Quantitative detection primer probe combination for lactobacillus vaginalis, kit and application

Abstract

The invention provides a quantitative detection primer probe combination for lactobacillus vaginalis, a kit and application, and belongs to the technical field of gene detection. The invention provides a vaginal lactobacillus detection primer probe combination. The vaginal lactobacillus detection primer probe combination comprises detection primer pairs and probes aiming at total bacteria, total lactobacillus, lactobacillus crispatus, lactobacillus gasseri, lactobacillus inertus and lactobacillus jensenii. The invention further provides a kit for detecting the lactobacillus vaginalis based on the primer probe combination, so that multi-channel detection can be realized, and quantitative detection of total bacteria, total lactobacillus and four main lactobacillus (lactobacillus crispatus, lactobacillus gasseri, lactobacillus inertus and lactobacillus jensenii) in a specimen can be completed at one time; the total lactobacillus proportion and the proportions of the four main lactobacillus are analyzed, clinical requirements are met, the detection time is short, and the cost is low.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a primer-probe combination, a kit and an application thereof for quantitative detection of vaginal lactobacillus. Background Art

[0002] The female reproductive tract, especially the vaginal flora, is closely related to the risk of female reproductive tract infectious diseases, and the diagnosis of vaginal flora status is an important prerequisite for vaginal flora status assessment, intervention and follow-up. The determination of female reproductive tract health is generally based on whether non-inert Lactobacillus is dominantly colonized. Therefore, quantitative detection of the total abundance ratio of Lactobacillus and the abundance ratio of Lactobacillus inert is of great significance for clinical treatment decisions. Non-lactobacillus often exists in a state of low-abundance co-colonization of multiple bacteria. Even if individual low-abundance non-lactobacillus is detected by quantitative detection, the health status of the reproductive tract cannot be determined.

[0003] The conventional detection methods currently include: (1) Culture method: the most commonly used method in medical institutions, but the detection rate is low. Whether vaginal microorganisms can be detected is affected by the culture medium and culture conditions of the bacteriological laboratory, and the test results cannot provide relative abundance information. (3) High-throughput sequencing methods: including 16S detection, macrogene detection, etc., which are still in the early research and application stage. They can provide abundance ratio information, but are expensive and time-consuming, such as Dian Diagnostics Dano-seq reproductive tract microbial detection. However, Dian Diagnostics Dano-seq reproductive tract microbial detection reports provide the total Lactobacillus abundance ratio, but do not provide the richness information of Lactobacillus inerens and other Lactobacillus species. The vaginal protection characteristics of Lactobacillus inerens and other Lactobacillus species are inconsistent, which increases the risk of infection. In addition, Dano-seq reproductive tract microbial detection uses high-throughput detection, which is expensive and takes longer than PCR. (2) PCR detection of pathogenic bacteria: Currently, medical institutions have separate tests for pathogenic microorganisms such as mycoplasma, chlamydia, and Streptococcus agalactiae. Although Lactobacillus PCR detection kits are publicly available, they can generally only be qualitative but not quantitative, and cannot provide relative abundance information. They cannot detect the proportion of total lactobacilli and the proportion of Lactobacillus inerts (Lactobacillus inerts among lactobacilli are associated with many poor prognoses). However, whether clinical intervention usually depends on the proportion of non-inert lactobacilli. It can be seen that there is an urgent need for a low-cost female reproductive tract lactobacillus detection product that is not limited by experimental conditions, which can effectively detect whether the vaginal flora is dominated by non-inert lactobacilli, provide a basis for selective intervention treatment, and dynamically follow up the changes in the abundance of lactobacilli after intervention treatment such as lactobacillus transplantation treatment. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the object of the present invention is to provide a primer-probe combination and a kit for quantitative detection of vaginal lactobacillus, which can realize multi-channel detection, complete the quantitative detection of total bacteria, total lactobacillus and four major lactobacilli (Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, Lactobacillus jensenii) in a specimen at one time, analyze the proportion of total lactobacillus and the proportion of four major lactobacilli, meet clinical needs, and have short detection time and low cost.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer-probe combination for detecting vaginal lactobacillus, including a primer pair and a probe for detecting total bacteria, total lactobacillus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, and Lactobacillus jensenii, and the nucleotide sequence is as follows:

[0007] Total bacteria detection primer F: SEQ ID NO: 1, total bacteria detection primer R: SEQ ID NO: 2, total bacteria detection probe P: SEQ ID NO: 3; total lactobacillus detection primer F: SEQ ID NO: 4, total lactobacillus detection primer R: SEQ ID NO: 5, total lactobacillus detection probe P: SEQ ID NO: 6; Lactobacillus crispatus detection primer F: SEQ ID NO: 7, Lactobacillus crispatus detection primer R: SEQ ID NO: 8, Lactobacillus crispatus detection probe P: SEQ ID NO: 9; Lactobacillus gasseri detection primer F: SEQ ID NO: 10, Lactobacillus gasseri detection primer R: SEQ ID NO: 11, Lactobacillus gasseri detection probe P: SEQ ID NO: 12; Lactobacillus iners detection primer F: SEQ ID NO: 13, Lactobacillus iners detection primer R: SEQ ID NO: 14, Lactobacillus iners detection probe P: SEQ ID NO: 15; Lactobacillus jensenii detection primer F: SEQ ID NO: 16, Lactobacillus jensenii detection primer R: SEQ ID NO: NO:17, Lactobacillus jensenii detection probe P: SEQ ID NO:18.

[0008] Preferably, the 5' end of the nucleotide sequence of the detection probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0009] The present invention also provides the use of the primer-probe combination in preparing a quantitative detection kit for vaginal lactobacillus.

[0010] The present invention also provides a vaginal lactobacillus quantitative detection kit, comprising the primer-probe combination.

[0011] Preferably, the final concentration of the primers for total bacteria is 0.1-1 nM, and the final concentration of the probe is 0.2-1 nM; the final concentration of the primers for total lactobacilli is 0.1-1 nM, and the final concentration of the probe is 0.2-1 nM; the final concentration of the primers for Lactobacillus crispatus is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM; the final concentration of the primers for Lactobacillus gasseri is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM; the final concentration of the primers for Lactobacillus iners is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM; the final concentration of the primers for Lactobacillus jensenii is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM.

[0012] Preferably, it also includes a PCR reaction solution, which includes 10-40mM Tris-HCl, 10-40mM KCl, 5-20mM (NH4)2SO4, 10-40m MgSO4, 1-5U / μL EasyTaq DNA Polymerase, and 0.1-1mM dNTP, and the pH value of the PCR reaction solution is 7.4-8.0.

[0013] Preferably, positive quality control and negative quality control are also included.

[0014] Preferably, the positive quality control is a Lactobacillus crispatus plasmid, a Lactobacillus gasseri plasmid, a Lactobacillus iners plasmid, a Lactobacillus jensenii plasmid and a total bacteria plasmid.

[0015] Preferably, the negative quality control is ultrapure water.

[0016] The present invention also provides the use of the kit in preparing a vaginal lactobacillus quantitative detection product.

[0017] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0018] Kit of the present invention can realize multi-channel detection, once complete the quantitative detection for total bacteria, total lactobacillus and four major lactobacillus (Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, Lactobacillus jensenii) in specimen, carry out the analysis of total lactobacillus proportion and four major lactobacillus proportion, meet clinical demand, can filter out the unhealthy flora state that needs to be treated at present and has an effective treatment method, and the vaginal flora state after treatment is followed up regularly and dynamically, and has important guiding significance for the clinical selection of the adaptation population of vaginal flora treatment and the follow-up after treatment. Kit of the present invention adopts PCR detection, can complete detection in a short time, and is faster than cultivation and high-throughput detection speed. Kit of the present invention is low in cost, meets the clinical long-term follow-up and multiple detection needs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1The patient's initial test results;

[0020] Figure 2 The change trend of the proportion of different types of Lactobacillus (Lactobacillus / total Lactobacillus) before and after transplantation;

[0021] Figure 3 This is the changing trend of the Lactobacillus ratio (total Lactobacillus / total bacteria) before and after transplantation. DETAILED DESCRIPTION

[0022] The present invention provides a primer-probe combination for detecting vaginal lactobacillus, including a primer pair and a probe for detecting total bacteria, total lactobacillus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, and Lactobacillus jensenii, and the nucleotide sequence is as follows:

[0023] Total bacteria detection primer F: CGTCGCTGCATCAGGGTTTC, SEQ ID NO: 1, total bacteria detection primer R: TAGTTGGAGGGGTAACGGCCCA, SEQ ID NO: 2, total bacteria detection probe P: CGTGTCTCAGTCC CAATGTGGCC, SEQ ID NO: 3; total lactobacillus detection primer F: CTTCAACTGGCATTAAGAAT, SEQ ID NO: 4, total lactobacillus detection primer R: TATTCCAGTTGTTCGTGGTTCA, SEQ ID NO: 5, total lactobacillus detection probe P: TWCWGGAGTTGGRATGTATTCRTCAAC, SEQ ID NO: 6; crispatus detection primer F: CCATTTCAACTAAGTCGAT, SEQ ID NO: 7, crispatus detection primer R: CATGATTACCGGT GCTGCACAA, SEQ ID NO: 8, crispatus detection probe P: ATGTGTTCACGAGTTTGTG, SEQ ID NO:9; Lactobacillus gasseri detection primer F: TTTAACAGTACCACGGTCAAT, SEQ ID NO:10, Lactobacillus gasseri detection primer R: CAGAAAATTAATGGAAACT, SEQ ID NO:11, Lactobacillus gasseri detection probe P: TA GTAAATACGTCTTCAA, SEQ ID NO:12; Lactobacillus iners detection primer F: ACCAACGTTATCTCCG GCTTC, SEQ ID NO:13, Lactobacillus iners detection primer R: GGTCGTATCGATCGTGGTACTG, SEQ ID NO:14, Lactobacillus iners detection probe P: CCAGTTACAGTTGATT, SEQ ID NO:15; Lactobacillus jensenii detection primer F: ACTTCATCGCCGACCTTAACTTG, SEQ ID NO:16, Lactobacillus jensenii detection primer R: TCT TGGAACTTATGAAGACT, SEQ ID NO:17, Lactobacillus jensenii detection probe P: ATACGTCTTCAACTG GC, SEQ ID NO:18.

[0024] The nucleotide sequence of the detection probe of the present invention is labeled with a fluorescent group at the 5' end, and a quenching group at the 3' end. The fluorescent group of the present invention can be selected from FAM, HEX, ROX or CY5, and the quenching group can be selected from BHQ1 or BHQ2. Preferably, the 5' end of the Lactobacillus gasseri detection probe is labeled with: FAM; the 5' end of the Lactobacillus iners detection probe is labeled with: HEX; the 5' end of the Lactobacillus crispatus detection probe is labeled with: ROX; the 5' end of the Lactobacillus jensenii detection probe is labeled with: CY5; the 5' end of the total bacteria detection probe is labeled with: FAM; the 5' end of the total lactobacillus detection probe is labeled with: ROX. The 3' end of the Lactobacillus gasseri detection probe is labeled with: FAM; the 3' end of the Lactobacillus iners detection probe is labeled with: HEX; the 3' end of the Lactobacillus crispatus detection probe is labeled with: ROX; the 3' end of the Lactobacillus jensenii detection probe is labeled with: CY5; the 3' end of the total bacteria detection probe is labeled with: FAM; the 3' end of the total lactobacillus detection probe is labeled with: ROX.

[0025] In the primer-probe combination for detecting vaginal lactobacillus of the present invention, total bacteria are used as an internal reference, which can be used to identify whether the sample is qualified on the one hand, and can be used as a total bacteria standard for content calculation on the other hand.

[0026] The present invention also provides the use of the primer-probe combination in preparing a quantitative detection kit for vaginal lactobacillus.

[0027] The present invention also provides a vaginal lactobacillus quantitative detection kit, comprising the above primer-probe combination. The final concentration of the primer (forward primer or reverse primer) for total bacteria of the present invention is 0.1-1 nM, preferably 0.2-0.4 nM, and the final concentration of the probe is 0.2-1 nM, preferably 0.3-0.5 nM; the final concentration of the primer for total lactobacillus is 0.1-1 nM, preferably 0.2-0.4 nM, and the final concentration of the probe is 0.2-1 nM, preferably 0.3-0.5 nM; the final concentration of the primer (forward primer or reverse primer) for Lactobacillus crispatus is 0.1-0.4 nM, preferably 0.2-0.3 nM, and the final concentration of the probe is 0.2-0.8 nM, preferably 0.3-0.5 nM; the primer (forward primer or reverse primer) for Lactobacillus gasseri is 0.1-0.4 nM, preferably 0.2-0.3 nM, and the final concentration of the probe is 0.2-0.8 nM, preferably 0.3-0.5 nM; The final concentration of the primer (forward primer or reverse primer) is 0.1-0.4 nM, preferably 0.15-0.2 nM, and the final concentration of the probe is 0.2-0.8 nM, preferably 0.4-0.6 nM; the final concentration of the primer (forward primer or reverse primer) of Lactobacillus iners is 0.1-0.4 nM, preferably 0.25-0.3 nM, and the final concentration of the probe is 0.2-0.8 nM, preferably 0.3-0.5 nM; the final concentration of the primer (forward primer or reverse primer) of Lactobacillus jensenii is 0.1-0.4 nM, preferably 0.2-0.3 nM, and the final concentration of the probe is 0.2-0.8 nM, preferably 0.25-0.4 nM.

[0028] The kit of the present invention also includes a PCR reaction solution, which includes 10-40mM Tris-HCl, 10-40mM KCl, 5-20mM (NH4)2SO4, 10-40m MgSO4, 1-5U / μL EasyTaq DNA Polymerase, and 0.1-1mM dNTP. The Tris-HCl is preferably 20mM, the KCl is preferably 20mM, the (NH4)2SO4 is preferably 10mM, the MgSO4 is preferably 20mM, the EasyTaq DNA Polymerase is preferably 2U / μL, the dNTP is preferably 0.2mM, and the pH value of the PCR reaction solution is 7.4-8.0, preferably 7.6-7.8.

[0029] The template DNA of the present invention can be extracted by using a conventional kit. The concentration of the template DNA is set according to the sample extraction result, and is required to be 1-100 ng / μL.

[0030] The kit of the present invention also includes positive quality control and negative quality control. The positive quality control is Lactobacillus crispatus plasmid, Lactobacillus gasseri plasmid, Lactobacillus iners plasmid, Lactobacillus jensenii plasmid and total bacteria plasmid, which are obtained by inserting corresponding target gene fragments (400bp) into pUC57 vector respectively. Wherein, the Lactobacillus crispatus plasmid is obtained by inserting the sequence of SEQ ID NO: 19 between the EcoRI and PstI restriction sites of the pUC57 vector, the Lactobacillus gasseri plasmid is obtained by inserting the sequence of SEQ ID NO: 20 between the EcoRI and PstI restriction sites of the pUC57 vector, the Lactobacillus iners plasmid is obtained by inserting the sequence of SEQ ID NO: 21 between the EcoRI and PstI restriction sites of the pUC57 vector, the Lactobacillus jensenii plasmid is obtained by inserting the sequence of SEQ ID NO: 22 between the EcoRI and PstI restriction sites of the pUC57 vector, and the total bacterial plasmid (total bacterial plasmid) is obtained by inserting the sequence of SEQ ID NO: 23 between the EcoRI and PstI restriction sites of the pUC57 vector. The negative quality control is ultrapure water.

[0031] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] In the specific embodiment of the present invention, the Lactobacillus crispatus plasmid, the Lactobacillus gasseri plasmid, the Lactobacillus iners plasmid, the Lactobacillus jensenii plasmid and the total bacterial plasmid were ordered from General Biotechnology (Anhui) Co., Ltd.

[0033] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0034] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0035] Example 1

[0036] A vaginal lactobacillus quantitative detection kit comprises a primer-probe combination, a PCR reaction solution, a positive quality control and a negative quality control.

[0037] Primer probe combination: total bacteria detection primer F: SEQ ID NO: 1, R: SEQ ID NO: 2, total bacteria detection probe P: SEQ ID NO: 3; total lactobacillus detection primer F: SEQ ID NO: 4, R: SEQ ID NO: 5, total lactobacillus detection probe P: SEQ ID NO: 6; Lactobacillus crispatus detection primer F: SEQ ID NO: 7, R: SEQ ID NO: 8, Lactobacillus crispatus detection probe P: SEQ ID NO: 9; Lactobacillus gasseri detection primer F: SEQ ID NO: 10, R: SEQ ID NO: 11, Lactobacillus gasseri detection probe P: SEQ ID NO: 12; Lactobacillus iners detection primer F: SEQ ID NO: 13, R: SEQ ID NO: 14, Lactobacillus iners detection probe P: SEQ ID NO: 15; Lactobacillus jensenii detection primer F: SEQ ID NO: 16, R: SEQ ID NO: 17, Lactobacillus jensenii detection probe P: SEQ ID NO: 18. The 5' end of the Lactobacillus gasseri detection probe is labeled with FAM; the 5' end of the Lactobacillus iners detection probe is labeled with HEX; the 5' end of the Lactobacillus crispatus detection probe is labeled with ROX; the 5' end of the Lactobacillus jensenii detection probe is labeled with CY5; the 5' end of the total bacteria detection probe is labeled with FAM; the 5' end of the total lactobacillus detection probe is labeled with ROX. The 3' end of the Lactobacillus gasseri detection probe is labeled with FAM; the 3' end of the Lactobacillus iners detection probe is labeled with HEX; the 3' end of the Lactobacillus crispatus detection probe is labeled with ROX; the 3' end of the Lactobacillus jensenii detection probe is labeled with CY5; the 3' end of the total bacteria detection probe is labeled with FAM; the 3' end of the total lactobacillus detection probe is labeled with ROX.

[0038] PCR reaction solution: 20mM Tris-HCl, 20mM KCl, 10mM (NH4)2SO4, 20m MgSO4, 2U / μL EasyTaqDNAPolymerase, 0.2mM dNTP, pH 7.8, solvent is ddH2O.

[0039] Positive quality control: Lactobacillus crispatus plasmid, Lactobacillus gasseri plasmid, Lactobacillus iners plasmid, Lactobacillus jensenii plasmid and total bacteria plasmid. Plasmids were ordered from General Biotechnology (Anhui) Co., Ltd., and the insertion results of relevant plasmids were identified by first-generation sequencing.

[0040] Example 2

[0041] The sample was tested using the kit of Example 1:

[0042] 1. Template DNA extraction (using HiPure Tissue & Blood DNAKit universal column DNA extraction kit, Shanghai Maigen Biotechnology Co., Ltd.)

[0043] (1) Break the vaginal swab and transfer the swab head to a homogenization tube containing glass beads.

[0044] (2) Add 1.0 ml of Buffer SOLPlus to the sample and perform bead milling for 10 min at 40 Hz. Preheat EB at the same time.

[0045] (3) Centrifuge at 13000×g for 1 min.

[0046] (4) Transfer 600 μL of supernatant to a new 1.5 ml centrifuge tube, add 150 μL of Buffer PS to the sample, and vortex to mix.

[0047] (5) Centrifuge at 13000×g for 5 min.

[0048] (6) Transfer the supernatant to a new 2 ml centrifuge tube, add 700 μL of Buffer GXP, and mix by inverting several times.

[0049] (7) Place HiPure DNAMini Column II in a 2 ml collection tube. Transfer half of the mixed solution to the column. Centrifuge at 10,000 × g for 40 seconds.

[0050] (8) Discard the filtrate and return the column to the collection tube. Transfer the remaining liquid to the column. Centrifuge at 10,000 × g for 40 seconds.

[0051] (9) Discard the filtrate and return the column to the collection tube. Add 500 μL of Buffer DW1 to the column. Centrifuge at 10,000 × g for 40 seconds.

[0052] (10) Discard the filtrate and return the column to the collection tube. Add 650 μL of Buffer GW2 (diluted with ethanol) to the column. Centrifuge at 10,000 × g for 40 seconds.

[0053] (11) Repeat step (10).

[0054] (12) Discard the filtrate and put the column back into the collection tube. Centrifuge at 13,000 × g for 2 min and spin dry the column. After centrifugation, open the tube cap and let it dry for 2 min.

[0055] (13) Place the column in a new 1.5 ml centrifuge tube. Add 52 μL of EB preheated to 65°C to the center of the column membrane and leave at room temperature for 2 min. Centrifuge at 13,000 × g for 1 min.

[0056] (14) Discard the binding column and use the DNA for the next reaction to measure the concentration.

[0057] 2. Prepare the reaction system

[0058] Primer probe combination 5 μL: the forward primer / reverse primer concentration of total bacteria is 0.4 nM, and the probe concentration is 0.4 nM; the forward primer / reverse primer concentration of total lactobacilli is 0.4 nM, and the probe concentration is 0.4 nM; the forward primer / reverse primer concentration of Lactobacillus crispatus is 0.2 nM, and the probe concentration is 0.3 nM; the forward primer / reverse primer concentration of Lactobacillus gasseri is 0.15 nM, and the probe concentration is 0.4 nM; the forward primer / reverse primer concentration of Lactobacillus iners is 0.25 nM, and the probe concentration is 0.2 nM; the forward primer / reverse primer concentration of Lactobacillus jensenii is 0.3 nM, and the probe concentration is 0.25 nM.

[0059] PCR reaction solution 10μL: Tris-HCl 20mM, KCl 20mM, (NH4)2SO410mM, MgSO420mM, EasyTaqDNAPolymerase 2U / μL, dNTP 0.2mM, pH 7.8.

[0060] Template DNA 5μL: Template DNA concentration 5ng / μL.

[0061] 3. Run the experimental program

[0062] The reaction procedure is shown in Table 1.

[0063] Table 1 Experimental procedures

[0064]

[0065] 4. Draw the standard curve

[0066] The positive control plasmids of Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, Lactobacillus jensenii and total bacteria were respectively divided into 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 / μL dilution to obtain diluted samples of each plasmid. Each diluted sample replaced the template DNA in step 2 and was tested according to the experimental procedure in step 3 to obtain a standard curve. The results are as follows:

[0067] Lactobacillus gasseri: y = -3.3857x + 40.089; R 2 =0.9977

[0068] Lactobacillus iners: y = -3.307x + 39.513; R 2 =0.9984

[0069] Lactobacillus crispatus: y = -3.385x + 39.905; R 2 =0.9971

[0070] Lactobacillus jensenii: y = -3.262x + 40.879; R 2 =0.9949

[0071] Total Lactobacillus: y = -3.3529x + 40.311; R 2 =0.9995

[0072] Total bacteria: y = -3.3492x + 40.107; R 2 =0.9991

[0073] The standard curve of total lactobacilli was obtained by calculating the copy number of four lactobacilli plasmids mixed in equal amounts.

[0074] 5. Data Analysis

[0075] After the experiment is completed, the data of the original file of the template DNA is exported.

[0076] According to the average ct value of the corresponding bacterial species in the sample, the bacterial species copy number and relative abundance were calculated according to the standard curve, among which the total lactobacillus was calculated by adding the four lactobacillus species in equal proportions. The results are shown in Table 2.

[0077] Table 2 Test results

[0078] Pathogens Ct value results Total copy number Relative abundance Total Lactobacillus 43.96 410803 0.45％ Lactobacillus crispatus 23.96 310803 0.05％ Lactobacillus iners / Lactobacillus gasseri / Lactobacillus jensenii 22.76 2163371 0.32％

[0079] Example 3

[0080] The kit of Example 1 was used to test the samples, and the test results were compared with the NGS results to explore the accuracy of the kit of Example 1:

[0081] Vaginal swab samples were collected from 50 women, including 25 healthy people and 25 patients with dysbiosis.

[0082] Vaginal swab DNA was extracted, and all DNA was evenly divided into two parts, one part was tested according to the metagenomic NGS detection process, and the other part was tested using the kit of Example 1 according to the steps of Example 2. The results are shown in Table 3.

[0083] Table 3 Comparison of kit test results and NGS results

[0084]

[0085]

[0086]

[0087] Note: In the table, numbers 1-25 represent healthy people, and numbers 26-50 represent patients with imbalanced microbiota.

[0088] The results showed that the detection results of the NGS results were basically consistent with those of the kit. By comparing the absolute abundance and copy number of the NGS results with those of the kit results, it can be judged that the detection is consistent if they are detected at the same time and the numerical trends are consistent. The differences in individual samples are caused by the low detection amount of NGS or the kit. This detection amount is of little significance in practical applications, so it can be ignored. The healthy population is generally dominated by Lactobacillus crispatus, while most patients with dysbacteriosis are dominated by Lactobacillus iners, forming a significant difference between the two groups. Lactobacillus accounts for a higher proportion of total bacteria in the healthy population, while patients with dysbacteriosis have a large number of other species, forming a significant difference between the two groups.

[0089] Example 4

[0090] In practical applications, a typical case of using the kit of Example 1 to perform detection according to the steps of Example 2 is as follows:

[0091] Patient A (replaced by A to protect patient privacy) came to the hospital for pre-pregnancy consultation three times due to repeated "infectious abortion". All existing treatments including cervical cerclage have been tried in the past, but failed to preserve the fetus. The secretion culture during pregnancy was positive for Enterobacter aerogenes, but the proportion of the flora could not be determined. No intervention was given because there were no discomfort symptoms; before and after the abortion, there were obvious symptoms of infection such as fever and elevated blood count. After antibiotic treatment, the vaginal secretion culture was positive for Klebsiella pneumoniae, and it was still unclear whether Lactobacillus was dominantly colonized.

[0092] Vaginal swab sampling was performed on the patient, and the genital tract lactobacilli were quantitatively detected using the kit of Example 1 according to the steps of Example 2. The identification results after 2 hours are shown in Table 4 and Figure 1 shown.

[0093] Table 4 Initial test results of patients (before transplantation)

[0094] category Lactobacillus gasseri Lactobacillus iners Lactobacillus crispatus Lactobacillus jensenii Total Lactobacillus Total bacteria Copy number 245 6114983 54623 0 6298736 9598102 Proportion 0.00％ 97.08％ 0.87％ 0 65.62％ /

[0095] The results showed that the patient was predominantly colonized with Lactobacillus iners, a bacterium associated with recurrent miscarriages refractory to antibiotic treatment.

[0096] The patients were selectively treated with pre-pregnancy vaginal bacteria Lactobacillus (curl strain) transplantation. During the treatment, Lactobacillus detection was performed on the 1st day before transplantation, the 1st day after transplantation, the 7th day, the 14th day, and the 30th day. The results are shown in Table 5. The trend of different strains is shown in Figure 2 As shown in the figure (in the figure, the broken lines of Lactobacillus gasseri and Lactobacillus jensenii overlap), Lactobacillus accounts for Figure 3 shown.

[0097] Table 5 Test results of patients during treatment

[0098]

[0099] The patient was monitored regularly during pregnancy. Although the routine clinical culture method indicated that the vaginal secretions were positive for Klebsiella pneumoniae, the kit detected the dominant colonization of Lactobacillus crispatus, so no treatment was given, avoiding the disturbance of flora caused by unnecessary antibiotic use. The dominant colonization of Lactobacillus crispatus was constant throughout the pregnancy, and the baby was born at full term.

[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting vaginal lactobacillus, characterized in that: It includes detection primer pairs and probes for total bacteria, total lactobacillus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus iners, and Lactobacillus jensenii, and the nucleotide sequences are as follows: Total bacteria detection primer F: SEQ ID NO: 1, total bacteria detection primer R: SEQ ID NO: 2, total bacteria detection probe P: SEQ ID NO: 3; total lactobacillus detection primer F: SEQ ID NO: 4, total lactobacillus detection primer R: SEQ ID NO: 5, total lactobacillus detection probe P: SEQ ID NO: 6; Lactobacillus crispatus detection primer F: SEQ ID NO: 7, Lactobacillus crispatus detection primer R: SEQ ID NO: 8, Lactobacillus crispatus detection probe P: SEQ ID NO: 9; Lactobacillus gasseri detection primer F: SEQ ID NO: 10, Lactobacillus gasseri detection primer R: SEQ ID NO: 11, Lactobacillus gasseri detection probe P: SEQ ID NO: 12; Lactobacillus iners detection primer F: SEQ ID NO: 13, Lactobacillus iners detection primer R: SEQ ID NO: 14, Lactobacillus iners detection probe P: SEQ ID NO: 15; Lactobacillus jensenii detection primer F: SEQ ID NO: 16, Lactobacillus jensenii detection primer R: SEQ ID NO: ID NO: 17, Lactobacillus jensenii detection probe P: SEQ ID NO:

18.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the nucleotide sequence of the detection probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

3. Use of the primer-probe combination according to any one of claims 1 to 2 in the preparation of a quantitative detection kit for vaginal Lactobacillus.

4. A vaginal lactobacillus quantitative detection kit, characterized in that: The invention comprises the primer-probe combination according to any one of claims 1 to 2.

5. The kit according to claim 4, characterized in that The final concentration of the primers for the total bacteria is 0.1-1 nM, and the final concentration of the probe is 0.2-1 nM; the final concentration of the primers for the total lactobacilli is 0.1-1 nM, and the final concentration of the probe is 0.2-1 nM; the final concentration of the primers for the Lactobacillus crispatus is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM; the final concentration of the primers for the Lactobacillus gasseri is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM; the final concentration of the primers for the Lactobacillus iners is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM; the final concentration of the primers for the Lactobacillus jensenii is 0.1-0.4 nM, and the final concentration of the probe is 0.2-0.8 nM.

6. The kit according to claim 4, characterized in that It also includes a PCR reaction solution, which includes 10-40mM Tris-HCl, 10-40mM KCl, 5-20mM (NH4)2SO4, 10-40m MgSO4, 1-5U / μLEasyTaqDNAPolymerase, and 0.1-1mM dNTP, and the pH value of the PCR reaction solution is 7.4-8.

0.

7. The kit according to claim 4, characterized in that Positive and negative quality controls are also included.

8. The kit according to claim 7, characterized in that The positive quality control is a Lactobacillus crispatus plasmid, a Lactobacillus gasseri plasmid, a Lactobacillus iners plasmid, a Lactobacillus jensenii plasmid and a total bacteria plasmid.

9. The kit according to claim 7, characterized in that The negative quality control is ultrapure water.

10. Use of the kit according to any one of claims 4 to 9 in the preparation of a product for quantitative detection of vaginal lactobacilli.

Images