A gastric cancer early diagnosis biomarker combination and a detection reagent and application thereof

Abstract

The application provides a gastric cancer early diagnosis biomarker combination, a detection reagent and application thereof, and belongs to the technical field of biological detection.The biomarker combination provided by the application is composed of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.The sensitivity, specificity and accuracy of the kit prepared by using the biomarker combination of the application can reach 92.00%, 96.67% and 93.75% respectively, and the operation is gradually rapid.The application provides technical support for further development of accurate and efficient gastric cancer early diagnosis reagents.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a combination of biomarkers for the early diagnosis of gastric cancer, its detection reagents, and applications. Background Technology

[0002] Gastric cancer (GC) is one of the most common tumors of the digestive tract, a malignant tumor originating from the gastric mucosal epithelium. In recent years, the incidence and mortality rates of gastric cancer have remained among the highest globally, seriously endangering human health. Clinically, gastric cancer is classified into two types based on the depth of tumor invasion: early gastric cancer (EGC) and advanced gastric cancer (AGC). Early gastric cancer, with early and accurate diagnosis and effective endoscopic treatment, can potentially be cured. However, EGC patients often lack typical clinical symptoms, making them easily misdiagnosed as other gastric diseases. Even when symptoms are present, they are often mild and easily overlooked. Patients often only seek medical attention when significant discomfort develops, resulting in many patients already having advanced gastric cancer at their first visit. By this time, the optimal treatment window has often been missed, leading to a poor prognosis.

[0003] Currently, conventional white light endoscopy combined with endoscopic biopsy is the most commonly used method for diagnosing gastric cancer (EGC). It offers advantages such as ease of operation, low technical requirements, and relatively low cost, making it the preferred screening method for EGC. Early gastric cancer lesions are superficial, often appearing under white light endoscopy as slight color changes, vascular changes, or roughness and erosion of the mucosa, making them difficult to distinguish from inflammatory lesions. The clarity and magnification of mucosal images under conventional white light endoscopy are limited, making it impossible to accurately locate the sampling site for malignant lesions. Biopsy has a certain degree of randomness and blindness; deviations in the biopsy sampling location can cause discrepancies between the pathological diagnosis of inflammation and early gastric cancer, easily leading to missed diagnoses of early gastric cancer and directly affecting the patient's prognosis. Studies show that there are still certain differences between endoscopic biopsy specimens and subsequent resection specimens. Some lesions cannot be correctly diagnosed through tissue biopsy, making it difficult to choose the correct treatment method. Inaccurate endoscopic biopsy specimen collection may miss potential malignant structures, leading to misdiagnosis and inappropriate treatment strategies.

[0004] Therefore, improving the detection rate of EGC is a major challenge that urgently needs to be addressed. The key to improving the prognosis and survival of gastric malignancies lies in achieving "three earlys": early detection, early diagnosis, and early, effective treatment. Finding reliable and non-invasive early diagnostic methylation sites for the early detection and large-scale screening of gastric cancer has significant clinical implications. Summary of the Invention

[0005] To address the aforementioned shortcomings, this invention aims to provide a biomarker combination for early diagnosis of gastric cancer, along with its detection reagents and applications. The biomarker combination provided by this invention consists of chr8:53852064, chr12:10541790, chr14:22931150, and chr16:58497231. The reagent kit prepared using the biomarker combination of this invention achieves sensitivity, specificity, and accuracy of 92.00%, 96.67%, and 93.75%, respectively, and the operation is gradual and rapid. This invention provides technical support for the further development of accurate and efficient early diagnostic reagents for gastric cancer.

[0006] The technical solution of the present invention includes:

[0007] In a first aspect, the present invention provides a biomarker combination consisting of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.

[0008] Secondly, the present invention provides a detection reagent for detecting the methylation status of a combination of biomarkers, the detection reagent comprising primers and probes, wherein the combination of methylated biomarkers consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.

[0009] Specifically, the nucleotide sequences of the primers are shown in SEQ ID NO.1-8.

[0010] Preferably, the nucleotide sequence of the forward primer of chr8:53852064 is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.

[0011] Preferably, the nucleotide sequence of the forward primer of chr12:10541790 is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4.

[0012] Preferably, the nucleotide sequence of the forward primer of chr14:22931150 is shown in SEQ ID NO.5, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6.

[0013] Preferably, the nucleotide sequence of the forward primer of chr16:58497231 is shown in SEQ ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.8.

[0014] Specifically, the nucleotide sequence of the probe is shown in SEQ ID NO.9-12.

[0015] Preferably, the nucleotide sequence of the probe of chr8:53852064 is shown in SEQ ID NO.9.

[0016] Preferably, the nucleotide sequence of the probe of chr12:10541790 is shown in SEQ ID NO.10.

[0017] Preferably, the nucleotide sequence of the probe of chr14:22931150 is shown in SEQ ID NO.11.

[0018] Preferably, the nucleotide sequence of the probe of chr16:58497231 is shown in SEQ ID NO.12.

[0019] Specifically, the probe can be labeled with a fluorescent group or a quencher group at its 5' or 3' end.

[0020] Preferably, the probe is labeled with a fluorescent group at the 5' end and a quenching group at the 3' end.

[0021] More preferably, the fluorescent group is FAM; the quenching group is BHQ1.

[0022] Specifically, the final concentration of primers and probes in the detection reagent is 50-200 nM.

[0023] Preferably, the final concentration of the primer for chr8:53852064 is 100 nM, and the final concentration of the probe is 150 nM.

[0024] Preferably, the final concentration of the primer for chr12:10541790 is 100 nM, and the final concentration of the probe is 150 nM.

[0025] Preferably, the final concentration of the primer for chr14:22931150 is 100 nM, and the final concentration of the probe is 150 nM.

[0026] Preferably, the final concentration of the primer for chr16:58497231 is 200 nM, and the final concentration of the probe is 200 nM.

[0027] Thirdly, the present invention provides the application of the above-mentioned combination of biomarkers or detection reagents in the preparation of early diagnostic kits for gastric cancer.

[0028] Fourthly, the present invention provides a kit for the early diagnosis of gastric cancer, the kit comprising the above-mentioned combination of biomarkers or detection reagents.

[0029] Specifically, the kit also includes one or more of the following: DNA polymerase, dNTPs, PCR reaction buffer, positive control, and negative control.

[0030] Preferably, the positive control is bisulfite-modified fully methylated human genomic DNA.

[0031] Preferably, the negative control is nonmethylated human genomic DNA modified with bisulfite.

[0032] The beneficial effects of this invention are as follows:

[0033] The reagent kit prepared using the biomarker combination of this invention achieves sensitivity, specificity, and accuracy of 92.00%, 96.67%, and 93.75%, respectively, and the operation is gradual and rapid. This invention provides technical support for the further development of accurate and efficient early diagnostic reagents for gastric cancer. Specific Implementation

[0034] The present invention will be described below with reference to specific embodiments. These embodiments are not intended to limit the present invention, but only to illustrate the present invention and make the technical solution of the present invention easier to understand and master. Unless otherwise specified, the experimental methods described in the following embodiments are conventional methods; the reagents and materials described are commercially available unless otherwise specified.

[0035] Example 1: Biomarker Combinations and Their Primers and Probes

[0036] This invention provides a biomarker combination for early diagnosis of gastric cancer, consisting of chr8:53852064, chr12:10541790, chr14:22931150, and chr16:58497231. The primer sequences of the biomarker combination are shown in Table 1, and the probe sequences are shown in Table 2.

[0037] Table 1 Primer and probe sequences for biomarkers

[0038]

[0039] Note: In the table, "F" represents the forward primer and "R" represents the reverse primer.

[0040] Table 2 Primer and probe sequences for biomarkers

[0041]

[0042]

[0043] Example 2: Preparation and Use of Early Gastric Cancer Diagnostic Kit

[0044] The gastric cancer early diagnostic kit of the present invention includes a PCR premix, a positive control, and a negative control. The positive control is bisulfite-modified fully methylated human genomic DNA, and the negative control is bisulfite-modified unmethylated human genomic DNA.

[0045] 1. Preparation of primer-probe mixture:

[0046] Prepare the primer-probe mixture according to the components in Table 3.

[0047] Table 3 Primer-Probe Mixture

[0048]

[0049] Note: In the table, "F" represents the forward primer, "R" represents the reverse primer, and "P" represents the probe.

[0050] The nucleotide sequence of the forward primer of the ACTB internal control is shown in SEQ ID NO.13, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.14, and the nucleotide sequence of the probe is shown in SEQ ID NO.15.

[0051] SEQ ID NO.13: TGGTGATGGAGGAGGTTTAGTAAGT;

[0052] SEQ ID NO.14: AACCAATAAAAACCTACTCCTCCCTTAAA;

[0053] SEQ ID NO.15: VIC-ACCACCACCCAACACACAATAACAAACACA-BHQ1

[0054] 2. Preparation of PCR premix:

[0055] Prepare the PCR premix according to the components in Table 4.

[0056] Table 4 PCR Premix

[0057] Components Volume (μL) Final concentration 4× Primer-Probe Blocking Agent Mixture 5 1× 4× enzyme mixture 5 1× Total reaction volume 10 none

[0058] The enzyme mixture comprises 10×PCR buffer, MgCl2, dNTPs and DNA polymerase, with a volume ratio of 10×PCR buffer, MgCl2, dNTPs and DNA polymerase of 10:6:2:1.

[0059] 3. PCR amplification

[0060] The amplification system of this invention is shown in Table 4:

[0061] Table 4 PCR amplification system

[0062] Components volume premixed liquid 5μL DNA 1μL <![CDATA[ddH2O]]> 4μL

[0063] The PCR amplification procedure of this invention is shown in Table 5:

[0064] Table 5 PCR amplification program

[0065]

[0066] 4. PCR result interpretation criteria

[0067] The criteria for interpreting PCR results are as follows:

[0068] A Ct value ≤ 35 for the VIC fluorescence channel indicates a valid experiment; if the Ct value > 35 or there is no amplification, the experiment is invalid and needs to be repeated.

[0069] Positive interpretation: ΔCt > 2.0157 and the FAM channel amplification curve is S-shaped;

[0070] Negative interpretation: ΔCt≤2.0157 or no amplification in the FAM channel;

[0071] ΔCt = Ct value of VIC fluorescence channel / Ct value of FAM fluorescence channel.

[0072] Comparative Example 1: Preparation and Use of Early Diagnostic Kit for Gastric Cancer

[0073] The only difference between Comparative Example 1 and Example 2 is: "1. Preparation of primer-probe mixture".

[0074] Prepare the primer-probe mixture according to the components in Table 6.

[0075] Table 6 Primer-Probe Mixture

[0076]

[0077] Note: In the table, "F" represents the forward primer, "R" represents the reverse primer, and "P" represents the probe.

[0078] Comparative Example 2: Preparation and Use of Early Diagnostic Kit for Gastric Cancer

[0079] The only difference between Comparative Example 2 and Example 2 is: "1. Preparation of primer-probe mixture".

[0080] Prepare the primer-probe mixture according to the components in Table 7.

[0081] Table 7 Primer-Probe Mixture

[0082]

[0083]

[0084] Note: In the table, "F" represents the forward primer, "R" represents the reverse primer, and "P" represents the probe. Comparative Example 3: Preparation and Use of the Early Gastric Cancer Diagnostic Kit

[0085] The only difference between Comparative Example 3 and Example 2 is: "1. Preparation of primer-probe mixture". The primer-probe mixture was prepared according to the components in Table 8.

[0086] Table 8 Primer-Probe Mixture

[0087]

[0088] Note: In the table, "F" represents the forward primer, "R" represents the reverse primer, and "P" represents the probe. Example 1: Application of the Early Diagnostic Kit for Gastric Cancer

[0089] The study subjects in this embodiment were 50 patients with histopathologically confirmed gastric cancer and 30 healthy volunteers. 3 mL of blood was collected from each subject, peripheral blood mononuclear cells were isolated, genomic DNA was extracted and subjected to sulfite conversion, and PCR amplification and detection were performed using the kits prepared in Example 2 and Comparative Examples 1-3, respectively. The results are shown in Table 9.

[0090] Table 9 Measurement Results

[0091]

[0092] The test results show that the kit prepared in Example 2 of this invention has the highest sensitivity, specificity and accuracy, which are 92.00%, 96.67% and 93.75% respectively, and can be used for the early diagnosis of gastric cancer.

[0093] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. A detection reagent for detecting the methylation status of a combination of biomarkers, characterized in that, The detection reagent includes primers and probes, and the methylation biomarker combination consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231; the nucleotide sequences of the primers are shown in SEQ ID NO.1-8; The nucleotide sequence of the forward primer for chr8:53852064 is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer for chr12:10541790 is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; The nucleotide sequence of the forward primer for chr14:22931150 is shown in SEQ ID NO.5, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6; The nucleotide sequence of the forward primer of chr16:58497231 is shown in SEQ ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.8; The nucleotide sequences of the probes are shown in SEQ ID NO.9-12; The nucleotide sequence of the probe for chr8:53852064 is shown in SEQ ID NO.9; The nucleotide sequence of the probe for chr12:10541790 is shown in SEQ ID NO.10; The nucleotide sequence of the probe for chr14:22931150 is shown in SEQ ID NO.11; The nucleotide sequence of the probe chr16:58497231 is shown in SEQ ID NO.

12.

2. The detection reagent according to claim 1, characterized in that, The probe is labeled with a fluorescent group at the 5' end and a quenching group at the 3' end.

3. The detection reagent according to claim 2, characterized in that, The fluorescent group is FAM; the quenching group is BHQ1.

4. The detection reagent according to claim 1, characterized in that, The final concentration of primers and probes in the detection reagent is 50-200 nM.

5. The use of the detection reagent according to any one of claims 1-4 in the preparation of a gastric cancer early diagnostic kit.

6. A reagent kit for early diagnosis of gastric cancer, characterized in that, The kit includes the detection reagents as described in any one of claims 1-4.

7. The reagent kit according to claim 6, characterized in that, The kit also includes one or more of the following: DNA polymerase, dNTPs, PCR reaction buffer, positive control, and negative control.

Images