Longicorn population tracing SNP molecular marker and application

Abstract

The application discloses a long-horned beetle population tracing SNP (single nucleotide polymorphism) molecular marker and application. The application collects long-horned beetle geographical population samples at home and abroad, screens population-specific SNP tracing sites from sample genome resequencing sequences, and establishes a long-horned beetle population SNP tracing site detection method. The population tracing SNP marker site mined by the application has good genetic stability, and the detection result is reliable. In the detection process, the peak diagram obtained after amplification of the SNP marker site amplification primer can accurately determine the attribution and source of the detected population. The single mutation SNP molecular marker is used, and the population source detection process is rapid and simple.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology detection, and particularly relates to a SNP molecular marker technology applied to long-lin bark beetle population tracing and application thereof. BACKGROUND

[0002] At present, the molecular identification of intercepted samples in plant quarantine at ports is mainly species identification at the species level, and there is a lack of accurate and effective detection technology for the genetic differentiation characteristics of geographic populations under the species. With the needs of precise quarantine supervision of customs and technical trade measures, it is necessary to trace and identify the geographic population of important quarantine pests intercepted at ports to determine the transmission source of the population intercepted sample, including the geographic origin and possible transmission route of the population.

[0003] There are four main technologies related to population tracing: (1) simplified genome sequencing and analysis, (2) detection and analysis of specific barcode gene fragments (mitochondrial and nuclear genes, etc.), (3) microsatellite (SSR) molecular marker and analysis, and (4) SNP molecular marker technology. The first three technologies have obvious shortcomings for population tracing detection, and SNP molecular markers are mainly used for medical disease diagnosis, agricultural breeding traits molecular markers and food meat tracing molecular markers. At present, there is no corresponding technology and application of SNP molecular markers for quarantine pest population tracing.

[0004] (1) Simplified genome sequencing and analysis

[0005] This technology integrates the genetic differentiation characteristics and variation sources between various populations by sequencing the simplified genomes of samples from different sources, such as strain typing and transmission source analysis based on genome sequences of new coronaviruses (covid-19), and rapid expansion mechanism research of invasive weeds like Eupatorium odoratum (Liu, Bo; Yan, Jian; Li, Weihua et al. Mikania micrantha genome provides insights into the molecular mechanism of rapid growth. Nature Communications, 2020, 11(1). DOI:10.1038 / s41467-019-13926-4). The advantage of this technology is that the population typing information is comprehensive and accurate. However, this technology requires second-generation (library construction) or third-generation sequencing technology for sequencing and analysis of population samples, which is labor-intensive, costly and time-consuming, especially not suitable for routine detection of large genome species such as insects at ports. It is difficult to determine the population source under the condition of a single population sample.

[0006] (2) Barcode gene fragment (mitochondrial and nuclear gene, etc.) detection and analysis

[0007] Barcode gene fragment is mainly used for species identification, and can also be used for preliminary analysis of population genetic structure. For example, the geographic population genetic structure of longhin bark beetles based on mitochondrial CO1 gene (Oliveira MR C, Corre a AS, Souza G A d, Guedes R N C, Oliveira L O D. 2013. Mesoamerican Origin and Pre- and Post-Columbian Expansions of the Ranges of Acanthoscelides obtectus Say, a Cosmopolitan Insect Pest of the Common Bean. PLoS ONE 8(7): e70039) (doi:10.1371 / journal.pone.0070039). However, due to the relative conservation of barcode sequences and the limited diversity of population genetic differentiation information that can be reflected, as well as the poor stability of variable marker sites, it is not suitable as a molecular marker for tracing specific populations.

[0008] (3) Microsatellite (SSR) molecular marker and analysis

[0009] Microsatellite markers (microsatellite), also known as short tandem repeats (STRs) or simple sequence repeats (SSR), are simple repeat sequences uniformly distributed in eukaryotic genomes, consisting of 2-6 nucleotide tandem repeats. Due to the high variability and abundance of repeat numbers between individuals, microsatellite markers are widely used in population genetic molecular markers. Microsatellite sites are usually amplified by PCR, and the amplified products are detected by electrophoresis analysis and size separation of alleles. However, as a genetic variability molecular marker, microsatellite also has poor stability, lacks reliable molecular markers for specific populations, and requires a large number of population samples for conventional detection. Under single sample conditions, the source of the population cannot be determined. In addition, the reliability of detecting allelic differences through electrophoretic patterns is poor.

[0010] (4) SNP molecular marker and detection

[0011] SNP (Single Nucleotide Polymorphism) molecular marker technology, SNP refers to the DNA sequence polymorphism caused by single nucleotide variation at the genomic level. This variation may occur in the form of single base substitution (such as C←→T) or transversion (such as C←→A), or may be caused by insertion or deletion of bases. SNP has wide application in biology, medicine, agriculture and other fields. In the field of medicine, SNP research helps to locate, clone and identify disease genes, which can be used for disease diagnosis and prediction of pathogenic risk, as well as pharmacogenetics and new drug discovery. In the field of agriculture, SNP analysis can help breeding experts better understand crop genetic diversity and accelerate the breeding of excellent varieties. In the field of food, SNP molecular markers can be used to trace the variety of meat sold. In the field of plant quarantine, SNP molecular markers have not been applied to the population tracing of quarantine pests. Since SNP molecular marker detection and application are not universal, specific SNP molecular marker technology needs to be developed and established by screening genomic data for specific species research objects.

[0012] Currently, the main concern in the implementation of routine identification of quarantine pests is the identification of species, and there is a lack of precise and rapid detection technology for identifying the genetic differentiation characteristics of intra-species (sub-species units). It is worth noting that the genetic differentiation within the same biological species due to long-term geographical segmentation, on the one hand, will produce genetic differences under the corresponding ecological background conditions (such as biological types and geographical populations), and on the other hand, different sub-species units (biological types and geographical types, etc.) may produce hybridization dominant populations with stronger ecological adaptability than the original geographical population, and new harmful potential. Therefore, the implementation of species-level species identification cannot accurately identify the genetic differentiation characteristics of geographical populations of species, and it is necessary to develop molecular detection marker technology that can be used to identify the genetic background of different geographical species at the sub-species level, in order to accurately trace the source of transmission and track the source of transmission, and help to solve the problem of tracing the source of quarantine pests in international trade.

[0013] Longicorn Hylurgus ligniperda(Coleoptera: Curculionidae) (Order Coleoptera: Family Curculionidae) Native to the Mediterranean coast of Europe and certain islands in the Atlantic Ocean, it has spread to all continents in the past 90 years, including all of Europe, Japan (before 1931), South Korea and Sri Lanka (2018) in Asia, Australia (1942) and New Zealand (1974) in Oceania, and the United States, Uruguay, Brazil and Chile in the Americas (2000-2001). The long-grown bark beetle typically infests newly felled and weakened trees, and injured healthy trees are also frequently affected. In Chile, the long-grown bark beetle has been found to damage healthy trees during the dry season and occasionally kill radiata pine seedlings. The long-grown bark beetle can infest more than 20 tree species, including radiata pine, black pine, and slash pine. In China, the long-grown bark beetle was first discovered in 2020 infecting black pine in Yantai, Shandong. Pinus thunbergii The disease subsequently spread to Weihai, Tai'an, Weifang, and Qingdao. Currently, major sources of imported timber for my country include Russia and New Zealand, both of which are areas where the bark beetle is present. Due to my country's vast territory, abundant pine resources, and the widespread distribution of imported pines in monoculture plantations, coupled with the similarity between my country's geographical location and climate and the beetle's distribution pattern, and the bark beetle's strong adaptability, this insect poses a serious threat to my country's pine forest resources. Since adult bark beetles, larvae, and eggs can all be spread long distances via host materials (logs, wooden packaging), strengthening port quarantine supervision and accurately determining the source of the beetle intercepted at ports are crucial for its quarantine and control. Summary of the Invention

[0014] To address the shortcomings of existing population tracing technologies, this invention develops a group of *Bark Borer* species from genome sequences. Hylurgus ligniperda The study developed and applied SNP molecular markers for population tracing. By resequencing the genomes of samples from different geographical populations of *Bark Borer chinensis*, specific SNP molecular markers for different geographical populations of *Bark Borer chinensis* were developed from comparative analysis of genome sequence data. These markers serve as identification indicators for the specific geographical population origins of *Bark Borer chinensis*, forming a detection method applicable to population tracing.

[0015] To obtain the source SNP loci for the *Bark Borer chinensis* population, this invention first performed whole-genome sequencing of the insect, providing a reference genome for screening source SNP loci. The whole genome was sequenced using second- and third-generation sequencing technologies, yielding a total sequencing volume of 179.00 G and a coverage depth of 108.27X. Based on this, resequencing technology was used to re-sequencing 22 samples from three *Bark Borer chinensis* populations from New Zealand, Russia, and Shandong, China. Through bioinformatics analysis, one specific SNP marker and one pair of primers for each of the three source countries (New Zealand, Russia, and China) were successfully screened and validated from approximately 4 million SNP loci in each population's genome.

[0016] In order to achieve the above-mentioned purpose, the present application provides a longicorn population tracing SNP molecular marker, which comprises one or more of the following molecular markers:

[0017] For the tracing SNP site of the Russian population, the base at the 10581062th position on the 10th chromosome of the longicorn reference genome is A; for the Shandong population, the tracing SNP molecular marker at the site is C at the 12396414th position on the 4th chromosome, and for the New Zealand population, the tracing SNP molecular marker at the site is G at the 10512733th position on the 1st chromosome.

[0018] The present application also provides detection primers for detecting the longicorn population tracing SNP molecular marker.

[0019] Specifically, it comprises one or more of the following primer pairs:

[0020] For the detection primer of the tracing SNP site molecular marker of the Russian population, it is 1062-F / 1062-R, the forward primer sequence is CAGTTGAACGATGGGCCAAT, and the reverse primer sequence is TCACAGTTTTGAGCGCGAAT;

[0021] For the detection primer of the tracing SNP site molecular marker of the Shandong population, it is 6414-F / 6414-R, the forward primer sequence is TCTATGAGCTTAGTCGTCTGGT, and the reverse primer sequence is GGATTACCGTCACGAGAAGC;

[0022] For the detection primer of the tracing SNP site molecular marker of the New Zealand population, it is 2733-F / 2733-R, the forward primer sequence is CCTGCATTGAAGGGTTGAGT, and the reverse primer sequence is AACAGAACGTGCAACCATCC.

[0023] The present application provides the application of the longicorn population tracing SNP molecular marker in longicorn geographic population tracing detection.

[0024] The present application also provides the application of the detection primer in longicorn geographic population tracing detection.

[0025] The present application also provides a longicorn population tracing SNP molecular marker longicorn population tracing detection method, which comprises the following steps: taking a single head of a longicorn sample to extract genomic DNA, using the detection primer according to any one of claims 2 or 3 to perform amplification; and determining the attribution source of the to-be-tested population according to the sequencing or amplification peak diagram of the amplification product and referring to the genotype of the specific population tracing site.

[0026] The long-horned beetle population is a Russian, Shandong or New Zealand population.

[0027] Specifically, the method for extracting genomic DNA from the long-horned beetle sample uses a kit suitable for micro-sample extraction.

[0028] More specifically, the sequence amplification conditions of the traceability site (SNP) are as follows: pre-denaturation at 94℃ for 4 min, denaturation at 94℃ for 30 s, annealing at 50℃-58℃ (depending on the specific primer) for 30 s, extension at 72℃ for 40 s, 30 cycles, final extension at 72℃ for 10 min, and the system temperature is reduced to 12℃, ending the PCR amplification.

[0029] Preferably, the amplification system is prepared in 25 µL, the amount of genomic DNA template is 1 µL (concentration of 10 ng / µL-100 ng / µL), and the amount of upstream primer and downstream primer is 0.3 µL (concentration of 20 μM) respectively.

[0030] The application provides the long-horned beetle population traceability detection method, and the amplification product of the long-horned beetle population sample target detection sequence is amplified by the one or more primers; the target region is determined on the sequencing peak graph according to the flanking sequence of the SNP, and the sample source can be judged according to the SNP type; and the specific determination standard is as follows: genomic DNA is extracted from the long-horned beetle sample; the long-horned beetle population sample target detection sequence is amplified by the population traceability site detection primer according to any one of claims 1-9; and the attribution and source of the detection population can be accurately determined according to the SNP traceability site amplification peak graph and the specific population traceability site genotype.

[0031] The population traceability SNP marker site developed by the application has good genetic stability, reliable detection results, and the peak graph obtained after amplification of the SNP marker site amplification primer can accurately determine the attribution and source of the detection population. Specifically, the SNP (single nucleotide polymorphism) molecular marker is used, the long-horned beetle geographic population samples at home and abroad are collected, the population-specific SNP traceability site is screened from the genomic resequencing sequence of the samples, the detection method of the long-horned beetle population SNP traceability site is established to identify the population source of the intercepted samples at the port. The application of the application is helpful to determine the population source of the intercepted long-horned beetle, to avoid trade friction caused by misjudgment of the intercepted insect source, to improve the pertinence of the port inspection of imported beans, and to effectively ensure the smooth progress of international agricultural product trade and the safety of national ecology and agriculture. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 , sequencing depth distribution graph. In which, the horizontal axis: sequencing depth (sequencing depth), unit X; the vertical axis: the ratio of bases to the genome (fraction of bases).

[0033] Figure 2 Figure 4 shows the identification peak map of the traceability site of the Russian geographical population of the long-horned bark beetle.

[0034] Figure 3 Figure 5 shows the identification peak map of the traceability site of the Shandong geographical population of the long-horned bark beetle.

[0035] Figure 4 Figure 6 shows the identification peak map of the traceability site of the New Zealand geographical population of the long-horned bark beetle. DETAILED DESCRIPTION

[0036] The present application will be further described in conjunction with specific examples, but the present application is not limited by the examples.

[0037] In the following examples, the experimental materials, reagents, instruments and methods used are conventional experimental materials, reagents, instruments and methods in the art, and can be obtained through commercial channels, unless otherwise specified.

[0038] Example 1: Mining of traceability sites of long-horned bark beetle populations and design of primers

[0039] 1. Sequencing and assembly of long-horned bark beetle reference genome

[0040] To provide a reference genome for screening of long-horned bark beetle population traceability SNP sites, a long-horned bark beetle sample (HL202404001) from Shandong, China was selected for genome sequencing. Using second-generation and third-generation sequencing technologies, a total of 396.00 G of Rawdata was generated, and 348.21 G of Clean data was obtained after filtering. The total amount of long-horned bark beetle genome sequencing library fragments was 80.77 G, and the coverage depth was 108.27X (Table 1).

[0041] Based on the sequencing of the whole genome of the long-horned bark beetle, 179.00 G of sequencing data of the long-horned bark beetle HL202404001 genome was used to perform denovo assembly of the HL202404001 genome. The total length of contigs was 518.74 Mbp, and the contig N50 length reached 2.11 Mbp. Various methods were used to evaluate the assembly version, and the results showed that the genome consistency, integrity and accuracy were good.

[0042] Table 1: Long-horned bark beetle genome sequencing library data volume statistics

[0043]

[0044] The contig N50 of genome assembly reached 286.86Kbp (the assembly result selects sequences of more than 100bp). Sequence consistency analysis shows that small fragment reads are aligned to the genome, the read alignment rate is about 93.99%, and the genome coverage is about 75.53% (Table 1). Figure 1 The genome is de novo assembled, and the total length of the assembly result contig is 588.59Mbp, and the contig N50 length reaches 286.86Kbp.

[0045] SNPs analysis statistics are performed on the measured long-lin bark beetle reference genome, and the total amount of SNP sites of the genome is 4004207, of which 4001407 are heterozygous sites, and 2620 are homozygous sites (Table 2).

[0046] Table 2, SNP statistics of long-lin bark beetle HL202404001 genome

[0047]

[0048] Note: All SNP: all SNPs in the genome, including heterozygous (Heterozygosis) SNP and homozygous (Homology) SNP.

[0049] 2, Long-lin bark beetle traceability population sample resequencing

[0050] The present application resequences a total of 22 samples of 3 long-lin bark beetle geographic populations from New Zealand, Russia and Shandong, China (Table 3), the library quality built by sample sequencing is good (Table 4), and the amount of resequencing data of each sample is shown in Table 5.

[0051] Table 3, long-lin bark beetle geographic population sample source

[0052]

[0053] Table 4, long-lin bark beetle population sample resequencing library data output quality situation table

[0054]

[0055] Table 5, long-lin bark beetle population sample resequencing data amount

[0056]

[0057] The SNPs site screening analysis was performed on the re-sequencing data of the four geographical population samples of Monochamus alternatus by referring to the reference genome of Monochamus alternatus. The vcftools software was used for SNPs filtering, the sites with missing genotypes were removed, and the sites with a SNPs quality value greater than 30 were retained. A total of 141635 population tracing SNPs sites were screened, and on this basis, the 100% specific SNPs and the sequences of about 300bp on both sides of the 100% specific SNPs (used for designing SNP site amplification primers) specific to China, New Zealand and Russia were further selected. Through site sequence amplification verification, finally three effective SNP molecular markers for tracing the population of Monochamus alternatus from New Zealand, China and Russia were obtained (Table 6).

[0058] Table 6, information of three geographical population samples of Monochamus alternatus and tracing SNPs sites

[0059]

[0060] The SNP tracing marker sites and their detection primer list 7 of the population of Monochamus alternatus were established.

[0061] Table 7, detection primer sequences of the SNPs combination sites of the geographical population of Monochamus alternatus

[0062]

[0063] Example 2, application verification of the population tracing SNP molecular markers of Monochamus alternatus

[0064] According to the tracing detection sites (Table 6) and their detection primers (Table 7), the genomic DNA of the population sample of Monochamus alternatus was extracted. The population tracing site detection primers (Table 7) provided by the present application were used to amplify (PCR) the sequence of the Monochamus alternatus population sample to be tested.

[0065] The specific operation steps are as follows:

[0066] 1. Sample sampling: The sample requires that the insect body or tissue is not degraded, not infected by pathogenic bacteria.

[0067] 2. Genomic DNA extraction

[0068] A commercial kit suitable for micro-sample extraction (such as DNeasy Blood and Tissue Kit (50) of QIAGEN company) or other equivalent kits were selected, and the extraction method was referred to the instruction manual. The DNA purified by the separation column was removed as much as possible before elution, and the organic solvents such as alcohol were removed. The solution after elution was detected for DNA concentration and quality.

[0069] 3. SNP tracing site sequence amplification

[0070] According to the sample of the population to be tested, the SNP site is amplified using the traceable primer in Table 2.

[0071] 1) Amplification system and conditions: Take the preparation of 25 μL as an example (Table 8), if the DNA template concentration is lower than 10 ng / μL, the amount of template should be appropriately increased.

[0072] Table 8, PCR reaction system mixture and amount of traceable site sequence

[0073]

[0074] PCR reaction conditions: 94℃ pre-denaturation for 4 min before cycling; 94℃ denaturation for 30 s, 50℃-58℃ (depending on the specific primer) annealing for 30 s, 72℃ extension for 40 s, 30 cycles; finally 72℃ extension for 10 min, the system temperature is reduced to 12℃, and the PCR amplification is ended.

[0075] 2) Amplification product sequencing and SNP site determination

[0076] The amplification product is generally sent to a sequencing company for sequencing. The sequence is opened with SnapGene ab1 sequencing file, the flanking sequence of SNP is found, the target region is determined on the sequencing peak map according to the flanking sequence (usually 10 bp) of SNP, and the sample population attribution source can be determined according to the SNP type. The verification of 3 long-lin bark beetle population SNP traceable sites is shown in Table 9, and the peak map of the verification site is shown in Figures 2 to 4 .

[0077] Table 9, verification results of long-lin bark beetle population traceable SNP detection sites

[0078] .

Claims

1. The application of a detection primer in the geographical population tracing and detection of *Bark Beetle*, characterized in that, The geographical population of the long-leaved bark beetle is either the Russian population or the New Zealand population. The detection primers for molecular markers of SNP sites for tracing the origin of the Russian population are 1062-F / 1062-R, with the forward primer sequence being CAGTTGAACGATGGGCCAAT and the reverse primer sequence being TCACAGTTTTGAGCGCGAAT. The primers for detecting molecular markers of SNP sites for tracing the origin of the New Zealand population are 2733-F / 2733-R, with the forward primer sequence being CCTGCATTGAAGGGTTGAGT and the reverse primer sequence being AACAGAACGTGCAACCATCC.

Images