Sensitive gene SbCSLG2, recombinant plasmid and preparation method and application thereof

Abstract

The invention discloses a susceptible gene SbCSLG2, a recombinant plasmid as well as a preparation method and application of the susceptible gene SbCSLG2 and the recombinant plasmid. The susceptible gene SbCSLG2 is a susceptible gene of sorghum anthracnose, the nucleotide sequence of the susceptible gene SbCSLG2 is SEQ ID NO.01, and the amino acid sequence of the protein gene SbCSLG2 is SEQ ID NO.02. The invention further discloses a preparation method of the SbCSLG2. The susceptible gene SbCSLG2 can be subjected to amplification, recovery, plasmid recombination and homologous genetic transformation to obtain a positive sorghum plant; a primer designed by the susceptible gene SbCSLG2 can be directly used as a molecular marker to quickly screen and identify sorghum anthracnose-resistant resources in a seedling stage; the sorghum susceptible gene SbCSLG2 can be mutated into a disease-resistant gene through a gene locus, and the sorghum susceptible gene SbCSLG2 can be possibly changed into the disease-resistant gene through technologies such as gene editing; the invention can provide a convenient method for rapidly screening materials, creating new materials and improving sorghum anthracnose-resistant varieties for sorghum anthracnose-resistant breeding research.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a disease susceptibility gene SbCSLG2, a recombinant plasmid and a preparation method and application thereof. Background Art

[0002] Sorghum is the fifth most widely grown cereal crop in the world and can be used as food, feed and industrial raw material. Anthracnose is one of the most serious diseases in sorghum growing areas around the world. It can occur at all growth stages of sorghum, causing sorghum yield reduction or even total crop failure. Studying the genetic mechanism of sorghum resistance to anthracnose and conducting breeding improvement is the most effective way to increase sorghum yield, save costs and increase efficiency, and prevent sorghum anthracnose.

[0003] Gene cloning technology provides a powerful tool for studying biological genetics and molecular biological mechanisms. Gene cloning of crop-related traits can be used to improve crop varieties and increase crop yields and stress resistance. Gene function analysis is an important means of studying the gene function of organisms. It can reveal the specific functions of genes and provide key information for understanding basic life processes such as growth and development, physiological metabolism, etc. Bioinformatics tools can be used to analyze gene sequences, protein functions, and system evolution, thereby discovering some new information and laws.

[0004] Susceptibility genes can be directly used as molecular markers to screen and identify sorghum resources. There are also many reports that they may mutate into disease-resistant genes through gene loci. For example, Chen et al. found that a BSR-D1 rice blast susceptibility gene locus in nature mutated into a disease-resistant gene SNP33-G in rice. Eukaryotic translation initiation factor 4E (EIF4E) is a susceptibility factor for viral infection in many plant species. Hoffie et al. targeted mutagenesis of the EIF4E gene using Cas9 endonuclease in winter barley varieties susceptible to BaMMV / BaYMV, resulting in the movement of the translation reading frame, which led to the loss of EIF4E function and enhanced winter barley resistance to Bymovirus. Overexpression of TaRsfS, a ribosomal silencing factor (RsfS) homolog in wheat, reduces wheat resistance to powdery mildew and stripe rust, while TaRsfS knockout (TaRsfS-KO) increases wheat resistance to these two diseases without affecting key agronomic traits. The wheat GRAINWIDTH2 (TaGW2) homologous gene negatively regulates grain weight and mediates the ubiquitination of TaSGT1 to negatively regulate wheat leaf rust resistance. By editing TaGW2 with CRISPR / Cas9, grain weight and leaf rust resistance were increased simultaneously. This study showed that the sorghum anthracnose susceptible gene SbCSLG2 may be transformed into a disease-resistant gene through gene editing and other technologies, which has certain potential uses in sorghum disease resistance breeding research, and its function will be further explored in the next step.

[0005] There are many reports on heterologous cloning of sorghum genes, such as cloning the sorghum nitrogen deficiency-specific induced gene SbMYB-like, constructing an overexpression vector, and transforming it into Arabidopsis to obtain an overexpression strain, which verifies that the gene plays an important role in promoting root elongation and flowering; cloning the sorghum deep rooting gene SbDRO1, overexpressing SbDRO1 in Arabidopsis can significantly improve the survival rate of Arabidopsis under drought conditions, and the root system of transgenic Arabidopsis is significantly more developed than that of the wild type; cloning the sorghum seed shattering Sh-B140 gene and transferring it into the Sudan grass variety Hiro-1. By observing the field phenotype of the T1 generation transgenic plants, it was found that the seed shattering intensity of the T1 plants was higher than that of Hiro-1, but significantly lower than that of the parent B140. However, there are few reports on homologous cloning in sorghum, and there has been no homologous cloning and functional analysis of sorghum anthracnose-related genes. The present invention discovered the sorghum anthracnose susceptibility gene SbCSLG2 by genome-wide association analysis (GWAS) and transcriptome combined analysis, performed homologous cloning and vector construction, obtained SbCSLG2 genetically transformed sorghum plants, and performed bioinformatics analysis on the gene, aiming to lay a foundation for the study of the biological function of the sorghum anthracnose resistance-related gene.

[0006] Susceptibility genes in plants are key genes for the occurrence of diseases. They will be overexpressed after direct contact with the effector proteins of pathogenic bacteria, and then activate the entire susceptibility pathway of the plant, eventually leading to plant disease. In the report of anthracnose infection of sorghum, previous studies did not find any susceptibility genes. The acquisition of sorghum anthracnose susceptibility genes can systematically analyze the molecular response mechanism of sorghum anthracnose, and can also identify sorghum anthracnose through sorghum susceptibility genes. At the same time, after cloning and transforming the susceptibility genes, the genetic mechanism of sorghum resistance to anthracnose can be analyzed, and the foundation can be laid for the study of sorghum anthracnose resistance genes and the genetic improvement of sorghum resistance to anthracnose. Summary of the invention

[0007] The purpose of the present invention is to provide a disease susceptibility gene SbCSLG2, a recombinant plasmid and a preparation method and application thereof. The present invention obtains a recombinant plasmid by transforming the disease susceptibility gene SbCSLG2 into a recombinant plasmid, and the recombinant plasmid can act on sorghum plants to identify sorghum resistance to anthracnose.

[0008] The technical solution of the present invention is: a disease susceptibility gene SbCSLG2, the nucleotide sequence of the disease susceptibility gene SbCSLG2 is SEQ ID NO.01, the disease susceptibility gene SbCSLG2 is a gene encoding a protein composed of the amino acid sequence shown in SEQ ID NO: 2, and the disease susceptibility gene SbCSLG2 is a disease susceptibility gene for sorghum anthracnose.

[0009] A recombinant plasmid comprising the gene sequence of the disease susceptibility gene SbCSLG2 according to claim 1.

[0010] The aforementioned method for constructing the recombinant plasmid is carried out according to the following steps:

[0011] (1) After PCR amplification of the disease-susceptible gene SbCSLG2, the 2244 bp electrophoresis fragment was cut out and recovered, and the target fragment was recovered using the agarose gel DNA recovery kit DP209-03 from Tiangen Biochemical Technology Co., Ltd.;

[0012] (2) subjecting the target fragment to an enzyme digestion-ligation reaction to obtain a ligation product;

[0013] (3) The ligation product is mixed with competent E. coli cells, cultured in LLB liquid medium to restore the cells to normal growth state, and then the recombinant plasmid is transformed into plasmid colonies on LB solid medium plates;

[0014] (4) Using primers JJ-F and NOS-R, PCR amplification is performed on the plasmid colonies obtained in step (3), and PCR detection is performed; the positive bacterial plaques detected are picked out, separated and purified, and the plasmid is extracted.

[0015] In the above step (1), the PCR amplification reaction system is 25 μL of 2xPCR buffer, 10 μL of 2mM dNTPs, 1 μL of primer F, 1 μL of primer R, 1 μL of KOD-FX and 1 μL of BTx623 sorghum DNA template, and then ddH2O is added to prepare a 50 μL PCR amplification reaction system; the PCR amplification reaction conditions are: first pre-denaturation at 98°C for 3 min, then 98°C for 10 sec to 68°C for 3 min, cycle 32 times, and finally 68°C for 6 min; the nucleotide sequence of the primer F is SEQ ID NO.03, and the nucleotide sequence of the primer R is SEQ ID NO.04.

[0016] In the above step (2), the enzyme digestion-ligation reaction system is: 10×CutSmartBuffer 1.5μL, 10mMATP1.5μL, empty plasmid 100ng, target fragment 100ng, BsaI-HF 10U and 4DNAligase 35U, added with H2O to make up to 15μL; the enzyme digestion-ligation reaction parameters are 37℃5min first, then 20℃5min.

[0017] In the above step (4), the colony PCR amplification system is as follows: take 10ul of 2XTaqMIX, 0.5ul of JJ-F primer and 0.5ul of NOS-R primer, pick up colonies and add them, add ddH2O to 20ul; the colony PCR amplification reaction parameters are pre-denaturation at 95°C for 5min, denaturation at 95°C for 530sec, annealing at 55°C for 30sec, extension at 72°C for 1min, and final extension at 72°C for 2min; the nucleotide sequence of the primer JJ-F is SEQIDNO.05, and the nucleotide sequence of the primer NOS-R is SEQIDNO.06.

[0018] The application of the aforementioned disease susceptibility gene SbCSLG2 and the aforementioned recombinant plasmid in homologous genetic transformation of sorghum.

[0019] In the above application, after the sorghum-positive plants genetically transformed with the disease-susceptibility gene SbCSLG2 were treated with a spore solution of sorghum anthracnose pathogen, the gene was significantly overexpressed, and the sorghum-positive plants had significantly more lesions than the wild control sorghum plants, indicating that the disease-susceptibility gene SbCSLG2 is a sorghum anthracnose-susceptible gene.

[0020] In the aforementioned application, after anthracnose-resistant sorghum and anthracnose-susceptible sorghum were treated with spore solution of sorghum anthracnose pathogen, the susceptibility gene SbCSLG2 was significantly overexpressed in the susceptible sorghum, which can be used for rapid identification of anthracnose-susceptible sorghum resources.

[0021] In the aforementioned application, the nucleotide sequences of the specific primers for detecting overexpression of the disease-susceptible gene SbCSLG2 are SEQ ID NO.07 and SEQ ID NO.08.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention discloses a sorghum anthracnose susceptible gene SbCSLG2, a recombinant plasmid and an application thereof. SbCSLG2 is a sorghum anthracnose susceptible gene. Primers designed with the susceptible gene can be directly used as molecular markers to quickly screen and identify sorghum anthracnose-resistant resources at the seedling stage, providing a convenient method for quickly screening materials for sorghum anthracnose-resistant breeding research and improving sorghum anthracnose-resistant varieties.

[0024] 2. So far, there have been no reports on sorghum anthracnose susceptible genes. Sorghum susceptibility genes can be mutated into disease-resistant genes through gene loci. The SbCSLG2 sorghum susceptibility gene in the present invention may be transformed into a disease-resistant gene through gene editing and other technologies. It has certain potential uses in the research on sorghum disease-resistant breeding, and will help provide theoretical methods and new strategies for the creation of sorghum anthracnose-resistant germplasm. The next step will be to explore its functions.

[0025] 3. The susceptibility gene SbCSLG2 for sorghum anthracnose was discovered for the first time, constructed into a recombinant plasmid, and genetically transformed into sorghum plants. This allows for more functional analysis of the susceptibility gene SbCSLG2, which has far-reaching significance for the academic research on sorghum anthracnose and the improvement of sorghum anthracnose-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : SbCSLG2 gene structure diagram (white box-UTR, red box-exon, line-intron);

[0027] Figure 2 : Plasmid vector map of SbCSLG2 gene;

[0028] Figure 3 : T0 generation overexpression transformed seedlings and positive identification of SSbCSLG2 (A: T0 seedlings of SbCSLG2, B: electrophoresis diagram of identification of overexpression positive strains of SbCSLG2);

[0029] Figure 4 : Expression level of SbCSLG2 gene in positive sorghum;

[0030] Figure 5 : Pictures of wild-type (CK) and transformed SbCSLG2 sorghum leaves on the 5th day after treatment with anthracnose pathogens (A: CK, B: SbCSLG2);

[0031] Figure 6 :Specific expression of SbCSLG2 gene in disease-resistant and disease-susceptible sorghum. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with the accompanying drawings and embodiments, but they are not intended to limit the present invention.

[0033] Example 1: Gene localization

[0034] First, based on 242 sorghum whole genome resequencing data (China National Gene Bank (CNGB) CNP0002968) and sorghum population SNP detection methods, 2015850 high-quality SNPs were obtained for subsequent genome-wide association analysis and haplotype analysis. Referring to the genome-wide association analysis method of Zhang Liyi et al., GWAS was performed using the BLINK, FarmCPU, GLM, MLM and MLMM statistical methods implemented in the Genome Association and Prediction Integrated Toolkit (GAPIT version: 3.0). Genome-wide association analysis was performed on the sorghum anthracnose lesion onset time disease index and lesion size disease index traits obtained in three replicates. The first three PCs derived from genome-wide SNPs were used as fixed effects in the mixed model to correct for stratification. Random effects were estimated based on groups clustered according to the kinship between all germplasms. The genome-wide significant cutoff was defined using the adjusted Bonferroni test threshold, which was set to P = -log 10 (1 / 2015850) =6.3, the loci above the threshold line are considered reliable, and the average linkage disequilibrium (LD) decay distance is 62.5 kb (r 2 =0.2, ) and searched for candidate genes related to sorghum anthracnose resistance within 62.5 kb above and below all significant SNPs according to the sorghum BTx623 reference genome. Then, 1.5x10 5The seedlings of anthracnose-resistant sorghum and anthracnose-susceptible sorghum were sprayed with spore solution of 1000 g / ml, and the aboveground seedlings at 0h, 12h, 24h, 36h, and 48h were taken for transcriptome analysis to obtain differential genes related to anthracnose resistance. The co-located genes were analyzed by GWAS and transcriptome analysis, and the FPKM of the DEGs excavated together was analyzed. Genes with extreme values ​​of FPKM>3 and FPKM>17 were screened, and genes with the same expression trend of FPKM and qPCR in resistant and susceptible sorghum and significant differences were located. The candidate gene Sobic.003G442500 was located as a new sorghum anthracnose susceptibility gene; BlastP was used to search the NCBI (https: / / ngdc.cncb.ac.cn / sorgsd / browse) database to download SBP15 sequences of other species ; Using MEGA7.0 software, the muscle method was used to align the sequences and then the neighbor-joining method (NJ) (bootstrap = 1000) was used to construct an unrooted evolutionary tree. The homology comparison and neighbor-joining tree were used for analysis. The Sobic.003G442500 protein had the highest homology with ZmCSLG2 (cellulose synthase-like protein G2; corn) (Per.Ident = 78.80%, E-value = 0), so the Sobic.003G442500 gene can be regarded as the SbCSLG2 gene. The nucleotide sequence of the gene SbCSLG2 is SEQ ID NO.01, and the amino acid sequence of the SbCSLG2 protein gene is SEQ ID NO.02.

[0035] The SbCSLG2 gene was retrieved and screened from the genome browser in SorGSD (https: / / ngdc.cncb.ac.cn / sorgsd / browse) for analysis of its gene characteristics, showing that it has a complete gene structure and multiple introns. The SbCSLG2 gene is located on the positive strand of chromosome 3, with a gene interval of 74,093,353-74,097,352bp, which can encode a protein of 748aa, with a total of 5 exons and 4 introns. There are 647 SNPs and 261 deletion / insertion (Indel) mutations in the SbCSLG2 gene. There are 2 high-consequence type SNP variants, both of which are stop-acquired SNP variants; there are 17 moderate-consequence type SNP variants (missense variants) and 15 low-consequence type SNP variants (synonymous variants) in the coding region; and in the modification type, the upstream gene and downstream gene mutations are the most, followed by intron mutations, and the least UTR region has a small number of mutations, but no coding region mutations. For Indel mutations, there were 6 high-consequence Indel mutations, including stop loss and frameshift mutations; there were 11 medium-consequence Indel mutations (whole-code mutations) and 3 low-consequence Indel mutations (splicing region mutations) in the coding region; and among the modification types, the most mutations were found in upstream genes and downstream genes, followed by intron mutations, and the least mutations were found in the UTR region, but no mutations were found in the coding region (Table 1, Figure 1 ).

[0036] Table 1SbCSLG2 coding variation statistics.

[0037]

[0038] Example 2: Construction of vectors of disease-susceptibility genes

[0039] 1. Design of vector primers, as shown in Table 2.

[0040] Table 2 Primer sequences for constructing vector

[0041]

[0042] 2. Amplification and recovery of target fragments

[0043] When recovering the fragments, the electrophoresis fragments of 2874 bp and 2244 bp were cut out from the Sobic.007G120000 and SbCSLG2 genes, respectively, and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd.; the operation was performed according to the instructions of the kit.

[0044] The PCR reaction system was: 2xPCR buffer 25 μL, 2 mM dNTPs 10 μL, F 1 μlL, R 1 μlL, KOD-FX 1 μL, 1 μL of BTx623 sorghum DNA template, and ddH 2 O was added to 50 μL to obtain the PCR reaction;

[0045] PCR reaction conditions:

[0046]

[0047] 3. Enzyme Digestion-Ligation Reaction

[0048] Operate according to the enzyme digestion reaction system in Table 3, and then set the reaction according to the enzyme digestion-ligation reaction parameters in Table 4.

[0049] Table 3 Enzyme digestion reaction system

[0050]

[0051] Table 4 Enzyme digestion-ligation reaction parameters

[0052]

[0053] 4. Recombinant plasmid transformation

[0054] (1) Take a tube of 100 μL of DH5a competent E. coli cells and mix with 2-5 μL of ligation product and incubate on ice for 30 min;

[0055] (2) Rapidly place in a 42°C constant temperature water bath, heat shock for 90 seconds, and ice bath for 2 minutes;

[0056] (3) Add 500 μL of LB liquid culture medium and mix well;

[0057] (4) Cultivate at 37°C and 200 rpm for 45 min to allow the cells to return to normal growth;

[0058] (5) Spread the bacterial solution evenly on a Kana-resistant LB solid culture medium plate;

[0059] (6) After 30 minutes, place the cells in a 37°C incubator for overnight culture.

[0060] 5. Bacteria test

[0061] Use the primer pair JJ-F / NOS-R to perform colony PCR detection according to the following colony PCR amplification system and the parameters in Table 4; pick and shake the positive plaques detected.

[0062] Colony PCR amplification system: 2XTaqMIX10ul, JJ-F primer: 0.5ul, NOS-R primer 0.5ul, pick a small amount of colonies, add ddH2O to 20ul.

[0063] Table 5 Colony PCR reaction parameters

[0064]

[0065] 6. Plasmid Extraction

[0066] (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight;

[0067] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely;

[0068] (3) Take 250 μL of Solution I reagent containing RNase A to thoroughly resuspend the bacterial mass;

[0069] (4) Take 250 μL Solution II reagent to lyse the bacterial mass and gently invert it several times until the bacteria become transparent;

[0070] (5) Take 350 μL Solution III reagent and invert several times until white compact flocs are formed;

[0071] (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant;

[0072] (7) Take out the nucleic acid purification column from the kit and place it on the collection tube;

[0073] (8) Take the clarified supernatant from step 6 above and place it into a nucleic acid purification column, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate;

[0074] (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0075] (10) Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0076] (11) Repeat the above step 10;

[0077] (12) Place the nucleic acid purification column on the collection tube and centrifuge at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0078] (13) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0079] (14) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C refrigerator for later use;

[0080] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the quality of the plasmid extraction.

[0081] 7) Sequencing

[0082] The plasmid extracted from the positive plaque was subjected to Sanger sequencing and tested with sequencing primer eGFP-cx. If the sequencing result sequence was consistent with the target fragment sequence, the overexpression vector was successfully constructed. The vector map is shown in Figure 2 .

[0083] Example 3: Genetic transformation of sorghum

[0084] Agrobacterium containing plasmid vectors was transferred into tissue cultured sorghum. The stable genetic transformation of sorghum was completed with the help of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Specifically, it included sorghum callus induction, Agrobacterium infection of callus tissue, resistant callus screening, and regeneration plant culture.

[0085] 1. Planting of genetically transformed sorghum and detection of gene overexpression

[0086] The T0 generation overexpression transformed sorghum plants were planted in the teaching experimental field of Guizhou University and routinely planted and managed. When the T0 generation sorghum grew to the jointing stage, leaves of 8 plants were taken for identification of positive plants. Bright bands were seen in all of them, and the size of the amplified product was consistent with the expected one. Figure 3 When sorghum plants grew to the booting stage, leaves of the wild type (CK) and SbCSLG2-positive strains (L1275-1, L1275-3, L1275-3) were taken for expression testing.

[0087] The test method is RT-qPCR, using ambion by life technologies Total RNA was extracted with Biosharp SYBR PCR Reagent (Lot. No. 338111), and reverse transcribed into cDNA using Beyotime's BeyoRTTMⅢ CDNA Reverse Transcription Kit (Beyotime, with gDNA EZeraser, Lot. No. D7185M). SbUBQ10 was used as the internal reference gene, and homologous cloned gene primers were used for qRT-PCR amplification using biosharp's Universal Fluorescence Quantitative PCR Kit (biosharp, Universal SYBR QPCR Master Mix, Lot. No. BL697A); the use of the above reagents was referred to the instructions. BIO-RAD CFX96 Real-Time cycler (c100 Touch Thermal cycler) was used to quantify gene expression levels. The 2 -ΔΔCT The method was used to determine the relative fold change in target gene expression.

[0088] Table 6 Primers for disease resistance-related genes of homologous cloning

[0089] Serial number name sequence SEQ ID NO.07 Forward primer (5′-3′) GCTCTCAGTCTCAGTCGTCTCC SEQ ID NO.08 Reverse primer (5′-3′) AGGAACAGCAGCGTCAGGTC

[0090] The leaves of the successfully transformed positive sorghum were selected for identification of the anthracnose resistance phenotype.

[0091] Example 4: Overexpression of SbCSLG2 in positive strains

[0092] The results of the overexpression of the three SbCSLG2 gene overexpression lines are as follows: Figure 4 As shown. Compared with the wild-type CK, the expression levels of SbCSLG2 in L1275-1, L1275-3, and L1275-3 were 869.72, 399.33, and 601.61 times of CK, respectively. This indicates that the constructed overexpression vector has an effect on SbCSLG2 in sorghum, and by changing their expression levels, it ultimately leads to the production of effects. These materials can be used to further study the effects of mutation effects on agronomic traits and disease resistance of materials.

[0093] Example 5: Changes in lesions of overexpressing sorghum

[0094] The lesions were counted every 12 hours and it was found that at the 72nd hour, lesions began to appear on the leaf veins of the SbCSLG2-positive strains and the control plants, but the lesions on the leaf veins of the positive strains were more than those on the control leaves. At the 96th hour, lesions began to appear on the leaves of the SbCSLG2-positive strains and the control plants, but the lesions on the leaves of the positive strains were more than those on the control leaves. At the 120th hour, the lesions on the leaves of the SbCSLG2-positive strains were significantly more than those on the control leaves. Figure 5 ; This indicates that overexpression of SbCSLG2 in sorghum will lead to an increase in sorghum lesions.

[0095] Example 6: Identification of SbCSLG2 for Anthracnose Resistance in Sorghum

[0096] According to the nucleotide sequence of the susceptible gene SbCSLG2, SEQ ID NO.01, a specific primer sequence of SEQ ID NO.07 was designed. Then, 1.5×10 5 The seedlings of anthracnose-resistant sorghum (DR) and anthracnose-susceptible sorghum (S) were sprayed with spore solution of 1000 spores / ml. The aboveground parts of the plants were taken before inoculation (0 h), 12, 24, 36, and 48 h after inoculation. After RNA was extracted, real-time fluorescence quantitative qPCR was performed using SEQ ID NO.07 as primer to analyze the specific expression of SbCSLG2 gene in disease-resistant and disease-susceptible sorghum. Figure 6 As shown, the relative expression level of SbCSLG2 gene in susceptible sorghum was significantly higher than that in resistant sorghum during 12-48h. Based on the significant difference in the relative expression level of SbCSLG2 gene in anthracnose-resistant and anthracnose-susceptible sorghum, whether sorghum is resistant / susceptible to anthracnose can be identified, and sorghum anthracnose-resistant resources can be quickly identified.

[0097] DNA sequence of SbCSLG2

[0098] SEQ ID NO.01:

[0099]

[0100] The amino acid sequence of SbCSLG2 protein gene is SEQ ID NO.02:

[0101]

Claims

1. A disease susceptibility gene SbCSLG2, characterized in that: The nucleotide sequence of the susceptible gene SbCSLG2 is SEQ ID NO.

01. The susceptible gene SbCSLG2 is a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO:

2. The susceptible gene SbCSLG2 is a susceptible gene for sorghum anthracnose.

2. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene sequence of the disease-susceptibility gene SbCSLG2 according to claim 1.

3. The method for constructing a recombinant plasmid according to claim 2, characterized in that: The construction method is carried out according to the following steps: (1) After PCR amplification of the disease-susceptible gene SbCSLG2, the 2244 bp electrophoresis fragment was cut out and recovered, and the target fragment was recovered using the agarose gel DNA recovery kit DP209-03 from Tiangen Biochemical Technology Co., Ltd.; (2) subjecting the target fragment to an enzyme digestion-ligation reaction to obtain a ligation product; (3) The ligation product is mixed with competent E. coli cells, cultured in LLB liquid medium to restore the cells to normal growth state, and then the recombinant plasmid is transformed into plasmid colonies on LB solid medium plates; (4) Using primers JJ-F and NOS-R, PCR amplification is performed on the plasmid colonies obtained in step (3), and PCR detection is performed; the positive bacterial plaques detected are picked out, separated and purified, and the plasmid is extracted.

4. The method for constructing a recombinant plasmid according to claim 3, characterized in that: In the step (1), the PCR amplification reaction system is 25 μL of 2xPCR buffer, 10 μL of 2mM dNTPs, 1 μL of primer F, 1 μL of primer R, 1 μL of KOD-FX and 1 μL of BTx623 sorghum DNA template, and then ddH2O is added to prepare a 50 μL PCR amplification reaction system; the PCR amplification reaction conditions are: pre-denaturation at 98°C for 3 min, then at 98°C for 10 sec to 68°C for 3 min, for 32 cycles, and finally at 68°C for 6 min; the nucleotide sequence of the primer F is SEQ ID NO.03, and the nucleotide sequence of the primer R is SEQ ID NO.

04.

5. The method for constructing a recombinant plasmid according to claim 3, characterized in that: In the step (2), the enzyme digestion-ligation reaction system is: 10×CutSmartBuffer 1.5 μL, 10 mM ATP 1.5 μL, empty plasmid 100 ng, target fragment 100 ng, BsaI-HF 10 U and 4 DNA ligase 35 U, and H2O is added to make up to 15 μL; the enzyme digestion-ligation reaction parameters are first 37°C for 5 min, then 20°C for 5 min.

6. The method for constructing a recombinant plasmid according to claim 3, characterized in that: In the step (4), the colony PCR amplification system is as follows: 10ul of 2XTaqMIX, 0.5ul of JJ-F primer and 0.5ul of NOS-R primer are taken, a colony is picked and added, and ddH2O is added to 20ul; the colony PCR amplification reaction parameters are pre-denaturation at 95°C for 5min, denaturation at 95°C for 530sec, annealing at 55°C for 30sec, extension at 72°C for 1min, and final extension at 72°C for 2min; the nucleotide sequence of the primer JJ-F is SEQIDNO.05, and the nucleotide sequence of the primer NOS-R is SEQIDNO.

06.

7. Use of the disease susceptibility gene SbCSLG2 according to claim 1 and the recombinant plasmid according to claim 3 in homologous genetic transformation of sorghum.

8. The use according to claim 7, characterized in that: After the sorghum-positive plants genetically transformed with the susceptible gene SbCSLG2 were treated with a sorghum anthracnose spore solution, the gene was significantly overexpressed, and the sorghum-positive plants had significantly more lesions than the wild control sorghum plants, indicating that the susceptible gene SbCSLG2 is a sorghum anthracnose susceptible gene.

9. The use according to claim 7, characterized in that: After anthracnose-resistant sorghum and anthracnose-susceptible sorghum were treated with spore solution of sorghum anthracnose pathogen, the susceptibility gene SbCSLG2 was significantly overexpressed in the susceptible sorghum, which can be used to quickly identify anthracnose-susceptible sorghum resources.

10. The use according to claim 8 or 9, characterized in that: The nucleotide sequences of the specific primers for detecting overexpression of the disease-susceptible gene SbCSLG2 are SEQ ID NO.07 and SEQ ID NO.08.

Images