A method for whole genome detection of enterovirus based on NGS and its application

Abstract

The present invention discloses a method for detecting whole genome of enterovirus based on NGS and its application, which belongs to the technical field of second generation gene sequencing. The gene-specific reverse transcription primers and PCR amplification primers designed according to the enterovirus consensus sequence of the present invention are adaptable to variable sample sequences and have high amplification efficiency. The reverse transcription, amplification and linker addition processes of the detection method provided by the present invention are all completed in one tube, reducing sample cross contamination and saving costs; the whole genome of the virus as low as 120 copies can be detected in a 1 million times human RNA background, and the detection sensitivity is high.

Description

Technical Field

[0001] The present invention belongs to the technical field of second-generation gene sequencing, and specifically relates to a method for detecting the whole genome of enterovirus based on NGS and its application. Background Art

[0002] Enterovirus (EV) belongs to the Picornaviridae family. Its genome is a single-stranded RNA molecule with a total length of about 7.5 to 8.4 kb, which is wrapped by a virus-encoded icosahedral protein shell. Enterovirus is an important human pathogenic microorganism. Poliovirus, Coxsackievirus, and echovirus, which have caused widespread health problems in the past, are all enteroviruses. Therefore, rapid, accurate, and early detection of enterovirus is of great clinical value for the treatment of patients.

[0003] The latest progress in molecular biology research divides enterovirus into four categories, ABCD, and at least 116 subtypes. The genomes of enteroviruses of different categories and subtypes have certain similarities but more differences. In addition, as an RNA virus, the genome sequence of enterovirus itself mutates rapidly. With the rapid changes in the epidemic trend of enterovirus and the need to identify new enteroviruses, traditional serology, qPCR and other methods can no longer meet current needs. There is an urgent need for a technology that can directly detect the whole genome sequence of enteroviruses without molecular characteristics such as the type of enterovirus.

[0004] The whole genome sequencing method based on next-generation sequencing (NGS) can cover the entire length of the virus sequence, making up for the shortcoming that the conventional method can only detect a small number of known regions, not only improving the detection accuracy, but also identifying possible mutations of the virus. Based on this, the present invention provides a method for whole genome detection of enterovirus based on NGS, which has high detection efficiency and good sensitivity, is applicable to all enteroviruses, and obtains detailed base sequence information of the whole genome of enterovirus except for the last approximately 20 bp without the need to know the type and subtype of the virus sample in advance. Summary of the invention

[0005] One object of the present invention is to provide a primer and its application in the whole genome detection of enterovirus, the primer comprising a specific reverse transcription primer and a specific PCR amplification primer; the second object of the present invention is to provide a kit comprising the primer, the kit is used for whole genome detection of enterovirus; the third object of the present invention is to provide a method for whole genome detection of enterovirus for non-disease diagnosis and treatment purposes; and another object of the present invention is to provide a library construction method for whole genome detection of enterovirus based on NGS.

[0006] If not otherwise specified, the enterovirus described in the technical solution of the present invention includes all currently known enteroviruses of the four types A, B, C, and D.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides a specific reverse transcription primer, which is used to reverse transcribe enterovirus to obtain cDNA, characterized in that the specific reverse transcription primer consists of the nucleotides shown in SEQ ID NO.1-4 in Table 1.

[0009] The specific reverse transcription primer provided by the present invention is a gene-specific primer designed based on the enterovirus consensus sequence. The primer selectively reverses the viral RNA to achieve specific enrichment of the viral RNA, and can increase the proportion of viral sequences in sequencing data.

[0010] In a second aspect, the present invention provides a specific PCR amplification primer, characterized in that the primer comprises a primer set 1 and a primer set 2, wherein the primer set 1 is composed of the nucleotides shown in SEQ ID NO.5-10 in Table 2, and the primer set 2 is composed of the nucleotides shown in SEQ ID NO.11-16 in Table 3.

[0011] The primer set 1 provided by the present invention can use enterovirus cDNA as a template to amplify a nucleic acid fragment of about 4.5 kb, wherein the nucleotides shown in SEQ ID NO.5-6 are upstream primers, and the nucleotides shown in SEQ ID NO.7-10 are downstream primers.

[0012] The primer set 2 provided by the present invention can use viral cDNA as a template to amplify a nucleic acid fragment of about 3 kb, wherein the nucleotides shown in SEQ ID NO.11-12 are upstream primers, and the nucleotides shown in SEQ ID NO.13-16 are downstream primers.

[0013] In a specific embodiment of the present invention, the primer set 1 and the primer set 2 are divided into two tubes, each of which is used for separate amplification using viral cDNA as a template.

[0014] In a specific embodiment of the present invention, the primer set 1 and the primer set 2 are combined into one tube, and single-tube amplification is performed using viral cDNA as a template.

[0015] A preferred implementation is to mix primer set 1 and primer set 2 to perform single-tube amplification, thereby improving efficiency, reducing sample cross contamination, and facilitating cost savings.

[0016] In a third aspect, the present invention provides a use of the specific reverse transcription primer described in the first aspect of the present invention and / or the specific PCR amplification primer described in the second aspect of the present invention in at least one of the following:

[0017] 1) Application in the preparation of products for targeted enrichment of enterovirus genes;

[0018] 2) Application in the preparation of products for multiplex amplification of enterovirus;

[0019] 3) Application in the preparation of products for the construction of enterovirus genome sequencing gene libraries;

[0020] 4) Application in the preparation of products for whole genome detection of enterovirus.

[0021] The product includes but is not limited to one of a reagent, a test kit, a chip, a test paper, a membrane strip or a detection platform.

[0022] In a fourth aspect, the present invention provides a kit, characterized in that the kit comprises the specific reverse transcription primer described in the first aspect of the present invention and / or the specific PCR amplification primer described in the second aspect.

[0023] Preferably, the kit also includes any reagents routinely used by those skilled in the art in the process of reverse transcription, PCR amplification and purification, including but not limited to reverse transcriptase, polymerase, buffer, Mg 2+ , dNTPs, purified magnetic beads, and nuclease-free water. All of these reagents can be obtained through commercial channels.

[0024] Furthermore, the kit also includes any reagents routinely used by those skilled in the art for gene library construction, including but not limited to fragmentase, end repair enzyme, DNA ligase, specific linker, buffer, and all of which can be obtained through commercial channels.

[0025] In a fifth aspect, the present invention provides a method for detecting the whole genome of enteroviruses not for the purpose of disease diagnosis and treatment, characterized in that the method comprises the following steps:

[0026] S1: Extract RNA from samples to be tested;

[0027] S2: using the RNA obtained in step S1 as a template, adding the specific reverse transcription primer described in the first aspect of the present invention, and reversely transcribing to obtain cDNA;

[0028] S3: using the cDNA described in step S2 as a template, adding the specific PCR amplification primers described in the second aspect of the present invention, amplifying, purifying, fragmenting the product, adding adapters, and obtaining a sequencing library;

[0029] S4: Purified library;

[0030] S5: Library quality control;

[0031] S6: sequencing on the machine;

[0032] S7: Bioinformatics analysis.

[0033] In a sixth aspect, the present invention provides a method for constructing a library for whole-genome detection of enterovirus based on NGS, characterized in that the method comprises the following steps:

[0034] S1: Extract RNA from samples to be tested;

[0035] S2: using the RNA obtained in step S1 as a template, adding the specific reverse transcription primer described in the first aspect of the present invention, and reversely transcribing to obtain cDNA;

[0036] S3: Using the cDNA described in step S2 as a template, adding the specific PCR amplification primers described in the second aspect of the present invention, amplifying, purifying, fragmenting the product, adding adapters, and obtaining a sequencing library.

[0037] According to the fifth and sixth aspects of the present invention, the sample to be tested is any substance that may contain enterovirus, including but not limited to food, feces, oral swabs, anal swabs, tissues, whole blood, and saliva.

[0038] In a specific embodiment of the present invention, the reverse transcription conditions in step S2 are:

[0039] temperature time Number of cycles 55℃ 15min 1 95℃ 1min 1 8℃ Hold 1

[0040] In a specific embodiment of the present invention, the PCR amplification reaction conditions in step S3 are:

[0041]

[0042] In a specific embodiment of the present invention, the sample RNA in step S1 can be extracted using a commercially available kit, and the extraction further includes removing human ribosomal RNA.

[0043] The technical solution provided by the present invention has the following beneficial technical effects:

[0044] 1) Wide application range: The present invention avoids the main polymorphic sites on the genome of enterovirus of various categories and subtypes when designing primer sequences. The designed primers and detection process are applicable to all enteroviruses, adapt to variable sample sequences, and have high amplification efficiency.

[0045] 2) High sensitivity: The primers and detection method provided by the present invention can detect as few as 120 copies of the whole viral genome in a 1 million-fold human RNA background, with high detection sensitivity.

[0046] 3) Easy operation: The reverse transcription, amplification, and linker addition processes in the detection method provided by the present invention are all completed in one tube, and in particular, there is no need for the common process of dividing multiple amplicons into separate tubes, which minimizes sample cross-contamination and helps save costs.

[0047] 4) Short detection time: The technical process provided by the present invention is easy to operate, and the NGS library construction and sequencing work can be completed within 1 day. Together with the automated bioinformatics pipeline, the test report can be issued within 3 days. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of the enterovirus whole genome detection process.

[0049] Figure 2 Electrophoresis of PCR amplification products.

[0050] Among them, M: 1kb marker; 1: 20ng NL-RNA + 1200 copies EV-D68; 2: 1200 copies EV-D68; 3: 20ng NL-RNA + 120 copies EV-D68; 4: 120 copies EV-D68.

[0051] Figure 3 Library electropherogram.

[0052] Among them, M: 1kb marker; 1: 20ng NL-RNA + 1200 copies EV-D68; 2: 1200 copies EV-D68; 3: 20ng NL-RNA + 120 copies EV-D68; 4: 120 copies EV-D68.

[0053] Figure 4 Relative coverage plot of each base position in the reference genome. DETAILED DESCRIPTION

[0054] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0055] Specific reverse transcription primers

[0056] The specific reverse transcription primers for enterovirus reverse transcription provided by the present invention are shown in Table 1:

[0057] Table 1 Specific reverse transcription primers

[0058] Reverse transcription primers Nucleotide sequence (5'-3') serial number 1 GCTATTCTGGTTATAACAAAT SEQ ID NO.1 2 CCGCACCGAAGCGGAGA SEQ ID NO.2 3 CCCCGAATTAAARAAAAAT SEQ ID NO.3 4 GTCCCCAAGTGRCCAAAAT SEQ ID NO.4

[0059] Specific PCR primers

[0060] The primers provided by the present invention for specific amplification of reverse transcription product cDNA include primer set 1 and primer set 2, which can be divided into two tubes for separate amplification using viral cDNA as a template, or mixed together for single tube amplification.

[0061] Table 2 Primer set 1

[0062] PCR primers Nucleotide sequence (5'-3') serial number 1 F TTAAAACAGCCTGIGGGTTG SEQ ID NO.5 2 F TTAAAACAGCTCTGGGGTTGT SEQ ID NO.6 3 R AGACATACAGGTTCAATRCGGTGTTTGCT SEQ ID NO.7 4 R AAACATACTGGCTCGATACGGTGCTTGGA SEQ ID NO.8 5 R AAACAAACIGGTTCAATRCGAGATTTGGA SEQ ID NO.9 6 R AGACATACIGGTTCAATRCGGCATTTGGA SEQ ID NO.10

[0063] Table 3 Primer set 2

[0064]

[0065]

[0066] In the above table, "F" indicates the upstream primer; "R" indicates the downstream primer.

[0067] Description of special bases: R represents A / G; V represents A / C / G; Y represents C / T; I represents hypoxanthine.

[0068] Example 1 Enterovirus Whole Genome Detection Method

[0069] 1. Sample Preparation

[0070] EV-D68 viral genomic RNA was purchased from ATCC, catalog number VR-1826DQ.

[0071] Human lung tissue total RNA (NL-RNA) was purchased from Thermo Fisher, catalog number AM7968.

[0072] 2. Primer Pool Preparation

[0073] The reverse transcription primer pool, specific primer pool 1 and specific primer pool 2 are synthesized and prepared according to the invention.

[0074] 3. Library Preparation Process

[0075] 3.1 Reverse transcription

[0076] 3.1.1 Prepare the reverse transcription reaction solution as shown in the table below and add the corresponding RNA sample to each tube.

[0077]

[0078] 3.1.2 Cover the tube, shake and mix, and then centrifuge quickly.

[0079] 3.1.3 Run the following program:

[0080] temperature time Number of cycles 55℃ 15min 1 95℃ 1min 1 8℃ Hold 1

[0081] 3.2 Specific PCR amplification

[0082] 3.2.1 Prepare the PCR reaction solution as shown in the table below and add the corresponding reverse transcription reaction solution to each tube.

[0083]

[0084] In this embodiment, specific primer pool 1+2 is preferred.

[0085] 3.2.2 Cover the tube, shake and mix, and then centrifuge quickly.

[0086] 3.2.3 The PCR instrument runs the following program:

[0087]

[0088] 3.3 Purification of PCR amplification products

[0089] 3.3.1 After taking each tube out of the PCR instrument, centrifuge quickly to throw the liquid to the bottom of the tube;

[0090] 3.3.2 Add 0.5 times volume of purified magnetic beads (AMPure, Beckman, the same below) to each tube, shake to mix and centrifuge quickly. Let stand at room temperature for 5 minutes;

[0091] 3.3.3 Transfer each tube to the magnetic rack and place at room temperature for 5 minutes or until the liquid is clear. Carefully aspirate the supernatant, taking care to avoid touching the magnetic beads;

[0092] 3.3.4 Add 150 μL 70% ethanol to each tube for washing. After incubation for 30 seconds, remove the ethanol and be careful not to touch the magnetic beads. Repeat the washing once;

[0093] 3.3.5 Cover the tubes, centrifuge them quickly, place them on a magnetic rack, and carefully remove the remaining ethanol from the tubes;

[0094] 3.3.6 Place at room temperature for 2-3 minutes until the beads are dry. Add 22 μL of nuclease-free water to each tube, cover the tube, shake to mix and centrifuge quickly;

[0095] 3.3.7 Transfer each tube to a magnetic rack and place at room temperature for 5 minutes. Transfer the supernatant to a new tube;

[0096] 3.3.8 Use Qubit to quantify the purified product and dilute it to 0.2 ng / μL with nuclease-free water;

[0097] 3.4 PCR amplification product fragmentation and adapter addition reaction

[0098] Products of specific PCR were fragmented and adapter added using Nextera XT DNA Library Preparation Kit (Illumina).

[0099] 3.4.1 Prepare the fragmentation reaction solution according to the following table

[0100]

[0101] 3.4.2 Beat evenly and centrifuge quickly;

[0102] 3.4.3 Set the hot cover to 100℃, the reaction volume to 50μL, and react at 55℃ for 5min on the PCR instrument, then cool to 10℃;

[0103] 3.4.4 Add 5 μL NT buffer, pipette evenly, and centrifuge quickly. Leave at room temperature for 5 minutes;

[0104] 3.4.5 Add the following solution to each tube of fragmentation reaction solution.

[0105]

[0106] 3.4.6 Set the heated lid to 100°C, the reaction volume to 50 μL, and run the following program on the PCR instrument.

[0107]

[0108]

[0109] 3.5 Library purification

[0110] 3.5.1 After taking each tube out of the PCR instrument, centrifuge quickly to throw the liquid to the bottom of the tube;

[0111] 3.5.2 Add 0.6 times the volume of purified magnetic beads to each tube, shake to mix, centrifuge quickly, and let stand at room temperature for 5 minutes;

[0112] 3.5.3 Transfer each tube to the magnetic rack and place at room temperature for 5 minutes or until the liquid is clear. Carefully aspirate the supernatant, taking care to avoid touching the magnetic beads.

[0113] 3.5.4 Add 150 μL 70% ethanol to each tube for washing. After incubation for 30 seconds, remove the ethanol and avoid touching the magnetic beads. Repeat the washing process.

[0114] 3.5.5 Cover the tubes, centrifuge them quickly, place them on a magnetic rack, and carefully remove the remaining ethanol from the tubes;

[0115] 3.5.6 Place at room temperature for 2-3 minutes until the beads are dry, add 50 μL of nuclease-free water to each tube, cover the tube, shake to mix and centrifuge quickly;

[0116] 3.5.7 Transfer each tube to a magnetic rack, place at room temperature for 5 minutes, and transfer the supernatant to a new tube.

[0117] 3.6 Library quality control

[0118] The library was quantified using Qubit, and the library fragment size and purity were analyzed using Qseq100. The mass concentration was converted to molar concentration based on the library fragment size.

[0119] 4. Sequencing

[0120] 4.1 Dilute each library to 5nM according to the concentration, take a small amount of equal volume and mix;

[0121] 4.2 Add an equal volume of 0.2N NaOH for denaturation, and then dilute to 15pM with HT1 solution;

[0122] 4.3 Take 594 μL of 15 pM mixed library and add 6 μL of 12.5 pM PhiX library control;

[0123] 4.4 Add the above 600 μL to the sequencing kit and load it into the Illumina Miseq sequencer for sequencing. The sequencing read length is PE150, and at least 0.1M reads are allocated to each sample.

[0124] 5. Data Analysis

[0125] The data were split according to different sample Index barcodes to obtain the original data FASTQ files. The EV-D68 virus genome standard sequence NC_038308.1 was used for sequence alignment and splicing, to identify the coverage depth and perform subsequent parameter calculations.

[0126] 6. Results display

[0127] 6.1 Electrophoresis results

[0128] The electrophoresis diagram of specific PCR amplification products is as attached in the instruction manual. Figure 2 As shown in the instruction manual, the library electrophoresis diagram is as follows Figure 3 shown.

[0129] 6.2 Sequencing data

[0130]

[0131] 6.3 Relative coverage of each base position in the reference genome

[0132] As the instruction manual Figure 4 shown.

[0133] 6.4 Sequence Accuracy

[0134] The EV-D68 genome sequence measured by the above method was compared with the reference sequence NC_038308.1, and the inconsistent base sequences are as follows:

[0135] Position Ref Alt 26 - C 435 G A 2152 T A 2390 C T 4449 A T 6757 A G

[0136] The above mutations and base sequences at other positions are completely consistent with the sequence information provided by ATCC.

[0137] 6.5 Conclusion

[0138] This method can accurately detect the whole genome sequence of enterovirus except for the first and last 20 bp under the condition of 100,000 to 1,000,000 times human RNA background interference and as low as 120 virus copies per reaction.

[0139] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A specific reverse transcription primer, which is used to reverse transcribe enterovirus to obtain cDNA, characterized in that: The specific reverse transcription primer consists of the nucleotides shown in SEQ ID NO.1-4 in Table 1.

2. A specific PCR amplification primer, characterized in that: The primers include primer set 1 and primer set 2, wherein the primer set 1 consists of the nucleotides shown in SEQ ID NOs.5-10 in Table 2, and the primer set 2 consists of the nucleotides shown in SEQ ID NOs.11-16 in Table 3.

3. The specific PCR amplification primer according to claim 2, characterized in that: The nucleotides shown in SEQ ID NO.5-6 in primer set 1 are upstream primers, and the nucleotides shown in SEQ ID NO.7-10 are downstream primers; the nucleotides shown in SEQ ID NO.11-12 in primer set 2 are upstream primers, and the nucleotides shown in SEQ ID NO.13-16 are downstream primers.

4. Use of the specific reverse transcription primer according to claim 1 and / or the specific PCR amplification primer according to any one of claims 2 to 3 in at least one of the following: 1) Application in the preparation of products for targeted enrichment of enterovirus genes; 2) Application in the preparation of products for multiplex amplification of enterovirus; 3) Application in the preparation of products for the construction of enterovirus genome sequencing gene libraries; 4) Application in the preparation of products for whole genome detection of enterovirus; The product includes one of a reagent, a test kit, a chip, a test paper, a membrane strip or a detection platform.

5. A kit, characterized in that: The kit comprises the specific reverse transcription primer according to claim 1 and / or the specific PCR amplification primer according to any one of claims 2-3.

6. The kit according to claim 5, characterized in that The kit also includes any reagents routinely used by those skilled in the art during reverse transcription, PCR amplification and purification, including reverse transcriptase, polymerase, buffer, Mg 2+ , dNTPs, purification magnetic beads or nuclease-free water.

7. The kit according to claim 5, characterized in that The kit also includes any reagents routinely used by those skilled in the art for gene library construction, including fragmentation enzymes, end repair enzymes, DNA ligases, specific adapters or buffers.

8. A method for detecting the whole genome of enterovirus not for the purpose of disease diagnosis and treatment, characterized in that: The method comprises the following steps: S1: Extract RNA from samples to be tested; S2: using the RNA obtained in step S1 as a template, adding the specific reverse transcription primer described in claim 1, and reverse transcribing to obtain cDNA; S3: using the cDNA described in step S2 as a template, adding the specific PCR amplification primers described in any one of claims 2 to 3, amplifying, purifying, fragmenting the product, adding adapters, and obtaining a sequencing library; S4: Purified library; S5: Library quality control; S6: sequencing on the machine; S7: Bioinformatics analysis.

9. A method for constructing a library for whole-genome detection of enterovirus based on NGS, characterized in that: The method comprises the following steps: S1: Extract RNA from samples to be tested; S2: using the RNA obtained in step S1 as a template, adding the specific reverse transcription primer described in the first aspect of the present invention, and reversely transcribing to obtain cDNA; S3: Using the cDNA described in step S2 as a template, adding the specific PCR amplification primers described in the second aspect of the present invention, amplifying, purifying, fragmenting the product, adding adapters, and obtaining a sequencing library.

10. The method according to claim 9, characterized in that The sample to be tested is any substance that may contain enterovirus, including food, feces, oral swabs, anal swabs, tissues, whole blood, and saliva.

Images