Application of substance for detecting serum exosome non-coding miRNA in preparation of detection product for prognosis of bile duct cancer

Abstract

The invention belongs to the technical field of biology and medicine, and particularly relates to application of a substance for detecting serum exosome non-coding miRNA in preparation of a detection product for prognosis of bile duct cancer. The marker is a serum exosome miRNA (micro Ribonucleic Acid), and the sequence of the serum exosome non-coding miRNA is' GTTTCCGTAGTGTAGTGGTTATCACGTTCGC '. Based on the marker, the marker can be used for accurately detecting prognosis of bile duct cancer, the prediction value of tsRNA-5027c is verified by drawing a working characteristic curve of a subject, AUC can reach 0.783, and the marker has high prediction value for nerve invasion. Therefore, by detecting the expression quantity of the tsRNA-5027c molecular biomarker in the serum of a bile duct cancer patient to predict the prognosis condition of the patient, related treatment can be carried out timely, the survival time of the patient is prolonged, the survival quality of the patient is improved, and great economic value and social benefit are achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biology and medicine technology, and specifically relates to an application of a substance for detecting serum exosome non-coding miRNA in the preparation of a detection product for the prognosis of cholangiocarcinoma. Background Art

[0002] Cholangiocarcinoma (CCA) is a highly heterogeneous tumor with a very high degree of malignancy. Cholangiocarcinoma (CCA) originates from intrahepatic or extrahepatic bile duct epithelial cells and can be divided into intrahepatic cholangiocarcinoma (iCAA), hilar cholangiocarcinoma (pCCA) and distal cholangiocarcinoma (dCCA), which have different molecular and clinical phenotypes but all originate from the biliary epithelium.

[0003] Due to the strong invasiveness, insidious onset and late stage of diagnosis of cholangiocarcinoma, the 5-year survival rate of cholangiocarcinoma patients is still less than 10%. Cholangiocarcinoma is a malignant tumor originating from the bile duct epithelium. The biliary system is the first to be exposed to cholangiocarcinoma. During the progression of cholangiocarcinoma, the content of serum components in the biliary system often changes significantly.

[0004] Therefore, new diagnostic markers and targeted therapies for the prognosis of cholangiocarcinoma are urgently needed to be discovered in order to improve the early prediction of the prognosis of cholangiocarcinoma patients and prolong their survival. Summary of the invention

[0005] The present invention has discovered a marker that can detect the prognosis of bile duct cancer, which can accurately detect the prognosis of bile duct cancer.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] On the one hand, the present invention provides an application of a substance for detecting serum exosome non-coding miRNA in preparing a detection product for the prognosis of cholangiocarcinoma, wherein the sequence of serum exosome non-coding miRNA is: GTTTCCGTAGTGTAGTGGTTATCACGTTCGC.

[0008] Preferably, the above-mentioned detection product can be a reagent, a test kit, a test paper or a diagnostic chip.

[0009] Preferably, the above reagent or kit is a reagent or kit based on ELISA detection or PCR amplification detection.

[0010] Preferably, the above-mentioned prognosis of cholangiocarcinoma is nerve invasion and / or cancer pain.

[0011] The beneficial effects of the present invention include: the serum exosomal non-coding miRNA (tsRNA-5027c) as a predictive marker for cholangiocarcinoma prognosis provided by the present invention can be used to accurately detect the prognosis of cholangiocarcinoma. The predictive value of tsRNA-5027c is verified by drawing a receiver operating characteristic curve, and the AUC can reach 0.783, which has a high predictive value for nerve invasion. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The expression of tsRNA-5027c in the serum exosome Pandora-seq sequencing results of the cholangiocarcinoma patient group and the non-cholangiocarcinoma patient group;

[0013] Figure 2 The expression of tsRNA-5027c in serum exosomes of cholangiocarcinoma patients and non-cholangiocarcinoma patients was analyzed by qPCR using the stem-loop method;

[0014] Figure 3 This is the ROC curve of the relationship between tsRNA-5027c expression level and neuroinvasion. DETAILED DESCRIPTION

[0015] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0016] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0017] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0018] 1. Marker Screening

[0019] 1. Patient sample inclusion criteria

[0020] In the following example, the bile duct cancer patient samples come from:

[0021] Inclusion criteria:

[0022] (1) Male or female patients aged 18-80 years;

[0023] (2) Cholangiocarcinoma confirmed by puncture combined with imaging examinations such as abdominal enhanced CT, MRI or MRCP, laboratory tests and physical examination;

[0024] (3) ECOG score 0-1, Child-Pugh score A or B;

[0025] (4) Clear clinical data, follow-up data, and survival time, with the survival time after treatment being greater than 3 months;

[0026] Exclusion criteria:

[0027] (1) Hematological examination: WBC<4.0*10 9 / L,HB<80g / L,PLT<75*10 9 / L;

[0028] (2) Coagulation function: international normalized (prothrombin time) ratio (INR) > 2.3, or prothrombin time (PT) prolonged > 6 seconds;

[0029] (3) Liver function indicators: serum albumin (ALB) <2.8 g / dl, serum total bilirubin (TBIL) >51.3 μmol / l, alkaline phosphatase, serum transaminases (ALT and AST) >5 times the upper limit of normal value;

[0030] (4) Renal function index: serum creatinine (CRE)>1.5 times the upper limit of normal value;

[0031] (5) Subjects had acute cardiovascular and cerebrovascular diseases such as acute cerebral infarction, acute coronary syndrome, etc. within one month, and cardiovascular clinical symptoms or diseases were not well controlled;

[0032] (6) Ascites, hepatic encephalopathy, Gilbert’s syndrome, sclerosing cholangitis, etc.

[0033] (II) Screening of microRNA molecules

[0034] In the following example, the method of extracting RNA from exosomes using TRIZOL is as follows:

[0035] (1) 1 ml serum can extract 200 μL of exosomes dissolved in PBS. After adding 1 ml Trizol, let it stand at room temperature for 5 minutes to fully lyse it and completely separate the nucleic acid-protein complex (you can gently flip it to mix it). Note: At this time, it can be stored at -70℃ for a long time. Centrifuge at 12000rpm, 4℃ for 10 minutes and take the supernatant. Transfer the supernatant to a new EP tube. The side wall of the EP tube should be marked to prevent the erosion of organic solvents in the future from blurring the handwriting.

[0036] (2) Add at least 0.2 ml of chloroform (1 / 5 volume) to every 1 ml of Trizol. Close the sample bottle cap tightly, shake the test tube vigorously by hand to mix it thoroughly, and let it stand at room temperature for 5 minutes.

[0037] (3) Centrifuge at 12000 rpm and 4°C for 15 min. Carefully transfer the upper aqueous phase into a new 1.5 ml EP tube (about 400-500 ul), add an equal volume of isopropanol (add isopropanol at the rate of 0.5 ml isopropanol / ml Trizol), mix well, and place at -20°C for 1 h (or at room temperature for 10 min).

[0038] (4) Note: (1) The phases are divided into three layers: the upper aqueous phase contains RNA, the middle white phase contains protein and DNA, and the lower red phase contains protein, DNA, chloroform, and phenol. Do not absorb any of the substances in the middle layer. It is better to have less than too much. (2) If DNA and protein are extracted at the same time, keep the lower phenol phase and store it in a 4℃ refrigerator. If only RNA is extracted, discard the lower phenol phase.

[0039] (5) Centrifuge at 12000 rpm and 4°C for 10 min. Carefully discard the supernatant. After centrifugation, a gel-like RNA precipitate will form on the sides and bottom of the tube.

[0040] (6) Add 1 ml of 75% ethanol (prepared with DEPC water) to wash the precipitate. After adding ethanol, bounce the RNA precipitate to rinse. For every 1 ml of Trizol used, use at least 1 ml of 75% ethanol to wash. Note: RNA precipitates can be stored in 75% ethanol at 2-8°C for more than a week or at -20°C for more than a year.

[0041] (7) Centrifuge at 12,000 rpm and 4°C for 10 min. Aspirate the supernatant with a pipette, taking care not to aspirate the precipitate.

[0042] Pandora-seq sequencing was used to detect all microRNAs in the serum exosomes of the samples, identify existing and newly discovered microRNAs, and screen for microRNAs with significantly different expressions in the serum of cholangiocarcinoma patients compared with those of non-cholangiocarcinoma patients; specifically, sera of 5 cholangiocarcinoma patients and 5 non-cholangiocarcinoma patients were selected, and the exosomes in the serum were separated by ultracentrifugation, and the RNA in the serum exosomes was extracted using the TRIZOL method; then the high-throughput sequencing method of Pandora-seq was used to detect the expression of all miRNAs in serum exosomes, identify existing and newly discovered miRNAs, and screen for microRNAs with significantly different expressions in the serum of cholangiocarcinoma patients compared with those of non-cholangiocarcinoma patients; the screening criteria were that the content of non-coding miRNAs in the serum exosomes of cholangiocarcinoma patients was log2(fc)≥1&q≤0.05 compared with the content of non-coding miRNAs in the serum exosomes of non-cholangiocarcinoma patients, and it was found that tsRNA-5027c was significantly expressed in the serum of cholangiocarcinoma patients compared with that of non-cholangiocarcinoma patients, and its Pandora-seq expression level was visible Figure 1 .

[0043] 3. Establishment of prognostic model

[0044] A cut-off value was calculated based on the median expression level of tsRNA-5027c in all samples tested, and all samples were divided into groups with high and low tsRNA-5027c expression. The clinical characteristics and pathological information of cancer tissues of all patients were followed up to evaluate the impact of the expression level of this miRNA on patient prognosis.

[0045] 2. Marker Validation

[0046] Serum from 43 patients with cholangiocarcinoma was collected clinically, and the relative content of tsRNA-5027c was detected by stem-loop qPCR, and the differences were analyzed as follows:

[0047] (I) Ultraspeed Isolation of Exosomes

[0048] (1) Serum was collected from 43 patients with cholangiocarcinoma;

[0049] (2) The serum is centrifuged to remove a large amount of impurities such as cell debris and cell nuclei. The centrifugation condition is usually 300g × 10min to allow precipitation. At this point, the supernatant contains most of the exosomes.

[0050] (3) The supernatant of step (2) is centrifuged again, and the centrifugation conditions are usually 2000g×10min.

[0051] (4) The supernatant of step (3) was centrifuged again for ultracentrifugation to further purify the exosomes, and the centrifugation condition was 110000g×70min. At this point, the clean exosomes have been concentrated in the precipitate and can be directly collected and used for subsequent experiments.

[0052] (II) Stem-loop qPCR

[0053] (1) The collected serum samples were used to separate exosomes and the RNA in the exosomes was extracted using the TRIZOL method;

[0054] (2) Design specific fluorescent quantitative PCR primers for the obtained microRNA; the sequence of tsRNA-5027c is GTTTCCGTAGTGTAGTGGTTATCACGTTCGC; after RNA extraction, the specific primers of step (2) are used to verify the microRNA screened above by fluorescent quantitative PCR, and further screen the microRNA molecules whose fluorescent quantitative PCR results are consistent with the differentially expressed miRNA screened above; the first strand cDNA of the microRNA molecule is synthesized using a stem-loop reverse transcription kit (SPARJade SPARKScript miRNA 1st strand cDNA synthesis kit, catalog number: AG0501), the reverse transcription reaction system is 20 μL, and the synthesis procedure is as follows: after the components required for the reverse transcription system are prepared, the prepared reaction solution is gently mixed with a pipette, and after a brief centrifugation, the reaction is reacted at 42°C for 60 minutes, and then heated at 85°C for 5 seconds to inactivate E. coli Poly(A) Polymerase and SPARKscript H-Rtase; after the reversal rate is completed, fluorescent quantitative PCR amplification is performed to calculate the relative expression of microRNA molecules; PCR amplification uses SYBR fluorescent quantitative PCR kit (SparkJade 2XmiRNA SYBR Green qPCR Mix, catalog number: AH0502) for amplification, and the PCR reaction detection system is 20μl; the PCR amplification reaction system procedure is: after the components required for the PCR reaction are prepared, they are preheated at 94°C for 2 minutes on a PCR instrument to fully denature the template DNA, and then enter the amplification cycle system; in each amplification cycle, the template is first denatured at 94°C for 15 seconds, and then the temperature is lowered to the annealing temperature of 60°C for 30 seconds to fully anneal and extend the primers and template to complete a cycle; the cycle is repeated 40 times.

[0055] The results are as follows Figure 2As shown, the results showed that the expression level of Has-tsRNA-5027 in the cholangiocarcinoma patient group was significantly higher than that in the non-cholangiocarcinoma patients; that is, the microRNA molecule screened for predicting the prognosis of cholangiocarcinoma was: Has-tsRNA-5027c, and the sequence of the microRNA obtained by sequencing was "GTTTCCGTAGTGTAGTGGTTATCACGTTCGC".

[0056] In addition, after statistics, the relationship between the relative content of tsRNA-5027c and the occurrence of nerve invasion is shown in Table 1. The results showed that the tsRNA-5027c content in the serum and bile exosomes of cholangiocarcinoma patients was statistically significant with the probability of nerve invasion in the patient's tissue.

[0057] Table 1. Significance statistics of tsRNA-5027c expression level and clinical characteristics and pathological information of subjects

[0058]

[0059]

[0060] In addition, the predictive value of tsRNA-5027c was verified by drawing the receiver operating characteristic curve. Figure 3 , where AUC = 0.783, the results showed that tsRNA-5027c had a high predictive value for nerve invasion.

[0061] In summary, serum exosomal tsRNA-5027c can be used as a biomarker to predict the prognosis of cholangiocarcinoma.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. Use of a substance for detecting serum exosome non-coding miRNA in the preparation of a detection product for the prognosis of cholangiocarcinoma, wherein the sequence of serum exosome non-coding miRNA is: GTTTCCGTAGTGTAGTGGTTATCACGTTCGC.

2. The use according to claim 1, characterized in that: The detection products are reagents, test kits, test strips or diagnostic chips.

3. The use according to claim 2, characterized in that: The reagent or kit is a reagent or kit based on ELISA detection or PCR amplification detection.

4. The use according to any one of claims 1 to 3, characterized in that: The prognosis of cholangiocarcinoma is nerve invasion and / or cancer pain.

Images