A SLAMP primer set and kit for detecting spotted fever group rickettsia

Abstract

The present application proposes a SLAMP primer set and a kit for detecting spotted fever group rickettsia, and relates to the field of biological detection technology. The SLAMP primer set is a primer set for amplifying the conserved region fragment of spotted fever group rickettsia, and the primer pair is R‑SF / R‑SR; the nucleotide sequence of R‑SF is shown in SEQ ID NO.1, and the nucleotide sequence of R‑SR is shown in SEQ ID NO.2. The kit provided in the present application and the use of the kit can complete the rapid and accurate detection of spotted fever group rickettsia without expensive instruments or complicated operations. The visualization kit provided by the present invention can sensitively and specifically detect spotted fever group rickettsia infection, is easy to operate, and can be used as primary health prevention and pathogen screening at sites with limited conditions.

Description

Technical Field

[0001] The present application relates to the field of biological detection technology, and in particular to a SLAMP primer set and a kit for detecting spotted fever group rickettsia. Background Art

[0002] Spotted fever group Rickettsia is an obligate intracellular Gram-negative bacillus, and its vectors are arthropods, including ticks, lice, mites and fleas. Spotted fever group Rickettsia causes a large number of new and recurring infectious diseases, distributed all over the world, threatening the life and health of humans and livestock. At present, the cases of spotted fever group Rickettsia reported in China are Heilongjiang Rickettsia, Lawrence Rickettsia, Steiner Rickettsia, Ehrlichi Rickettsia, Siberian Rickettsia and Masri Rickettsia. Infection with spotted fever group Rickettsia often occurs in desert and forest tourists and forestry practitioners. The transmission of spotted fever group Rickettsia occurs during the feeding of infected ticks. Once biting the skin, the pathogens are phagocytosed by dendritic cells, transported to local lymph nodes through lymphatic vessels and replicated. The pathogens then enter the blood and spread to infect the endothelium of the microcirculation. Endothelial infection leads to increased vascular permeability. Clinical manifestations include rash, fever, headache, and myalgia, and in severe cases, interstitial pneumonia, meningoencephalitis, acute kidney injury, multiple organ failure, and death. Considering the widespread spread of rickettsiae and their arthropod reservoirs, there is a non-negligible risk to people living and working nearby. Therefore, on-site detection of spotted fever group rickettsiae in animals and ticks in the wild is essential in clinical practice, and timely diagnosis and prevention of human infection should be carried out.

[0003] At present, the commonly used detection methods for spotted fever group rickettsia mainly include serological detection and molecular biological detection. Among them, detection based on polymerase chain reaction (PCR) is the main method for detecting spotted fever group rickettsia, including conventional PCR, nested PCR and quantitative PCR, and whole genome sequencing technology is also widely used. Existing detection methods such as PCR and whole genome sequencing for nucleic acid targets have too long reaction time and cumbersome operation. Summary of the invention

[0004] The purpose of the present application is to provide a SLAMP primer set for detecting spotted fever group rickettsiae, which has the advantages of high sensitivity and strong specificity.

[0005] Another object of the present application is to provide a kit for detecting spotted fever group rickettsiae, which has fast detection speed, high accuracy and is easy to use.

[0006] In order to solve the above technical problems, the technical solution adopted in this application is:

[0007] In one aspect, the present application provides a SLAMP primer set for detecting spotted fever group rickettsiae, wherein the SLAMP primer set is a primer pair R-SF / R-SR;

[0008] Among them, the nucleotide sequence of R-SF is shown in SEQ ID NO.1, and the nucleotide sequence of R-SR is shown in SEQ ID NO.2.

[0009] On the other hand, the present application provides a kit for detecting spotted fever group rickettsiae, wherein the kit comprises the above-mentioned SLAMP primer set.

[0010] Short loop mediated isothermal amplification of nucleic acids (SLAMP) is a newly developed and improved nucleic acid amplification technology under constant temperature conditions (Chinese patent application number: 202411655233.5) based on the CDA technology (Chinese patent authorization number: ZL202110473121.8) and the Japanese LAMP nucleic acid amplification method developed by the inventor team in the early stage. This method mainly uses two different specific primers to identify the specific region of the target gene and perform amplification reactions under constant temperature conditions. Compared with conventional gene detection methods (such as PCR, etc.), the SLAMP reaction can be completed in a constant temperature water bath, with low instrumentation requirements and much simpler operation than traditional PCR and culture methods. It can be accurately completed without professionals, and the amplification results can be combined with the metal ion indicator hydroxynaphthol blue (HNB) to observe the color change by naked eye to realize the judgment of the results, making it suitable for primary medical institutions and local inspection and quarantine departments. Moreover, SLAMP can greatly shorten the operation time and reduce the chance of sample contamination, making it suitable for rapid diagnosis of Vibrio parahaemolyticus. In addition, the key circular primer used in SLAMP is about 30 bp, which is shorter than the 40 bp circular primer in LAMP. The design of the relevant primers is extremely simple, requiring only simple rearrangement, which will greatly save design time and development costs.

[0011] Compared with the prior art, the embodiments of the present application have at least the following advantages or beneficial effects:

[0012] 1. The SLAMP primer set provided in the present application is designed by the specific conserved region of spotted fever group rickettsia (GenBank: MK304548.1) and screened out a primer set with good amplification effect, and is composed of 2 primers, including an intra-sequence primer pair (R-SF / R-SR). The primer set provided by the present invention has high sensitivity and strong specificity, and the kit prepared therefrom can quickly and accurately detect spotted fever group rickettsia contained in the sample to be tested.

[0013] 2. The primer set provided in this application has extremely high specificity, and the time required for SLAMP amplification is short, which further shortens the detection time and simplifies the operation.

[0014] 3. The kit provided in this application and the use of the kit can complete the rapid and accurate detection of spotted fever group rickettsia without expensive instruments or complicated operations. Therefore, it is suitable for primary health prevention and pathogen screening in areas with limited conditions such as the field. The visualization kit provided in this application will greatly facilitate on-site detection and can achieve rapid and accurate detection of spotted fever group rickettsia. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 This is a graph showing the change in fluorescence intensity versus reaction time in Example 1 of the present application.

[0017] Figure 2 This is a graph showing the change in fluorescence intensity versus reaction time in Example 2 of the present application.

[0018] Figure 3 This is an endpoint monitoring chart based on color change in the reaction using HNB in ​​implementation 3 of the present application. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme in the embodiments of the present application will be described clearly and completely below. The experimental methods used in the following embodiments are conventional methods unless otherwise specified, and can be specifically referred to the specific methods listed in the book "Molecular Cloning Experiment Guide" (3rd Edition) by J. Sambrook, or carried out according to the kit and product instructions; the materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0020] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present application will be described in detail below with reference to specific embodiments.

[0021] A SLAMP primer set for detecting spotted fever group rickettsiae, wherein the SLAMP primer set is a primer pair R-SF / R-SR;

[0022] Among them, the nucleotide sequence of R-SF is shown in SEQ ID NO.1, and the nucleotide sequence of R-SR is shown in SEQ ID NO.2.

[0023] A kit for detecting spotted fever group rickettsiae, comprising the SLAMP primer set according to claim 1.

[0024] In some embodiments of the present application, in the above SLAMP primer set, the concentrations of primers R-SF and R-SR are both 1-2 μM.

[0025] In some embodiments of the present application, the above-mentioned kit further includes Bst polymerase, SLAMP reaction buffer, ultrapure water and a color developer.

[0026] In some embodiments of the present application, the color developer is selected from one of Sybr green I, Eva green and hydroxynaphthol blue.

[0027] In some embodiments of the present application, the SLAMP reaction buffer comprises Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Triton X-100.

[0028] In some embodiments of the present application, the composition of the reaction system of the above-mentioned kit is:

[0029] 2-50mM Tris-HCl pH8.8, 2-20mM KCl, 2-20mM (NH4)2SO4, 2-20mM MgSO4, 0.1-0.5% Triton X-100, 0.2-1M betaine, 1-1.6mM dNTP, 5-10U Bst DNA polymerase, 100-150μmol / L color developer, 1-2μM primer R-SF and 1-2μM primer R-SR; the reaction solvent is ultrapure water.

[0030] In the present application, the kit is used to detect spotted fever group rickettsia, comprising the following steps:

[0031] Step 1: Mix the nucleic acid sample to be detected and the reaction system of the kit to prepare an amplification reaction solution;

[0032] Step 2: react the amplification reaction solution prepared above at 60-65°C for 20-80 minutes, and determine whether the sample contains spotted fever group rickettsia based on the color development result.

[0033] The features and performance of the present application are further described in detail below in conjunction with the embodiments.

[0034] Example 1

[0035] This example uses Eva Green to verify the amplification reaction of spotted fever group rickettsia genomic DNA fragments:

[0036] Eva Green is similar to SYBR Green I. It is a dye with a green excitation wavelength that binds to the minor groove region of all dsDNA double helixes. Its inhibition on nucleic acid amplification reactions such as PCR is much less than that of the latter. In the free state, EvaGreen emits weak fluorescence, but once it binds to double-stranded DNA, the fluorescence is greatly enhanced. Therefore, the fluorescence signal intensity of Eva Green is related to the amount of double-stranded DNA, and the amount of double-stranded DNA in the nucleic acid amplification system can be detected based on the fluorescence signal.

[0037] The reaction solution was composed as follows (add ddH2O to make up to 25 μL):

[0038] 20mM Tris-HCl pH 8.8, 10mM KCl, 10mM (NH4)2SO4, 14mM MgSO4, 0.1% Triton X-100, 1M betaine, 1.25mM dNTP, 8U Bst DNA polymerase (NEW ENGLAND Biolabs), 1× Eva Green (Biotum), and primers: 1600nM R-SF and 1600nM R-SR, the primers are shown in Table 1:

[0039] Table 1 Primer sequences

[0040] Serial Number Primer name Nucleotide sequence SEQ ID NO.1 R-SF ACCGCTAACACTACTTCACGAATGGCGGT SEQ ID NO.2 R-SR TGATATCACAACGAAACTTGTAGCACCTGC

[0041] Target: Spotted fever group rickettsia genomic dsDNA (shown in SEQ ID NO.3)

[0042] Two positive controls were set up, and two negative control groups without target were also set up.

[0043] The SLAN 96 real time PCR reaction temperature was set to 61°C and the reaction time was 60 min. The curve of fluorescence intensity versus reaction time is shown in Figure 1 shown. Figure 1 The results show that the primer set provided by the present invention can achieve rapid amplification of the conserved region specific to spotted fever group rickettsiae, and the application of fluorescence detection therein can achieve the purpose of real-time monitoring, and the result can be judged in advance through the real-time amplification curve.

[0044] Example 2

[0045] In this example, Eva Green was used to verify the amplification reaction of the spotted fever group rickettsia SLAMP primer set on genomes extracted from various bacteria, and the method was the same as that in Example 1.

[0046] The reaction solution was composed as follows (add ddH2O to make up to 25 μL):

[0047] 20mM Tris-HCl pH8.8, 10mM KCl, 10mM (NH4)2SO4, 14mM MgSO4, 0.1% Triton X-100, 1M betaine, 1.25mM dNTP, 8U Bst DNA polymerase (NEW ENGLAND Biolabs), 1×Eva Green (Biotum) and primers: 1600nM R-SF (shown in SEQ ID NO.1), 1600nM R-SR (shown in SEQ ID NO.2).

[0048] Target nucleic acid 1: Genomic DNA extracted from spotted fever group Rickettsia (target sequence as shown in SEQ ID NO.3), set as positive control;

[0049] Target nucleic acid 2: Genomic DNA extracted from Klebsiella pneumoniae, set as negative control;

[0050] Target nucleic acid 3: genomic DNA extracted from Anaplasma, set as negative control;

[0051] Target nucleic acid 4: Salmonella extracted genomic DNA, set as negative control;

[0052] A non-target control group was also set up.

[0053] The SLAN 96 real time PCR reaction temperature was set to 61°C and the reaction time was 60 min. The curve of fluorescence intensity versus reaction time is shown in Figure 2 shown. Figure 2 The results show that the primer set provided by the present invention can distinguish spotted fever group Rickettsia from Klebsiella pneumoniae, Anaplasma, and Salmonella, further illustrating the specificity of the SLAMP primer set provided by the present invention.

[0054] Example 3

[0055] This example uses hydroxynaphthol blue (HNB) to monitor the endpoint of the spotted fever group rickettsia SLAMP amplification reaction:

[0056] Hydroxynaphthol blue (HNB) is a metal ion indicator. It indicates the change in the amount of magnesium ions or manganese ions combined with the byproduct pyrophosphate in the reaction, thereby showing different indicator colors to judge the results. The combination of the reaction solution for SLAMP amplification of spotted fever group Rickettsia using hydroxynaphthol blue (HNB) is shown below.

[0057] The reaction solution was composed as follows, and the remainder was made up to 25 μL by adding ddH2O:

[0058] 20mM Tris-HCl pH8.8, 10mM KCl, 10mM (NH4)2SO4, 14mM MgSO4, 0.1% Triton X-100, 1M betaine, 1.25mM dNTP, 8U Bst DNA polymerase (NEW ENGLAND Biolabs), 120μM HNB, primers: 1600nM R-SF (shown in SEQ ID NO.1), 1600nM R-SR (shown in SEQ ID NO.2).

[0059] Target nucleic acid: Genomic DNA extracted from spotted fever group Rickettsia. Set up 8 positive controls and 8 negative controls for the amplification reaction. Set the constant temperature water bath to 61°C and the reaction time to 60 minutes. The endpoint results of the positive and negative reactions are as follows: Figure 3 As shown, violet indicates negative, and sky blue indicates positive. The experimental results show that the application of HNB can realize the judgment of reaction results by color, and the interpretation can be performed without the assistance of instruments.

[0060] In summary, the SLAMP primer set and kit for detecting spotted fever group rickettsia in the embodiment of the present application have the following advantages: 1. The SLAMP primer set provided by the present invention is designed by the specific conserved region of spotted fever group rickettsia (GenBank: MK304548.1) and screened out a primer set with good amplification effect, and is composed of 2 primers, including an intra-sequence primer pair (R-SF / R-SR). The primer set provided by the present invention has high sensitivity and strong specificity, and the kit prepared therefrom can quickly and accurately detect spotted fever group rickettsia contained in the sample to be tested.

[0061] 2. The primer set provided in this application has extremely high specificity, and the time required for SLAMP amplification is short, which further shortens the detection time and simplifies the operation.

[0062] 3. The kit provided in this application and the use of the kit can complete the rapid and accurate detection of spotted fever group rickettsia without expensive instruments or complicated operations. Therefore, it is suitable for primary health prevention and pathogen screening in areas with limited conditions such as the field. The visualization kit provided in this application will greatly facilitate on-site detection and can achieve rapid and accurate detection of spotted fever group rickettsia.

[0063] The embodiments described above are part of the embodiments of the present application, rather than all of the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the present application for protection, but merely represents the selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present application.

Claims

1. A SLAMP primer set for detecting spotted fever group rickettsiae, characterized in that: The SLAMP primer set is a primer pair R-SF / R-SR; Among them, the nucleotide sequence of R-SF is shown in SEQ ID NO.1, and the nucleotide sequence of R-SR is shown in SEQ ID NO.

2.

2. A kit for detecting spotted fever group rickettsiae, characterized in that: The reaction system of the kit comprises the SLAMP primer set according to claim 1.

3. A kit for detecting spotted fever group rickettsia according to claim 2, characterized in that: In the SLAMP primer set, the concentrations of primers R-SF and R-SR are both 1 to 2 μM.

4. A kit for detecting spotted fever group rickettsia according to claim 2, characterized in that: The reaction system of the kit also includes Bst polymerase, SLAMP reaction buffer, ultrapure water and a color developer.

5. A kit for detecting spotted fever group rickettsia according to claim 4, characterized in that: The developer is selected from one of Sybr green I, Eva green and hydroxynaphthol blue.

6. A kit for detecting spotted fever group rickettsia according to claim 4, characterized in that: The SLAMP reaction buffer includes Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Triton X-100.

7. A kit for detecting spotted fever group rickettsia according to claim 2, characterized in that: The reaction system of the kit is composed of: 2~50mM Tris-HCl pH8.8, 2~20mM KCl, 2~20mM (NH4)2SO4, 2~20mM MgSO4, 0.1~0.5% Triton X-100, 0.2~1M betaine, 1~1.6mM dNTP, 5~10U Bst DNA polymerase, 100~150μmol / L color developer, 1~2μM primer R-SF and 1~2μM primer R-SR; the reaction solvent is ultrapure water.

Images