Universal light-operated CRISPR-Cas12a detection method based on crRNA'tailed self-silencing 'strategy

Abstract

The invention provides a universal light-operated CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-CRISPR-Cas12a) detection method based on a crRNA'tailed self-silencing 'strategy, one-pot quick detection of non-nucleic acid and nucleic acid targets can be realized, and detection is performed by adopting a target molecule incubation system comprising tailed self-closed crRNA, Cas12a, a nucleic acid amplification reaction system or aptamer and a G4 dimer system. According to the invention, the cutting activity of the CRISPR-Cas12a system is blocked by using the self-closed light-controlled crRNA, so that the cutting influence on a nucleic acid amplification reaction system or a target molecule incubation system is avoided; after the reaction is finished, removing tails of the tailed crRNA under the condition of UV illumination, and further restarting the cleavage activity of the system; the activated system cleaves the G4 dimer, so no strong fluorescence signal is generated. According to the method disclosed by the invention, the CRISPR-Cas12a system can be blocked without optimizing a crRNA (Complementary Ribonucleic Acid) blocking condition.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a universal light-controlled CRISPR-Cas12a detection method based on the crRNA "tailing self-silencing" strategy. Background Art

[0002] Under the guidance of CRISPR RNA (crRNA), Cas12a protein specifically recognizes and cuts double-stranded DNA targets, while activating efficient trans-cleavage activity. At present, CRISPR-Cas12a detection technology for nucleic acid and non-nucleic acid target detection still faces a key bottleneck problem: the cis- and trans-cleavage functions of CRISPR-Cas12a are incompatible with nucleic acid amplification reactions and aptamer-target incubation and binding reactions. This is mainly due to: the cis-cleavage function of CRISPR-Cas12a will lead to the loss of nucleic acid amplification templates; the trans-cleavage function will destroy the primers or aptamers of nucleic acid amplification, thereby affecting the amplification efficiency and detection sensitivity. Therefore, in the current detection steps, nucleic acid amplification, the incubation and binding process of aptamers and targets, and the CRISPR-Cas12a reaction are carried out in different test tubes or chambers. However, the two-step reaction requires liquid transfer, which increases the complexity of the detection process and the risk of cross-contamination. Therefore, it is of great research significance to develop a one-pot detection method for CRISPR-Cas12a that is compatible with nucleic acid amplification or target and aptamer incubation processes.

[0003] Several one-pot CRISPR detection strategies have been reported, such as using physical space to separate nucleic acid amplification or aptamer and target incubation and CRISPR reaction, optimizing CRISPR component concentration to reduce inhibition of nucleic acid amplification, and designing crRNA that is independent of the protospacer adjacent motif (PAM) site. However, these methods still require additional operation steps or complex microfluidic design. Light-controlled technology allows chemical reactions to be controlled in a very fast (usually a few seconds) and non-contact manner. Light-controlled CRISPR-Cas12a technology can activate the CRISPR system at a specific time, thereby achieving one-pot, one-step highly sensitive detection. Studies have reported a silencing oligonucleotide modified with a photocleavable linker (PC-linker) that can hybridize with crRNA, thereby blocking the recognition and trans-cleavage function of the target DNA of the CRISPR system, but this method requires optimizing the ratio of silencing oligonucleotide and crRNA to achieve complete hybridization and silencing of crRNA.

[0004] G-quadruplex (G4) is a functional nucleic acid nanostructure, which is a four-stranded self-assembly formed by folding a guanine (G)-rich DNA sequence. There are a few reports on CRISPR-Cas12a biosensing detection methods based on G4. G4 dimer (dG4) is a high-order quaternary structure. Studies have found that the fluorescence intensity of dG4 / ThT is about 9 times that of G4 / ThT, and the fluorescence intensity is not affected by high salt solutions. According to research, there are currently no reports on CRISPR-Cas12a biosensing detection technology based on dG4. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a universal light-controlled CRISPR-Cas12a detection method based on the crRNA "tailing self-silencing" strategy.

[0006] To achieve the above object, the present invention adopts the following technical solutions: A universal light-controlled CRISPR-Cas12a detection method based on the crRNA "tailing self-silencing" strategy, the method includes using the universal light-controlled CRISPR-Cas12a detection system, the crRNA is a self-closed light-controlled crRNA, the self-closed light-controlled crRNA is a "self-closed tail" added to the end of the crRNA, the "self-closed tail" contains both a light-cleavable PC-linker photosensitive molecule and a complementary base sequence that spontaneously forms a hairpin structure with the target binding sequence of the crRNA. Further, the sequence of the crRNA is SEQ ID NO.1: 5′–UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNN –3′ (the bold part UAAUUUCUACUCUUGUAGAU is a full-length direct repeat sequence (DR region) of 20 nt), the underlined N represents the spacer region that is complementary to the specific target sequence of the gene to be tested; the sequence of the “self-closed tail” is a base sequence N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′–3′ that is complementary to NNNNNNNNNNNNNNNNNNNN and spontaneously forms a hairpin structure, and N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′ is labeled with a PC-linker photosensitive molecule; there are 2 to 6 bases U between N and N′; N and N′ represent bases selected from C, G, U, and A.

[0007] The crRNA containing the "self-sealing tail" is extended at the 3' end of the crRNA, and its base sequence is AAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNNNNUUUUUN ' N ' N 'N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ′–3′, where the N sequence (spacer region) and N 'Sequences form complementary base pairing.

[0008] Furthermore, the length of the "self-sealing tail" is 10 to 25 bases, that is, the number of N is 10 to 25 nt.

[0009] The light-controlled crRNA containing a "self-sealing tail" (1) can "self-silence" the CRISPR system through the spontaneously formed "hairpin" structure with a PC-linker site, blocking the CRISPR system from cutting the nucleic acid amplification primer or aptamer, thus solving the incompatibility problem between nucleic acid amplification and the enzyme cleavage reaction of the CRISPR system; (2) The "hairpin" structure with a PC-linker site can be cut by UV light, and then the "tailed" crRNA will produce "detailed" and restart the enzyme cleavage function of the CRISPR system.

[0010] Among them, PC-linker is 2-nitrophenyl phosphodiester, a photocleavable spacer, a non-nucleoside molecule, which connects two nucleotide sequences through a C3 spacer arm that can be cleaved by short ultraviolet light and can be added at any position in the sequence; PC-linker can be quickly cleaved under specific short ultraviolet light to obtain a 5'-phosphorylated oligomer and a 3'-phosphorylated oligomer.

[0011] In the detection method as described above, preferably, the detection system of the universal light-controlled CRISPR-Cas12a also includes an aptamer (non-nucleic acid target) or an RPA system (nucleic acid target) and Cas12a and G4 dimer and a sample to be tested; during the detection, after irradiation with a 365 nm ultraviolet lamp, incubation at 37°C, thioflavin T (ThT) is added to each reaction tube, and after incubation at room temperature in the dark, the fluorescence signal intensity of the detection system is analyzed and the results are analyzed to calculate the content of the sample to be tested.

[0012] A method for detecting non-nucleic acid targets of Salmonella by universal light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy, characterized in that the detection system of the universal light-controlled CRISPR-Cas12a includes aptamer, Cas12a, self-enclosed light-controlled crRNA and G4 dimer and a bacterial solution sample to be tested; wherein the sequence of the aptamer is shown in SEQ ID NO.2, the sequence of the self-enclosed light-controlled crRNA is shown in SEQ ID NO.3, and the PC-linker photosensitive molecule is marked at the 41st base of its sequence and every 5 bases thereafter; During the detection, after irradiation with ultraviolet light, incubation is performed, and then Thioflavin T is added to each detection system. After incubation at room temperature in the dark, the fluorescence signal intensity of the detection system is detected and the results are analyzed to calculate the Salmonella content of the sample to be tested.

[0013] Furthermore, the ultraviolet light irradiation time is 1-2 min; the incubation time is 60-120 min at 35-40° C., and the light-proof incubation time is 15-30 min.

[0014] In the detection method as described above, preferably, the concentration of the aptamer is 25 nM.

[0015] A method for detecting Salmonella nucleic acid targets by universal light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy, characterized in that the detection system of the universal light-controlled CRISPR-Cas12a includes an RPA amplification system, Cas12a, a self-enclosed light-controlled crRNA, a G4 dimer and a DNA sample to be tested; the sequence of the self-enclosed light-controlled crRNA is shown in SEQ ID NO.4, and the PC-linker photosensitive molecule is marked at the 44th base of the sequence and every 6 bases thereafter; the RPA system includes upstream primers and downstream primers as shown in SEQ ID NO.5 and SEQ ID NO.6; During the detection, after irradiation with ultraviolet light, incubation is performed, and then Thioflavin T is added to each reaction tube. After incubation at room temperature in the dark, the fluorescence signal intensity of the system is detected and the results are analyzed.

[0016] In the detection method as described above, preferably, the ultraviolet light irradiation time is 1 to 2 min.

[0017] In the detection method as described above, preferably, after irradiation with ultraviolet light, the incubation is carried out at 35-40° C. for 60-120 min, and the incubation time in the dark is 15-30 min.

[0018] Preferably, the detection system is first shaken and mixed and then incubated at 37°C for 10 min; then irradiated with a UV lamp (λ365 nm, 35W) for 90 s and incubated at 37°C for 60-90 min.

[0019] Among them, RPA amplification was carried out using an RPA amplification kit, and the RPA amplification system was: 0.5 μL 10 μMprimer A (sequence: SEQ ID NO.5: CATCTGTTTACCGGGCATACCATCCAGAGAAAA), 0.5 μL 10 μMprimer B (sequence: SEQ ID NO.6: TGTTGTCTTCTCTATTGTCACCGTGGTCCAG), 0.5 μL 280 mM MgOAc), 6 μL rehydration buffer, 0.2 μL sample DNA and 2.5 μL water; the total reaction volume was 10 μL.

[0020] The beneficial effects of the present invention are: The novel light-controlled CRISPR-Cas12a detection technology provided by the present invention adopts a light-controlled CRISPR-Cas12a detection system including "tailed self-closing" light-controlled crRNA, Cas12a, a nucleic acid amplification reaction system or aptamer, a target molecule incubation system, and a G4 dimer-ThT (dG4-ThT) system; specifically, a "self-closing tail" is added to the end of the crRNA, and the "tail" contains both a light-cleavable PC-linker site and a complementary base sequence that spontaneously forms a hairpin structure with the target binding sequence of the crRNA.

[0021] The present invention utilizes self-enclosed crRNA, blocks the cutting activity of CRISPR-Cas12a system, avoids the cutting influence on nucleic acid amplification reaction system or aptamer, target molecule incubation system;After nucleic acid amplification or aptamer, target molecule incubation is finished, under the condition of UV illumination, self-enclosed light-controlled crRNA "takes off tail", and then restarts the cutting activity of CRISPR-Cas12a system;The activated CRISPR-Cas12a system cuts dG4, therefore no strong fluorescent signal is produced. The method provided by the present invention does not need to optimize the conditions closed by crRNA, and the CRISPR-Cas12a system can be blocked.

[0022] The novel light-controlled CRISPR-Cas12a detection technology provided by the present invention does not require optimization of the ratio of silencing oligonucleotides to crRNA, but only requires crRNA self-closure to achieve complete hybridization and silencing of crRNA. It is universal, simple to operate, and greatly shortens the detection time.

[0023] The universal light-controlled CRISPR-Cas12a one-pot detection technology constructed by the present invention is suitable for nucleic acid and non-nucleic acid target detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the principle of the one-pot method of light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy for the detection of nucleic acid and non-nucleic acid targets.

[0025] Figure 2 Schematic diagram of the structure of PC-linker photosensitive molecule.

[0026] Figure 3 This is a graph showing the effect of different UV illumination times on the activation efficiency of the CRISPR-Cas12a system.

[0027] Figure 4 This is a graph showing the effect of different incubation times on the cutting efficiency of the CRISPR-Cas12a system.

[0028] Figure 5 This is a graph showing the effect of different aptamer concentrations on the cutting efficiency of the CRISPR-Cas12a system.

[0029] Figure 6 This is the fluorescence spectrum result at different wavelengths for the one-pot detection of Salmonella non-nucleic acid targets using light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy.

[0030] Figure 7 This is a scatter plot of the one-pot method of light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy to detect non-nucleic acid targets of Salmonella.

[0031] Figure 8 This is the standard curve diagram of the one-pot method for detecting non-nucleic acid targets of Salmonella using light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy.

[0032] Fig. 9 This is a graph showing the results of a one-pot investigation of the specificity of detecting non-nucleic acid targets of Salmonella using the light-controlled CRISPR-Cas12a method based on the crRNA "tailing self-silencing" strategy.

[0033] Fig.10 This is the fluorescence spectrum result of different wavelengths for one-pot detection of Salmonella nucleic acid target by light-controlled CRISPR-Cas12a based on crRNA "tailing self-silencing" strategy.

[0034] Fig.11This is a scatter plot of Salmonella concentration and fluorescence value for the one-pot detection of Salmonella nucleic acid targets by light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy.

[0035] Fig.12 This is the standard curve result of the one-pot method of light-controlled CRISPR-Cas12a for detecting Salmonella nucleic acid targets based on the crRNA "tailing self-silencing" strategy.

[0036] Fig.13 This is a graph showing the results of an investigation into the specificity of the one-pot method for detecting Salmonella nucleic acid targets using light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy. DETAILED DESCRIPTION

[0037] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0038] If not otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the present invention are all analytically pure or above, and commercially available products can be used.

[0039] Example 1 Light-controlled CRISPR mechanism based on crRNA "tailing self-silencing" strategy The light-controlled CRISPR mechanism based on the crRNA "tailing self-silencing" strategy provided by the present invention is as follows: Figure 1 As shown: (1) Nucleic acid target detection: When the sample contains the target object, the target nucleic acid is first amplified by the RPA system; after the amplification is completed, it is irradiated with UV light to break the tail of the self-silencing light-controlled crRNA; the RPA amplification product activates the CRISPR-Cas12a system (crRNA-Cas12a), and then trans-cuts dG4, thereby hindering the formation of the dG4-ThT complex and generating a weak fluorescence signal. Conversely, when the sample does not contain the target object, the RPA amplification product cannot activate the CRISPR-Cas12a system, so there is a large amount of dG4, which in turn forms a high concentration of dG4-ThT complex, which also generates a high-intensity fluorescence signal.

[0040] (2) Non-nucleic acid target detection: When the sample contains the target object, the target molecule first binds to the aptamer; when the binding is completed, it is also irradiated with UV light, and the tail of the self-silencing light-controlled crRNA is broken; because the aptamer binds to the target molecule, it cannot activate the CRISPR-Cas12a system, so there is a large amount of dG4, which in turn forms a high concentration of dG4-ThT complex, and also produces a high-intensity fluorescent signal. Conversely, when the sample does not contain the target object, the aptamer can fully activate the CRISPR-Cas12a system and then trans-cut dG4, thereby hindering the formation of the dG4-ThT complex and producing a weak fluorescent signal.

[0041] In the present invention, a complementary sequence containing a PC-linker light-controlled site is extended at the end of crRNA to form a light-controlled crRNA containing a "self-closing tail". Specifically, the design of the self-closing light-controlled crRNA is as follows: the crRNA contains a 20 nt direct repeat sequence (DR region) and a guide sequence (spacer region) with a length of 20 to 25 nt that is complementary to the specific target sequence of the gene to be tested. The "self-closing tail" is a base sequence that is complementary to the guide sequence and spontaneously forms a hairpin structure, and the complementary sequence is labeled with a PC-linker photosensitive molecule every 4 to 6 bases; there are 3 to 6 bases U between the guide sequence and the complementary sequence.

[0042] The designed crRNA sequence is as follows SEQ ID NO.1: 5′–UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNN NNNNNNN –3′ (the bold part is the full-length 20 nt direct repeat sequence (DR region), and the underline indicates the spacer region that is complementary to the specific target sequence). The tailed self-sealed light-controlled crRNA is extended to the 3′ end of the crRNA, and its base sequence can be UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNNNNUUUUUN ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N′–3′, where the N sequence is the spacer region, which is complementary to the target DNA or partial sequence of the aptamer; the tailed and extended N′ sequence forms a base complementary pair with the N sequence, and there are 2 to 6 base Us between the N sequence and the N′ sequence, which helps the sequences to form complementary sequences, and after the N sequence, a PC-linker photosensitive molecule is labeled every 4 to 6 bases. Among them, the PC-linker photosensitive molecule is 2-nitrophenyl phosphodiester, which is a photo-cleavable spacer and a non-nucleoside molecule. It connects two nucleotide sequences through a C3 spacer arm that can be cleaved by short ultraviolet light and can be added at any position in the sequence; PC-linker can be quickly cleaved under specific short ultraviolet light to obtain a 5'-phosphorylated oligomer and a 3'-phosphorylated oligomer. The specific structure is as follows Figure 2 shown.

[0043] Example 2 Effect of UV illumination time on activation efficiency of CRISPR-Cas12a system Taking the detection of non-nucleic acid targets of Salmonella as an example, the sequence of the tailed self-sealed light-controlled crRNA is designed as SEQ ID NO.3: UAAUUUCUACUAAGUGUAGAUCCCCGUCGGGUGACGCCGCC (PC-1inker)UUUUU(PC-1inker)GGCGG(PC-1inker)CGUCA(PC-1inker)CCCGA(PC-1inker)CGGGG.

[0044] 10 µL 125 nM Salmonella aptamer (SEQ ID NO.2: TATGGCGGCGTCACCCGACGGGGATTGACATTATGACAG, synthesized by Bio-engineering), 5 µL 500 nM Cas12a, 5 µL 500 nM self-enclosed light-controlled crRNA, (Cas12a was purchased from NEB, and the sequence of self-enclosed light-controlled crRNA was as above, synthesized by Bio-engineering) and 10 µL 5 μM G4 dimer (G4 dimer, synthesized by Bio-engineering) were added to the centrifuge tube, and then filled to 200 µL with 10 mM Tris-HCl buffer. After irradiation with 365 nm UV light for 0, 30, 60, 90, 120, 180, 240, and 300 s, incubated at 37°C for 1 h. 2.5 μL 1 mM Thioflavin T (ThT) was added to each tube and incubated at room temperature in the dark for 30 min. The fluorescence intensity of G4dimer / ThT was measured by an ELISA instrument. The specific results are shown in Figure 3 . Figure 3 The horizontal axis is the UV light irradiation time, and the vertical axis is the fluorescence value. From the results obtained, it can be seen that the optimal UV irradiation time is 90 s.

[0045] Example 3 Effect of incubation time on the cleavage efficiency of the CRISPR-Cas12a system Take the detection of non-nucleic acid targets of Salmonella as an example. Add 10 µL 125 nM Salmonella aptamer, 5 µL 500 nM Cas12a, 5 µL 500 nM self-blocking photocontrolled crRNA, and 10 µL 5 μM G4 dimer to the centrifuge tube, and then fill it up to 200 µL with 10 mM Tris-HCl buffer. The sequence of the photocontrolled crRNA is the same as in Example 2. After irradiation with a 365 nm UV lamp for 30 seconds, incubate at 37°C for 0, 30, 60, 90, 120, and 150 min. Next, add 2.5 μL 1 mM thioflavin T (ThT) to each tube and incubate at room temperature in the dark for 30 min. The fluorescence intensity of G4 dimer / ThT was measured using an enzyme reader. The specific results are shown in Figure 4 . Figure 4 The horizontal axis is the incubation time, and the vertical axis is the fluorescence value. From the results, we can see that the best incubation time is 120 min. In addition, we found that the fluorescence intensity at 90 min is close to that at 120 min. In order to shorten the detection time, we chose an incubation time of 90 min.

[0046] Example 4 Effect of aptamer concentration on the cleavage efficiency of the light-controlled CRISPR-Cas12a system Take the non-nucleic acid target detection of Salmonella as an example.

[0047] Add 10 µL of 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM and 0 nM aptamer to the centrifuge tubes respectively; add 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-sealed light-controlled crRNA, and 10 µL of 5 μM dG4 to each centrifuge tube; fill up to 200 µL with 10 mM Tris-HCl buffer, the sequence of the light-controlled crRNA is the same as in Example 2. Subsequently, irradiate with a 365 nm ultraviolet lamp for 90 s and incubate at 37°C for 90 min. Next, add 2.5 μL of 1 mM thioflavin T (ThT) to each tube and incubate at room temperature in the dark for 30 min. The fluorescence intensity of G4 dimer / ThT was measured using an enzyme reader, and the specific results are shown in Figure 5From the obtained results, it can be seen that the optimal aptamer concentration is 500 nM, so the final concentration of aptamer is about 25 nM. The aptamer sequence of Salmonella is SEQ ID NO.2: TATGGCGGCGTCACCCGACGGGGATTGACATTATGACAG.

[0048] Example 5 Salmonella non-nucleic acid target detection Add 80 μL of different concentrations of Salmonella (0, 1.7×10 1 , 1.7×10 2 , 1.7×10 3 , 1.7×10 4 , 1.7×10 5 , 1.7×10 6 , 1.7×10 7 CFU / mL), and then add 10 µL 500 nM aptamer, 5 µL 500 nM Cas12a, 5 µL 500 nM self-enclosed light-controlled crRNA, 10 µL 5 µM G4 dimer and 167.5 µL 10mM Tris-HCl buffer (containing 100 mM NaCl and 20 mM MgCl2), the sequence of the light-controlled crRNA is the same as in Example 2. After oscillation and mixing, incubate at 37°C for 10 min. Then irradiate with UV light (λ 365 nm, 35 W) for 90 s and incubate at 37°C for 90 min. Finally, add 2.5 µL 1mM thioflavin T (ThT) to each centrifuge tube, incubate at room temperature in the dark for 30 min, and detect the fluorescence signal intensity of the G4dimer / ThT complex at different wavelengths under different concentrations of Salmonella.

[0049] Plot different wavelengths as the horizontal axis and the fluorescence signal intensity detected at different wavelengths as the vertical axis. The test results are shown in Figure 6 As shown, it shows that as the concentration of Salmonella increases from 0 to 1.7×10 7 CFU / mL, the fluorescence intensity of G4 dimer / ThT gradually increased, and had a higher fluorescence intensity at 490 nm. 1 to 1.7×10 7 The linear relationship is shown in the range of CFU / mL, and the logarithm of the Salmonella concentration is taken as the horizontal axis (IgC), and the corresponding 490 nm wavelength fluorescence intensity is taken as the horizontal axis. The scatter plot is shown in Figure 7 As shown, the standard curve was drawn at the same time, and the linear equation was: FI = 2055.33 lgC +17151.64, R 2 =0.998, e.g. Figure 8 As shown, the lowest detection limit of Salmonella was 13 CFU / mL.

[0050] Example 6 Specificity of detecting non-nucleic acid targets of Salmonella 10 µL 500 nM aptamer, 5 µL 500 nM Cas12a, 5 µL 500 nM light-controlled crRNA, 10 µL 5 μM G4 dimer and 87.5 µL 10 mM Tris-HCl were added to the centrifuge tube in sequence, and then 80 µL 1.7×10 5 CFU / mL Staphylococcus aureus (J), Escherichia coli (D), Salmonella (S) and their mixtures J+D, S+J, S+D, incubated at 37°C for 10 min, the sequence of the light-controlled crRNA was the same as in Example 2. Then irradiated with UV light for 90 s. Then incubated at 37°C for 90 min. Finally, 2.5 µL 1mM ThT was added to each centrifuge tube. After incubation at room temperature in the dark for 30 min, the fluorescence signal intensity of G4 dimer / ThT corresponding to different foodborne pathogens at a wavelength of 490 nm was measured. From the results obtained Fig. 9 It can be seen that the fluorescence intensity of the sample containing Salmonella (S) is the highest, and the fluorescence intensity value of the non-target foodborne pathogens is similar to that of the negative control group. Therefore, it is verified that this method has good detection specificity.

[0051] Example 7 Practical Applicability of Detecting Non-Nucleic Acid Targets of Salmonella The practical applicability of the method was evaluated by spiking milk, pre-cut vegetables, and chicken with Salmonella Typhimurium. The final concentration of Salmonella in each sample was 1.7 × 10 2 , 1.7×10 3 and 1.7×10 4CFU / mL. According to the operation in Example 5, 80 µL of the spiked test sample was added to the test sample in the centrifuge tube, and then 10 µL 500 nM aptamer, 5 µL 500 nM Cas12a, 5 µL 500 nM light-controlled crRNA, 10 µL 5 µM G4dimer and 87.5 µL 10 mM Tris-HCl (100 mM NaCl, 20 mM MgCl2, PH7.5) were added, wherein the sequence of the light-controlled crRNA is the same as in Example 2. After oscillation and mixing, incubate at 37°C for 10 min. Then irradiate with a UV lamp (λ 365 nm, 35 W) for 90 s and incubate at 37°C for 90 min. Finally, 2.5 µL 1mM thioflavin T (ThT) was added to each centrifuge tube, and after incubation at room temperature in the dark for 30 minutes, the fluorescence signal intensity of the G4 dimer / ThT complex at a wavelength of 490 nm was detected. The measured fluorescence signal intensity of the sample was substituted into the linear equation in Example 5 to obtain the Salmonella in the sample to be tested. The results are shown in Table 1.

[0052] As can be seen from the results in Table 1, the recovery rates of Salmonella were 97.06% to 108.41%, which further demonstrates that this method has good practical applicability.

[0053] Table 1 Practical application investigation

[0054] Example 8 Detection of Salmonella nucleic acid targets The sequence of the self-sealing light-controlled crRNA for the Salmonella nucleic acid target was designed as SEQ ID NO.4: UAAUUUCUACUAAGUGUAGAUCCGGGCAUACCAUCCAGAGAAAA (PC-linker) UUUUUU (PC-linker) CUCUGG (PC-linker) AUGGUA (PC-linker) UGCCCG.

[0055] The nucleic acid RPA amplification system was performed using an RPA amplification kit, including 0.5 μL 10 μM primer A (sequence: SEQ ID NO.5: CATCTGTTTACCGGGCATACCATCCAGAGAAAA), 0.5 μL 10 μM primer B (sequence: SEQ ID NO.6: TGTTGTCTTCTCTATTGTCACCGTGGTCCAG), 0.5 μL 280 mM MgOAc), 6 μL rehydration buffer, 0.2 μL sample DNA and 2.5 μL water, with a total reaction volume of 10 μL.

[0056] Add 10 µL of RPA amplification system to a centrifuge tube, and then add 5 µL of 500 nM Cas12a, 5 µL of 500nM self-enclosed light-controlled crRNA, 10 µL of 5 μM G4 dimer and 167.5 µL of 10 mM Tris-HCl buffer (containing 100mM NaCl, 20 mM MgCl2). After oscillation and mixing, incubate at 39°C for 20 min. Then irradiate with UV light for 90 s and incubate at 37°C for 90 min. Finally, add 2.5 µL of 1mM ThT, incubate at room temperature in the dark for 30 min, and measure the fluorescence intensity of the G4 dimer / ThT complex under different concentrations of Salmonella at 490 nm using an enzyme reader. Among them, different concentration gradients of Salmonella DNA (0, 1.7×10 1 , 1.7×10 2 , 1.7×10 3 , 1.7×10 4 , 1.7×10 5 , 1.7×10 6 , 1.7×10 7 CFU / mL) for detection.

[0057] Draw a curve with different wavelengths as the horizontal axis and fluorescence intensity as the vertical axis. The results obtained are as follows Fig.10 As can be seen from the figure, with the increase of Salmonella concentration, the fluorescence intensity of G4 dimer / ThT complex gradually decreases, and the fluorescence intensity is the highest at 490nm; and the logarithm of Salmonella concentration is taken as the horizontal axis (lgC), and the corresponding 490nm wavelength fluorescence intensity is taken as the horizontal axis, and the scatter plot is drawn as follows Fig.11 As shown, a standard curve was drawn at 1.7×10 1 to 1.7×10 8 There is a linear relationship within the range of CFU / mL, such as Fig.12 As shown, the linear equation is: FI = -2339.66 lgC + 33117.69, R 2 =0.995, and the minimum detection limit of Salmonella was 4 CFU / mL.

[0058] Example 9 Specificity of detecting Salmonella nucleic acid targets The sequence of the Salmonella nucleic acid target self-sealing light-controlled crRNA was designed as UAAUUUCUACUAAGUGUAGAUCCGGGCAUACCAUCCAGAGAAAA (PC-linker) UUUUUU (PC-linker) CUCUGG (PC-linker) AUGGUA (PC-linker) UGCCCG.

[0059] The nucleic acid RPA amplification system is the same as that in Example 8.

[0060] 5 µL 500 nM Cas12a, 5 µL 500 nM self-sealed light-controlled crRNA, 10 µL 5 μM G4 dimer and 167.5 µL 10 mM Tris-HCl buffer (containing 100 mM NaCl, 20 mM MgCl2) were added to the centrifuge tube in sequence, and then 10 µL 1.7×10 5 The nucleic acid RPA amplification system of Staphylococcus aureus (J), Escherichia coli (D), Salmonella (S) and their mixtures J+D, J+S, and S+D at CFU / mL concentration was incubated at 39°C for 20 min. After UV irradiation for 90 s, it was incubated at 37°C for 90 min. Finally, 2.5 µL of 1 mM ThT was added to each centrifuge tube. After incubation at room temperature in the dark for 30 min, the fluorescence intensity of the G4 dimer / ThT complex corresponding to different foodborne pathogens was detected at a wavelength of 490 nm.

[0061] The results are as follows Fig.13 It can be seen that the fluorescence intensity of the sample containing Salmonella (S) is the lowest, and the fluorescence intensity value of the non-target foodborne pathogens is similar to that of the negative control group. Therefore, it is verified that this method has good detection specificity and strong specificity.

[0062] Example 10 Practical applicability of detecting Salmonella nucleic acid targets The practical applicability of the method was also evaluated by spiking Salmonella Typhimurium in milk, pre-cut vegetables, and chicken samples. The final concentration of Salmonella in each sample was 1.7 × 10 2 , 1.7×10 3 and 1.7×10 4CFU / mL, then extract DNA, and configure the RPA amplification system according to Example 8. Add 10 µL of RPA amplification system (same as Example 8) to the centrifuge tube, and then add 5 µL of 500 nM Cas12a, 5 µL of 500 nM self-enclosed light-controlled crRNA (same as Example 8), 10 µL of 5μM G4 dimer and 167.5 µL of 10 mM Tris-HCl buffer (containing 100 mM NaCl, 20 mM MgCl2). After oscillation and mixing, incubate at 39 ° C for 20 min. Then irradiate with UV light for 90 s and incubate at 37 ° C for 90 min. Finally, add 2.5 µL of 1mM ThT respectively, incubate at room temperature in the dark for 30 min, and measure the fluorescence intensity of the G4 dimer / ThT complex under different concentrations of Salmonella at a wavelength of 490 nm using an ELISA reader. According to the linear equation obtained in Example 8, the recovery rate of Salmonella in each test sample can be obtained, and the results are shown in Table 2.

[0063] Table 2 Investigation on the practical applicability of Salmonella nucleic acid detection

[0064] As can be seen from the result table 2, the recovery rate of Salmonella is 93.14% to 118.45%, which further illustrates that the detection method of the invention has good practical applicability.

Claims

1. A universal light-controlled CRISPR-Cas12a detection method based on crRNA "tailing self-silencing" strategy, characterized in that: The method uses a universal light-controlled CRISPR-Cas12a detection system in which the crRNA is a self-closed light-controlled crRNA, which has a "self-closed tail" added to the end of the crRNA. The "self-closed tail" contains both a light-cleavable PC-linker photosensitive molecule and a complementary base sequence that spontaneously forms a hairpin structure with the target binding sequence of the crRNA.

2. The detection method according to claim 1, characterized in that: The sequence of crRNA is SEQ ID NO.1: 5′–UAAUUUCUACUCUUGUAGAU NNNNNNNNNNNNNNNNNNNN –3′, where the underlined part represents the guide sequence that is complementary to the specific target sequence of the gene to be tested, and the sequence of the "self-closed tail" is a base sequence 5′–N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′N′–3′ that is complementary to the guide sequence and spontaneously forms a hairpin structure, and the complementary sequence is labeled with PC-linker photosensitive molecules every 4 to 6 bases; there are 2 to 6 bases U between N and N′; N and N′ represent bases selected from C, G, U, and A.

3. The detection method according to claim 1 or 2, characterized in that: The length of the "self-sealing tail" is 10~25 bases.

4. The detection method according to claim 1, characterized in that: PC-linker is 2-nitrophenyl phosphodiester.

5. The detection method according to claim 1, characterized in that: The universal light-controlled CRISPR-Cas12a detection system also includes an aptamer or RPA system, Cas12a and G4 dimer and a sample to be tested. During the detection, the sample is irradiated with ultraviolet light and incubated. Thioflavin T is then added to each reaction tube. After incubation at room temperature in the dark, the fluorescence signal intensity of the system is detected and the results are analyzed.

6. A method for detecting non-nucleic acid targets of Salmonella using a universal light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy, characterized in that: The detection system of universal light-controlled CRISPR-Cas12a includes aptamer, Cas12a, self-enclosed light-controlled crRNA, G4 dimer and a bacterial solution sample to be tested; wherein the sequence of aptamer is shown in SEQ ID NO.2; the sequence of self-enclosed light-controlled crRNA is shown in SEQ ID NO.3, and PC-linker photosensitive molecules are marked at the 41st base of its sequence and every 5 bases thereafter; During the detection, after irradiation with ultraviolet light, incubation is performed, and then Thioflavin T is added to each reaction tube. After incubation at room temperature in the dark, the fluorescence signal intensity of the detection system is detected and the results are analyzed to calculate the Salmonella content of the sample to be tested.

7. The detection method according to claim 6, characterized in that: The ultraviolet light irradiation time is 1-2 min; the incubation time is 60-120 min at 35-40° C., and the light-proof incubation time is 15-30 min.

8. A method for detecting Salmonella nucleic acid targets using a universal light-controlled CRISPR-Cas12a based on the crRNA "tailing self-silencing" strategy, characterized in that: The detection system of universal light-controlled CRISPR-Cas12a includes an RPA system, Cas12a, self-enclosed light-controlled crRNA, G4 dimer and a sample to be tested; the sequence of the self-enclosed crRNA is shown in SEQ ID NO.4, and the PC-linker photosensitive molecule is marked at the 44th base of the sequence and every 6 bases thereafter; the RPA system includes an upstream primer and a downstream primer as shown in SEQ ID NO.5 and SEQ ID NO.6; During the detection, after irradiation with ultraviolet light, incubation is performed, and then Thioflavin T is added to each detection system. After incubation at room temperature in the dark, the fluorescence signal intensity of the detection system is detected and the results are analyzed.

9. The detection method according to claim 8, characterized in that: The UV lamp irradiation time is 1 to 2 min.

10. The detection method according to claim 8, characterized in that: After the ultraviolet light irradiation, the incubation time is 60-120 min at 35-40° C., and the incubation time in the dark is 15-30 min.

Images