SV Molecular Markers Related to the Content of Cassava Amylopectin and Amylose and Their Applications

Abstract

The present invention provides an SV molecular marker related to the amylopectin and amylose contents of cassava and its application, belonging to the field of molecular biotechnology. The SV molecular marker is Chr14_26344949_26345058, which is used to predict the amylopectin and / or amylose contents of cassava; the primer set for amplifying the SV molecular marker includes: the forward primer has a sequence of 5'-AGATCATTCAGCCCATTT-3'; the reverse primer has a sequence of 5'-ATCCACCAAAGTTCGTAA-3'; a kit is prepared using this primer set; the DNA of the cassava to be tested is subjected to PCR amplification using the above primer set or the above kit to predict the amylopectin and / or amylose contents of cassava. The SV molecular marker of the present invention can accurately and efficiently predict the high or low amylopectin and amylose contents of cassava without waiting for the cassava to grow into a mature plant by planting, greatly improving the breeding selection efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to an SV molecular marker related to the content of branched and linear starch in cassava and its application, solving the problems of long breeding time and high breeding cost for new cassava varieties with specific levels of branched starch content or linear starch content in starch in the prior art. Background Art

[0002] Cassava, also known as tapioca, tree sweet potato, woody root, etc., is a tropical and subtropical perennial shrub crop widely cultivated in tropical and subtropical regions around the world. Cassava tubers are large and rich in starch. They have a rough and simple appearance, with various tuber shapes and rough epidermis, but extremely high internal starch content, delicate texture, white powder, and soft taste. It is an important food and industrial raw material, and has the elegant names of "king of starch", "treasure of tropical crops", and "energy crop". Mature cassava tubers are rich in starch, with large and high-purity starch granules, having excellent processing performance and important edible and industrial values. Therefore, developing cassava production will greatly promote the development of related industries such as food processing, bioenergy, papermaking, textile, and feed, and has important significance.

[0003] The content of branched starch and linear starch in cassava starch is of great significance in the cultivation and utilization of cassava. In the food industry, cassava starch with a high content of branched starch usually has better gelatinization properties and stability, and is suitable for making foods such as pastries and sauces. Cassava starch with a high content of linear starch has better gelation properties and resistant starch properties, and is suitable for making low-sugar and low-fat foods. There is usually a certain negative correlation between the content of branched starch and linear starch in cassava. When the content of branched starch increases, the content of linear starch usually decreases, and vice versa.

[0004] In traditional cassava molecular breeding, farmers or breeders mainly select individual plants with excellent traits and fix the excellent traits through hybridization or backcrossing. Currently, to obtain a new cassava variety with specific levels of branched and linear starch content in starch, it is necessary to wait for the plants to reach maturity and then investigate the levels of branched and linear starch content in tuber starch to screen for excellent plants. This breeding method has a long breeding time and high breeding cost. Summary of the Invention

[0005] In view of the above problems, the present invention provides an SV molecular marker related to the content of branched and linear starch in cassava and its application.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] An SV molecular marker related to the amylopectin and amylose contents of cassava, wherein the SV molecular marker is a large fragment deletion occurring at bases 26344949 to 26345058 of chromosome 14 of the cassava genome, the sequence deletion length is 110 bp, named Chr14_26344949_26345058, and the sequence is as shown in SEQ ID NO: 1;

[0008] The amylopectin content of cassava carrying the SV molecular marker is significantly higher than (i.e., greater than) the amylopectin content of cassava lacking the SV molecular marker (i.e., the large fragment deletion occurring at bases 26344949 to 26345058 of chromosome 14);

[0009] The amylose content of cassava carrying the SV molecular marker is lower than (i.e., less than) the amylose content of cassava lacking the SV molecular marker (i.e., the large fragment deletion occurring at bases 26344949 to 26345058 of chromosome 14);

[0010] Cassava carrying the SV molecular marker has a higher amylopectin content and a lower amylose content, and is cassava with a high amylopectin content and a low amylose content;

[0011] Cassava lacking the SV molecular marker has a lower amylopectin content and a higher amylose content, and is cassava with a low amylopectin content and a high amylose content.

[0012] An application of the above-mentioned SV molecular marker related to the amylopectin and amylose contents of cassava, wherein the application is to predict the amylopectin content and / or amylose content of cassava by detecting whether the cassava carries the SV molecular marker.

[0013] A primer set for amplifying the above-mentioned SV molecular marker related to the amylopectin and amylose contents of cassava, wherein the primer set is a set of primers designed upstream and downstream of the above-mentioned SV molecular marker, that is, the forward primer is designed according to the sequence upstream of nucleotide 26344949 of chromosome 14 of the cassava genome, and the reverse primer is designed according to the sequence downstream of nucleotide 26345058 of chromosome 14 of the cassava genome, including:

[0014] The sequence of the forward primer is 5'-AGATCATTCAGCCCATTT-3', and the sequence is as shown in SEQ ID NO: 3;

[0015] The sequence of the reverse primer is 5'-ATCCACCAAAGTTCGTAA-3', and the sequence is as shown in SEQ ID NO: 4.

[0016] A kit comprising the above-mentioned primer set.

[0017] Further, the kit includes conventional reagents for PCR amplification.

[0018] Further, the kit includes: 2× Rapid Taq Master Mix and ddH2O.

[0019] A method for identifying the contents of amylopectin and amylose in cassava, the method comprising performing PCR amplification on the DNA of the cassava to be tested using the above primer set to predict the amylopectin content and / or amylose content of the cassava to be tested;

[0020] Or, performing PCR amplification on the DNA of the cassava to be tested using the above kit to predict the amylopectin content and / or amylose content of the cassava to be tested.

[0021] Further, predicting the amylopectin content and / or amylose content of the cassava to be tested is to sequence the PCR amplification product and determine whether the SV molecular marker is carried to predict the amylopectin content and / or amylose content of the cassava to be tested;

[0022] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, with a length of 267 bp, and the 112th to 221st bases from the 5' end (i.e., the front end of the sequence) are the SV molecular marker fragment, and at this time the test product carries this SV molecular marker, then the amylopectin content of the cassava to be tested is higher and the amylose content is lower, and it is a cassava with high amylopectin content and low amylose content;

[0023] Otherwise, the cassava to be tested lacks this SV molecular marker, that is, a large fragment deletion occurs at positions 26344949 to 26345058 on chromosome 14 in the sample genome, and the length of the PCR amplification product is 157 bp, then the amylopectin content of the cassava to be tested is lower and the amylose content is higher, and it is a cassava with low amylopectin content and high amylose content.

[0024] Further, predicting the amylopectin content and / or amylose content of the cassava to be tested is to perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection result to predict the amylopectin content and / or amylose content of the cassava to be tested;

[0025] When only a 267 bp band appears in the electrophoresis detection result, then the cassava to be tested carries this SV molecular marker, and the amylopectin content of the cassava to be tested is higher and the amylose content is lower, and it is a cassava with high amylopectin content and low amylose content;

[0026] When only a 157 bp band appears in the electrophoresis detection result, then the cassava to be tested lacks this SV molecular marker, and the amylopectin content of the cassava to be tested is lower and the amylose content is higher, and it is a cassava with low amylopectin content and high amylose content.

[0027] Furthermore, the PCR amplification system includes: 12.5 μL of 2× Rapid Taq Master Mix, 1 μL of the forward primer with a concentration of 10 μM, 1 μL of the reverse primer with a concentration of 10 μM, 1 μL of the DNA template of the cassava to be tested, and 9.5 μL of ddH2O;

[0028] The reaction procedure for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for 35 cycles; 72°C for 5 min.

[0029] The beneficial effects of the SV molecular marker related to the amylopectin and amylose contents of cassava and its application in the present invention are as follows:

[0030] The present invention has developed an SV molecular marker related to the amylopectin and amylose contents of cassava. Using this SV molecular marker, it is possible to accurately and efficiently predict the high or low amylopectin content and amylose content of cassava without waiting for the cassava to grow into a mature plant by planting. This has greatly improved the selection efficiency of cassava breeding, can efficiently assist in the breeding selection of cassava, and has extremely high economic value;

[0031] The present invention has developed an SV molecular marker related to the amylopectin and amylose contents of cassava and established a method for accurately and rapidly identifying the amylopectin and amylose contents of cassava, providing a more effective theoretical and practical basis for molecular marker-assisted cultivation of new cassava varieties with specific amylopectin and amylose content levels; using this molecular marker-assisted breeding technology can accelerate the investigation of the amylopectin and amylose content levels in tuber starch, facilitate the screening of excellent plants, shorten the breeding cycle, and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 is the Manhattan plot of the genome-wide chromosome association analysis and localization of the amylopectin content trait data of 337 cassava samples in Example 1 of the present invention;

[0033] Figure 2 is the Manhattan plot of the genome-wide chromosome association analysis and localization of the amylose content trait data of 337 cassava samples in Example 1 of the present invention;

[0034] Figure 3 is the T-test result of the amylopectin content level of 109 cassava samples in Example 5 of the present invention; among them, REF represents cassava carrying the SV molecular marker, n = 39 represents the sample size of 39 samples; SV represents cassava lacking the SV molecular marker, n = 70 represents the sample size of 70 samples;

[0035] Figure 4This is the T - test result of the amylopectin and amylose content levels of 109 cassava samples in Example 5 of the present invention. Among them, REF represents cassava carrying the SV molecular marker, n = 39 represents the sample size of 39 samples; SV represents cassava lacking the SV molecular marker, n = 70 represents the sample size of 70 samples. Detailed implementation mode

[0036] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below. The present invention will be further described in detail below in conjunction with specific embodiments for those skilled in the art to understand.

[0037] Example 1 Obtaining of SV molecular markers related to amylopectin and amylose content in cassava

[0038] Collect the genome re - sequencing data of 337 cassava samples planted in Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude). Align the quality - controlled sequencing data to the cassava reference gene to obtain the cassava whole - genome SV molecular marker map, and perform genome - wide association analysis in combination with the phenotypic data of amylopectin content and amylose content in cassava starch. The results are as Figure 1 and Figure 2 shown. It can be seen that there is an SV molecular marker on the cassava genome that is significantly associated with the levels of amylopectin content and amylose content in cassava ( Figure 1 and Figure 2 the positions indicated by the arrows in).

[0039] The SV molecular marker related to amylopectin and amylose content in cassava is a large - fragment deletion occurring at bases 26344949 - 26345058 on chromosome 14 of the cassava genome. The sequence deletion length is 110 bp, named Chr14_26344949_26345058, and the sequence is as shown in SEQ ID NO: 1.

[0040] Using this SV molecular marker to detect cassava breeding materials, the amylopectin content of cassava carrying the SV molecular marker is significantly higher than that of cassava lacking the SV molecular marker (i.e., a large - fragment deletion occurring at bases 26344949 - 26345058 on chromosome 14). The amylose content of cassava carrying this SV molecular marker is lower than that of cassava lacking this SV molecular marker (i.e., a large - fragment deletion occurring at bases 26344949 - 26345058 on chromosome 14).

[0041] Therefore, by using this SV molecular marker, it is possible to accurately and efficiently predict the high or low content of amylopectin and / or amylose in cassava without waiting for the cassava plants to mature by planting, greatly improving the selection efficiency of cassava breeding, assisting in the breeding selection of cassava efficiently, and having extremely high economic value.

[0042] Example 2 Primer set and kit for identifying the amylopectin and amylose contents in cassava

[0043] Based on the characteristics of the SV molecular marker related to the amylopectin and amylose contents in cassava in Example 1 on the cassava genome, a set of primers was designed upstream and downstream of this SV molecular marker. That is, the forward primer was designed according to the sequence upstream of the 26,344,949th nucleotide on chromosome 14 of the cassava genome, and the reverse primer was designed according to the sequence downstream of the 26,345,058th nucleotide on chromosome 14 of the cassava genome.

[0044] The sequence of the forward primer is 5'-AGATCATTCAGCCCATTT-3', and the sequence is as shown in SEQ ID NO: 3;

[0045] The sequence of the reverse primer is 5'-ATCCACCAAAGTTCGTAA-3', and the sequence is as shown in SEQ ID NO: 4.

[0046] Among them, the sequence upstream of the 26,344,949th nucleotide on chromosome 14 of the cassava genome on which the forward primer is based is: 5'-TCTAAAGTTTCGGGATAAGACTAAAAAATAAGGTATATAAGATCATTCAGCCCATTTTGTTTAACTAAATTAGTCATACCCAGTAAAGCATTACAAAAAATACATCAGATGATTACAAAGAGTCATACCCAGTAGAGCTTACATGGAGTA-3';

[0047] The sequence downstream of the 26,345,058th nucleotide on chromosome 14 of the cassava genome on which the reverse primer is based is: 5'-AGTTGAATTACGAATTTAATTTTTGAGATTACGAACTTTGGTGGATTGTGTATGAGAAGTTTATTTCAGAAACATTTTTCACGAGACTAATTCTGTGGCGGATAGCTTAGCGAAATCGTCAGTTGAAGGCCCTATTGAGATGTAAATTCT-3'.

[0048] When designing primers, in order to enhance the applicability and sensitivity of the primers, the designed primers have a length between 18 and 25 bp, and the primers do not interfere with each other. The above two primers can be obtained by artificial synthesis.

[0049] This embodiment also provides a kit for identifying the contents of branched and linear starch in cassava. The kit includes the above primer set.

[0050] The kit also includes conventional reagents for PCR amplification, such as 2× Rapid Taq Master Mix and ddH2O.

[0051] The primer set designed by the present invention has strong specificity and can accurately amplify the sequence carrying / deleting the SV molecular marker of the present invention.

[0052] By using the primer set or kit of the present invention, it is possible to accurately and efficiently predict the high or low content of branched starch and / or linear starch in cassava without waiting for the cassava to grow into a mature plant by planting.

[0053] Example 3 Method for Identifying the Contents of Branched and Linear Starch in Cassava

[0054] This embodiment provides a method for identifying the contents of branched and linear starch in cassava. The specific method includes the following steps:

[0055] S1. Extract the DNA of the cassava to be tested as a DNA template;

[0056] S2. Use the primer set in Example 2 to perform PCR amplification on the DNA template of the cassava to be tested;

[0057] The reaction system for PCR amplification is: 12.5 μL of 2× Rapid Taq Master Mix, 1 μL of the forward primer with a concentration of 10 μM, 1 μL of the reverse primer with a concentration of 10 μM, 1 μL of the DNA template, and 9.5 μL of ddH2O. Among them, Mix (amplification buffer) is purchased from Novoprotein Scientific Inc., and the primer set is synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.

[0058] The reaction program for PCR amplification is: 5 min at 95°C; 30 s at 95°C, 30 s at 60°C, 30 s at 72°C, 35 cycles; 5 min at 72°C.

[0059] S3. Sequence the obtained PCR amplification product to determine whether it carries the SV molecular marker fragment.

[0060] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, with a length of 267 bp, the bases at positions 112 - 221 from the 5' end (i.e., the front end of the sequence) are the SV molecular marker fragment. At this time, if the test product carries this SV molecular marker, then the tapioca has a relatively high amylopectin content and a relatively low amylose content, and it is a tapioca with high amylopectin content and low amylose content.

[0061] Otherwise, the test tapioca lacks this SV molecular marker, that is, a large - fragment deletion occurs at bases 26344949 - 26345058 on chromosome 14 in the sample genome, and the length of the PCR amplification product is 157 bp. Then, the tapioca has a relatively low amylopectin content and a relatively high amylose content, and it is a tapioca with low amylopectin content and high amylose content.

[0062] Alternatively, perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection results;

[0063] When only a 267 - bp band appears in the electrophoresis detection result, the test tapioca carries this SV molecular marker. The tapioca has a relatively high amylopectin content and a relatively low amylose content, and it is a tapioca with high amylopectin content and low amylose content;

[0064] When only a 157 - bp band appears in the electrophoresis detection result, the test tapioca lacks this SV molecular marker. The tapioca has a relatively low amylopectin content and a relatively high amylose content, and it is a tapioca with low amylopectin content and high amylose content.

[0065] Among them, for tapioca with high amylopectin content and low amylose content, the amylopectin content is generally > 75.5%, and the amylose content is generally ≤ 24.5%;

[0066] For tapioca with low amylopectin content and high amylose content, the amylopectin content is generally ≤ 75.5%, and the amylose content is generally > 24.5%.

[0067] Example 4 Detection and Verification of SV Molecular Marker in Tapioca

[0068] To verify the practicality of this SV molecular marker, in the tapioca planting area of Danzhou City, Hainan Province, China (109.5°E, 19.5°N), several tapioca plants (excluding the 337 tapioca plants used for SV molecular marker development) were randomly selected. Using the method in Example 3, it was determined whether they carried the SV molecular marker through PCR amplification, and the amylose and amylopectin contents of these tapioca samples were detected. The results are shown in Tables 1 - 3 below.

[0069] Table 1 Whether 20 tapioca plants carry the SV molecular marker and their amylopectin and amylose contents (%)

[0070]

[0071] Table 2 Statistical table of whether 20 cassava plants carry SV molecular markers and amylopectin content (%)

[0072]

[0073] Table 3 Statistical table of whether 20 cassava plants carry SV molecular markers and amylose content (%)

[0074]

[0075] As can be seen from Table 1 to Table 3, the method of the present invention can identify that cassava carrying the SV molecular marker has a higher amylopectin content and a lower amylose content, which is cassava with a high amylopectin content and a low amylose content; cassava lacking the SV molecular marker has a lower amylopectin content and a higher amylose content, which is cassava with a low amylopectin content and a high amylose content, indicating that the method of the present invention can be used to identify the high or low amylopectin content and / or amylose content of cassava.

[0076] Example 5 Detection of SV molecular markers in cassava

[0077] Furthermore, the method in Example 3 was used to genotype 103 cassava samples, and the results are as Figures 3 to 4 shown. Among them, 39 samples carry the SV molecular marker, and 70 samples lack the SV molecular marker. The amylopectin and amylose content levels of these samples were detected and a T-test was performed. The results showed that the P value was 0.0000052, that is, the amylopectin content of cassava carrying the SV molecular marker was higher than that of cassava lacking the SV molecular marker, and there was a significant difference; at the same time, the amylose content of cassava carrying the SV molecular marker was lower than that of cassava lacking the SV molecular marker, and there was a significant difference.

[0078] Other parts not described in detail are all prior arts. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of the embodiments. Those of ordinary skill in the art can also obtain other embodiments according to this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An SV molecular marker related to the amylopectin and amylose content of cassava, characterized in that, The sequence of the SV molecular marker is shown as SEQ ID NO: 1; The amylopectin content of cassava carrying this SV molecular marker is greater than that of cassava lacking this SV molecular marker; The amylose content of cassava carrying this SV molecular marker is less than that of cassava lacking this SV molecular marker.

2. Use of a reagent for detecting SV molecular markers related to the amylopectin and amylose contents of cassava according to claim 1, characterized in that, The application is to detect whether the cassava carries the SV molecular marker through the reagent to predict the amylopectin content and / or amylose content of the cassava; The amylopectin content of cassava carrying this SV molecular marker is greater than that of cassava lacking this SV molecular marker; The amylose content of cassava carrying this SV molecular marker is less than that of cassava lacking this SV molecular marker.

3. A primer set for detecting SV molecular markers related to the content of cassava amylopectin and amylose as described in claim 1, characterized in that, The primer set includes: The sequence of the forward primer is 5'-AGATCATTCAGCCCATTT-3'; The sequence of the reverse primer is 5'-ATCCACCAAAGTTCGTAA-3'.

4. A kit comprising the primer set according to claim 3.

5. The kit according to claim 4, characterized in that, The kit includes reagents for PCR amplification.

6. The kit according to claim 5, wherein The kit includes: 2× Rapid TaqMaster Mix and ddH2O.

7. A method for identifying the contents of amylopectin and amylose in cassava, characterized in that The method is to perform PCR amplification on the DNA of the cassava to be tested using the primer set according to claim 3, sequence the PCR amplification product, and determine whether it carries the SV molecular marker to predict the amylopectin content and / or amylose content of the cassava to be tested; Alternatively, perform PCR amplification on the DNA of the cassava to be tested using the kit according to any one of claims 4-6, sequence the PCR amplification product, and determine whether it carries the SV molecular marker to predict the amylopectin content and / or amylose content of the cassava to be tested; When the nucleotide sequence of the PCR amplification product is shown as SEQ ID NO: 2 and the length is 267 bp, at this time the tested product carries this SV molecular marker, then the cassava to be tested is a cassava with high amylopectin content and low amylose content; the amylopectin content of cassava with high amylopectin content and low amylose content is generally > 75.5%, and the amylose content is generally ≤ 24.5%; Otherwise, the cassava to be tested lacks this SV molecular marker, and the length of the PCR amplification product is 157 bp, then the cassava to be tested is a cassava with low amylopectin content and high amylose content; the amylopectin content of cassava with low amylopectin content and high amylose content is generally ≤ 75.5%, and the amylose content is generally > 24.5%.

8. The method for identifying the contents of branched and linear starches in cassava according to claim 7, characterized in that, The system for PCR amplification includes: 2× Rapid Taq Master Mix, the forward primer, the reverse primer, the DNA template of the cassava to be tested, and ddH2O; The reaction program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

9. A method for identifying the contents of amylopectin and amylose in cassava, characterized in that, The method is to perform PCR amplification on the DNA of the cassava to be tested using the primer set described in claim 3, perform electrophoresis detection on the PCR amplification product, and interpret the electrophoresis detection result to determine whether the SV molecular marker is carried, so as to predict the amylopectin content and / or amylose content of the cassava to be tested; Alternatively, perform PCR amplification on the DNA of the cassava to be tested using the kit described in any one of claims 4-6, perform electrophoresis detection on the PCR amplification product, and interpret the electrophoresis detection result to determine whether the SV molecular marker is carried, so as to predict the amylopectin content and / or amylose content of the cassava to be tested; When only a 267bp band appears in the electrophoresis detection result, the cassava to be tested carries this SV molecular marker, and this cassava to be tested is a cassava with a high amylopectin content and a low amylose content; the amylopectin content of the cassava with a high amylopectin content and a low amylose content is generally > 75.5%, and the amylose content is generally ≤ 24.5%; When only a 157bp band appears in the electrophoresis detection result, the cassava to be tested lacks this SV molecular marker, and this cassava to be tested is a cassava with a low amylopectin content and a high amylose content; the amylopectin content of the cassava with a low amylopectin content and a high amylose content is generally ≤ 75.5%, and the amylose content is generally > 24.5%.

10. The method for identifying the contents of branched and linear starches in cassava according to claim 9, characterized in that, The system for PCR amplification includes: 2× Rapid Taq Master Mix, the forward primer, the reverse primer, the DNA template of the cassava to be tested, and ddH2O; The reaction program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

Images