCTAATCTGCGTAAAGCACTGCCGAATGAACGTAAACTGTATGATATTCCGCTGCTGCGTAGTAGCCTGCCGGGTAGTCAACGTTATGCACTGATTCATCTGACCAATTATGCCGACGAAACCATCAGCGTGGCAATTGACGTTACCAATGTATATATTATGGGCTATCGTGCCGGTGATACAAGCTATTTTTTTAATGAAGCAAGCGCAACCGAAGCAGCAAAATATGTTTTTAAAGACGCCATGCGTAAAGTGACCCTGCCGTATAGTGGTAACTACGAACGCCTGCAAACAGCAGCAGGAAAAATTCGTGAAAATATCCCGCTGGGCCTGCCGGCACTGGATAGCGCAATCACCACCCTGTTTTATTATAACGCCAATTCTGCAGCAAGCGCCCTGATGGTTCTGATTCAGAGTACAAGCGAAGCAGCACGTTACAAATTTATTGAACAGCAGATTGGGAAACGTGTCGACAAAACCTTTCTGCCGTCACTGGCAATTATTAGTCTGGAAAATAGCTGGTCTGCACTGAGCAAACAAATCCAAATTGCAAGCACCAATAACGGGCAGTTTGAAAGCCCGGTTGTTCTGATTAACGCCCAAAATCAGCGTGTGACCATCACCAATGTGGACGCAGGTGTCGTTACCAGCAACATCGCCCTGCTGCTGAATCGCAATAATATGGCA

[0222] Complete sequence of Xk-LysR (SEQ ID NO: 49, the underlined part is the lysR coding region):

[0223] TTAGTCACTCAAGAGTAATTTGCCTGCTTTTAACATAATGATATCGCTTATCAGCCAAACCTAGCTCTAATAACATTTAAATTAATCTTATGAATAACAAGGTTTATTTATCATATTCCATGAACATTTTATTGTTATTTAATAAGGTTTATTTATTTAAAAATCATATTAATTAATGTAATAATTCTTATATTCAATTGTTGACAAATATTAATGTCTATATATGATTATTGCACAATTAATAATTTCCACTGTGATGAATTACCACATCAAATCATGTAATTAAAATAAAAATGTAACAAATTTATTAATAATTTCATAACACCAGGAATAAGTCCTATTGAATTTAAAAAGGAGTATAG GTGTTTATTTCAAAA GACTTAGCAAATTTTATTGTCGTAGCCAAAAATAAATCAATAAATAAGGCAACAAAGGAGCTTTTTATTACACAGTC TCCAATTAGCCGAAGCTTAAAAAAATTGGAGTTCTCATTAGGTGTAAAACTCTTTGTCAGAAAAAACCAAGGATTAG TTCTAACGGAAGAAGGGGAGTGTCTATACAATAAAGTGTTATCAATTTATGAACAACTTAAAAATATCGAAAATGAT TACAAGAATCATAAATCACCCTATTGTGAAATTTATAAAAAACAACATAATGACTTAACATAA TAAAATAACAAGATAGATAAAAATATATTTCAGATAACTATTGAATCATATTCAATAGATTTCATTATATACATAAATTAAAAAGTAAATTTAACATGCCTAAATATCTTAGAGAAGCAGCAGAAGAAAAGACTTCTGTACAAAAACATTCTACCGATAGCAATCTTCTCAACTCAGGGAACTAATATCGCGGATACCTAACAATACAATAATGCACTTGAAGAAAGTGCATTCAAGTTGAATTAAAATAAAACGTTGAAGGAAAAGTATCACGAACCACCAGCTGGACAGGCAGAAATCCTTTTCCCCAGCAGAGCCACCTTCAAGGTTCATGCGATCAAGCGAGATGGCAAAAATACCTATGTCTTGCTAAGTGATATTTCCTCTGATGCCAACATAGATACAGATATAAAAGATATATTTTCAGGAAAAAAGAT

[0224] AD5RGDPK7 sequence (SEQ ID NO:50, the underlined part is the GS linker region):

[0225] GGCGGTTCTGGCGGCGGTGGTTCTGGCGGT AACGATAAACTGACCCTGTGGACCACACCGGCACCGAGTCCGAATTGTCGTCTGAATGCAGAAAAAGATGCAAAACTGACACTGGTTCTGACCAAATGTGGTAGCCAGATTCTGGCAACCGTTAGCGTTCTGGCAGTTAAAGGTAGCCTGGCACCGATTAGCGGCACCGTTCAGAGCGCACATCTGATTATTCGTTTTGATGAAAATGGCGTGCTGCTGAATAATAGCTTTCTGGATCCGGAATATTGGAATTTTCGTAATGGTGATCTGACCGAAGGCACCGCATATACCAATGCAGTTGGTTTTATGCCGAATCTGAGCGCATATCCGAAAAGCCATGGTAAAACCGCAAAAAGCAATATTGTTAGCCAGGTGTATCTGAACGGCGATAAAACAAAACCGGTTACACTGACCATTACACTGAATGGCACCCAAGAAACCGGTGATACCACAGCATGTGATTGTCGTGGTGATTGTTTTTGTGGTCCGAGCGCCTATAGCATGAGCTTTAGCTGGGATTGGAGCGGTCATAACTATATCAATGAAATTTTTGCGACCAGCAGCTACACCTTTAGCTATATTGCACAAGAAGGTAGCGGTAGCGGTTCAGGTAGTGGTTCTAAAAAGAAGAAAAAGAAAAAG

[0226] Ad5-knob sequence (SEQ ID NO:51, the underlined part is the GS linker region):

[0227] GGCGGTTCTGGCGGCGGTGGTTCTGGCGGT AACGATAAACTGACCCTGTGGACCACACCGGCACCGAGTCCGAATTGTCGTCTGAATGCAGAAAAAGATGCAAAACTGACACTGGTTCTGACCAAATGTGGTAGCCAGATTCTGGCAACCGTTAGCGTTCTGGCAGTTAAAGGTAGCCTGGCACCGATTAGCGGCACCGTTCAGAGCGCACATCTGATTATTCGTTTTGATGAAAATGGCGTGCTGCTGAATAATAGCTTTCTGGATCCGGAATATTGGAATTTTCGTAATGGTGATCTGACCGAAGGCACCGCATATACCAATGCAGTTGGTTTTATGCCGAATCTGAGCGCATATCCGAAAAGCCATGGTAAAACCGCAAAAAGCAATATTGTTAGCCAGGTGTATCTGAACGGCGATAAAACAAAACCGGTTACACTGACCATTACACTGAATGGCACCCAAGAAACCGGTGATACCACACCGAGCGCCTATAGCATGAGCTTTAGCTGGGATTGGAGCGGTCATAACTATATCAATGAAATTTTTGCGACCAGCAGCTACACCTTTAGCTATATTGCACAAGAA

[0228] E01 sequence (SEQ ID NO:52, the underlined part is the GS linker region):

[0229] GGTGGCTCTGGCGGTGGTGGATCTGGTGGC GATCTGGGTAAAAAGCTGCTGGAAGCAGCACGTGCAGGTCAGGATGAAGTTCGTATTCTGATGGCAAATGGTGCAGATGTTAATGCAGATGATACCTGGGGTTGGACACCG CTGCATCTGGCAGCATATCAGGGTCATCTGGAAATTGTTGAAGTGCTGCTGAAAAACGGTGCCGATGTGAATGCCTATGATTATATTGGTTGGACCCCCTCTGCACTTAGCAGCCG ATGGCCATTTAGAAATCGTGGAAGTTTTACTGAAAAATGGCGCAGACGTGAACGCAAGCGATTATATCGGTGATACCCCGTTACACCTGGCAGCACATAATGGCCACCTGGAAAT CGTAGAGGTTCTGTTAAAACATGGTGCGGACGTGAATGCACAGGATAATTGGTAAAACCGCCTTCGATATCAGCATTGATAATGGCAATGAAGATCTGGCAGAAATCCTGCAG

[0230] CD4 (SEQ ID NO:53, GS linker):

[0231] GGCGGTTCTGGCGGCGGTGGTTCTGGCGGTGATCTGGGTAAACGTCTGCTGGAAGCAGCACGTGCAGGTCAGGATGATGAAGTTCGTATTCTGATGGCAAATGGTGCAGATGTTAATGCCAAAGATGATGAGGGTCGTACCAGCCTGCATCTGGCAGCCCGTGAAGGTCATCTGGAAATTGTTGAAGTTCTGCTGAAACATGGTGCCGATGTGAACGCACAGGATTGGTATGGTAGCACACCGCTGCATTTAGCAGCAGCATGGGGTCATTTAGAAATCGTGGAAGTGTTACTGAAAAATGTGGCGGATGTGAATGCAATGGATGGTGATGGCAGTACTCCGCTGCATCTTGCCGCACATTATGCACATCTGGAAGTGGTGGAAGTGCTGTTAAAGAACGGTGCCGACGTTAATGCGCAGGATAAATTTGGTAAAACCGCCTTTGATATCAGCATCGATAATGGCAATGAAGATCTGGCAGAAATCCTGCAGAAACTGAAT

[0232] BlaM (β-lactamase) gene sequence (SEQ ID NO: 54):

[0233] ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTCCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA

[0234] Cre gene sequence (SEQ ID NO:55):

[0235]

[0236] Rluc (Renilla luciferase) gene sequence (SEQ ID NO: 56):

[0237] ATGACCAGCAAAGTTTATGATCCAGAACAGCGCAAACGTATGATCACCGGGCCCGCAGTGGTGGGCACGTTGCAAACAGATGAACGTTCTGGATAGCTTTATCAATTATTATGATAGCGAAAAACATGCCGAAAATGCAGTTATTTTTCTGCATGGTAATGCGCGCCAGTTCATATCTGTGGCGTCATGTTGTTCCACATATTGAACCGGTGGCACGTTGCATCATTCCGGATCTG ATTGGTATGGGTAAAAGCGGTAAAAGCGGCAATGGTAGTTATCGTCTGCTGGATCATTATAAATATCTGACCGCGTGGTTTGAACTGCTGAATCTGCCGAAAAAGATCATTTTTGTTGGTCATGATTGGGGTGCATGTCTGGCATTTCATTATAGCTATGAACATCAGGATAAAATCAAAGCAATCGTTCATGCGGAAAGCGTTGTAGATGTCATTGAAAGTTGGGATGAATGG CCGGATATTGAAGAAGATATTGCACTGATTAAAAGCGAAGAAGGTGAAAAAATGGTTCTGGAAAATAATTTTTTTGTTGAAACCATGCTGCCGAGCAAAATTATGCGTAAACTGGAACCGGAAGAATTTGCAGCATATCTGGAACCGTTTAAAGAAAAAGGTGAAGTTCGTCGTCCGACCCTGAGCTGGCCGCGTGAAATTCCGCTGGTTAAAGGTGGTAAACCGGATGTTGTTCAGATTGTTCGTAATTATAATGCATATCTGCGTGCAAGCGATGATCTGCCGAAAATGTTTATTGAAAGCGATCCGGGTTTTTTTAGCAATGCAATTGTTGAAGGTGCAAAAAAATTTCCGAATACCGAATTTGTTAAAGTTAAAGGTCTGCATTTTAGCCAGGAAGATGCACCGGATGAAATGGGTAAATATATTAAAAGTTTTGTTGAACGTGTTCTGAAAAATGAACAGTAA

[0238] It should be noted that, although the technical solutions of the present disclosure are introduced with specific examples, those skilled in the art will appreciate that the present disclosure should not be limited thereto.

[0239] The embodiments of the present disclosure have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A protein delivery system comprising a protein complex and a signal peptide, wherein: The protein complex includes structural proteins and regulatory factors. The structural proteins and regulatory factors are from the MCB strain of Xenorhabdus khoisanae; Optionally, the protein delivery system is an extracellular contractile injection system.

2. The protein delivery system according to claim 1, wherein The signal peptide is derived from Xenorhabdus khoisanae MCB strain; Preferably, the signal peptide comprises one or more of the amino acid sequences shown in SEQ ID NO: 38, 39 or 40 or fragments thereof; Optionally, the fragment is a C-terminally truncated fragment of the amino acid sequence shown in SEQ ID NO: 38, 39 or 40; Optionally, the signal peptide is linked to the N-terminus of the effector protein; Optionally, a linker sequence is further included between the signal peptide and the effector protein.

3. The protein delivery system according to claim 1 or 2, wherein The structural protein is from Xenorhabdus khoisanae MCB strain; Preferably, the structural protein is encoded by the Cis gene cluster; More preferably, the Cis gene cluster comprises a nucleotide sequence consisting of sequences shown in SEQ ID NO:47 and SEQ ID NO:57 in the order from 5' end to 3' end, or at least one of its variants having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with the nucleotide sequence consisting of sequences shown in SEQ ID NO:47 and SEQ ID NO:57 in the order from 5' end to 3' end.

4. The protein delivery system according to claim 3, wherein The structural protein is obtained by transforming the recognition region of the protein encoded by the Cis gene cluster into other recognition proteins.

5. The protein delivery system according to any one of claims 1 to 4, wherein: The regulatory factor is from the MCB strain of Xenorhabdus khoisanae; Preferably, the regulatory factor comprises the amino acid sequence as shown in SEQ ID NO:34, or a variant thereof having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% or higher sequence identity with SEQ ID NO:

34.

6. The protein delivery system according to any one of claims 1 to 5, wherein: The effector protein includes any protein; Optionally, the effector protein includes any protein of interest to be administered to a subject / cell; Optionally, the effector protein includes a virulence factor or reporter protein derived from Xenorhabdus khoisanae MCB strain, a cellular or bacterial virulence protein, a signaling pathway regulatory protein, a hormone or hormone regulatory molecule, a structural protein, a transport protein, an antimicrobial peptide, an enzyme involved in cell metabolism, a gene editing protein, an antigen or immunogen and / or a pharmaceutically active protein.

7. An isolated polynucleotide encoding the protein delivery system according to any one of claims 1 to 6.

8. The polynucleotide according to claim 7, wherein The polynucleotide comprises one or more of the following: i) nucleotides encoding structural proteins in the protein delivery system; ii) nucleotides encoding a regulatory factor in the protein delivery system; and iii) a nucleotide encoding a signal peptide in the protein delivery system; and, Optionally, nucleotides encoding an effector protein.

9. An expression vector comprising the polynucleotide according to claim 7 or 8. 10 . A recombinant host cell comprising the protein delivery system according to claim 1 , the polynucleotide according to claim 7 or 8 , or the expression vector according to claim 9 .

11. A method for preparing the protein delivery system according to any one of claims 1 to 6, comprising the steps of constructing the expression vector according to claim 9, transforming the expression vector according to claim 9 into a host cell to construct the recombinant host cell according to claim 10, and culturing the recombinant host cell according to claim 10; Optionally, the method further comprises the step of isolating the protein from the cultured recombinant host cells.

12. The method according to claim 11, wherein: The recombinant plasmid is selected from one or more of pBR322, pRK404, pUC, pBluescript, pBBR1MCS-5 or their modified vectors.

13. Use of the protein delivery system according to any one of claims 1 to 6, the polynucleotide according to claim 7 or 8, the expression vector according to claim 9 or the recombinant host cell according to claim 10 in the preparation of drugs, reagents and / or kits for delivering biomacromolecules.

14. The use according to claim 13, wherein The biomacromolecules include virulence factors or reporter proteins derived from Xenorhabdus khoisanae MCB strain, cellular or bacterial virulence proteins, signal pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens and / or pharmaceutically active proteins.

15. A pharmaceutical composition comprising: the protein delivery system according to any one of claims 1 to 6, and Optionally, a pharmaceutically acceptable carrier or excipient; Optionally, the effector protein, optionally, comprises a virulence factor or reporter protein derived from Xenorhabdus hoisanae MCB strain, a cellular or bacterial virulence protein, a signaling pathway regulatory protein, a hormone or hormone regulatory molecule, a structural protein, a transporter, an antimicrobial peptide, an enzyme involved in cell metabolism, a gene editing protein, an antigen or immunogen and / or a pharmaceutically active protein.

16. A kit for delivering effector proteins, comprising: the protein delivery system according to any one of claims 1 to 6, or the pharmaceutical composition according to claim 15; The effector proteins include virulence factors or reporter proteins derived from Xenorhabdus khoisanae MCB strain, cellular or bacterial virulence proteins, signal pathway regulatory proteins, hormones or hormone regulatory molecules, structural proteins, transport proteins, antimicrobial peptides, enzymes involved in cell metabolism, gene editing proteins, antigens or immunogens and / or pharmaceutically active proteins.

Images