A method for simultaneous detection of measles, mumps, rubella virus and varicella-zoster virus

Abstract

The present invention relates to the field of virus detection technology, and in particular to a method for synchronously detecting measles, mumps, rubella virus and varicella-zoster virus. The method comprises: extracting RNA of a sample to be tested, performing PCR amplification using a primer and probe combination, and judging the sample to be tested according to the amplification result. The primer and probe combination comprises a nucleotide sequence as shown in SEQ ID NO.1-12. The present invention provides a primer and probe combination, which can realize the simultaneous detection of the titers of measles, mumps, rubella virus and varicella-zoster virus through a reaction system, and has high specificity and sensitivity, which is of great significance in the field of virus detection.

Description

Technical Field

[0001] The invention relates to the technical field of virus detection, and in particular to a method for synchronously detecting measles, mumps, rubella virus and varicella-zoster virus. Background Art

[0002] Varicella-zoster virus is a highly contagious neurotropic virus with humans as its only natural host. It can cause two diseases, chickenpox and herpes zoster. Chickenpox is more common in children and is mostly self-limiting, but it can still cause a variety of complications; herpes zoster is common in adults, especially the elderly, and the incidence and severity increase with age. It can cause severe neuralgia and bring great physical and mental pain to patients.

[0003] Varicella live attenuated vaccine is an effective means of preventing varicella. In addition, there are combined vaccines such as measles, mumps, rubella and varicella (MMRV), which are of great significance in simplifying the immunization program and reducing the cost of immunization. The virus titer in the vaccine is a key indicator to measure the immunogenicity and quality consistency of the vaccine. It is crucial to the effectiveness and safety of the vaccine and is directly related to the immune protection effect of the vaccine.

[0004] The existing virus titer detection commonly uses the plaque method, which is a classic method for detecting VZV virus titer. The advantage of this method is that it can directly reflect the number of infectious live viruses, but it also has many problems: it has high requirements for operators, who need to have strong aseptic operation capabilities, rich cell culture experience and skilled operation levels; the experimental cycle is long, it takes more than 20 days from cell recovery to cell plating, and 7 days from virus inoculation to judgment and calculation. The total detection cycle is more than 27 days, which leads to poor detection mobility. In addition, due to reliance on manual observation and judgment during the detection process, the subjective judgment error is large. In addition, if the half XX amount (TCID 50 , LD 50 、EID 50 ) method can be used for some virus titer detection, but the detection cycle is long (at least 7 days), and the accuracy and repeatability are not high. Although the immunofluorescence focus method is faster and more sensitive, the antibody cost is high, and the counting results are easily affected by factors such as non-specific binding. Other studies have used a double antibody sandwich ELISA detection method targeting VZV glycoprotein antigen to detect the virus titer of intermediate products and finished products. However, since this method cannot directly reflect the infectivity of the virus in the sample when the virus is inactivated and the surface glycoprotein structure has not changed, the ELISA results cannot truly reflect the virus infectivity, resulting in distorted test results.

[0005] As for the titer detection of combined vaccines, regulations require the use of specific antisera to completely neutralize viruses other than the virus to be tested. In actual operations, problems such as the quality, supply, and interference with the target virus of the neutralizing serum are often faced. In addition, the neutralization process requires high-quality antisera and is strictly verified. If a certain virus is sensitive to the neutralization process, it will also lead to inaccurate results, or cause the actual titer to be higher than the measured result, which may not only cause the safety risk of excessive inoculation, but also increase production costs and social costs. Therefore, it is necessary to develop a detection method that does not require neutralization treatment for product quality control.

[0006] At present, the lesion method is the most commonly used method to determine the strength of viral infectivity and the content of the virus. This method has high sensitivity and good repeatability, so it is widely used for the quantitative determination of viruses. It is also one of the most accurate virus determination methods. However, this method requires the preparation of cultured cells and related reagents before the experiment. During the experiment, it is easily affected by factors such as cell status, virus dilution, and the techniques of the experimenters. The judgment process requires high experience from the judges, and the judgment results for the same sample are often inconsistent. In addition, it takes 7-10 days after the test to determine the results, which is time-consuming and labor-intensive for relevant practitioners, especially vaccine manufacturers when producing vaccines on a large scale. Summary of the invention

[0007] In order to solve the problems existing in the prior art, the present invention provides a method for synchronously detecting measles, mumps, rubella virus and varicella-zoster virus.

[0008] In a first aspect, the present invention provides a primer pair, comprising the following primers: VZV-F1: TGCCGAAGCAATTTATCAC, VZV-R1:AACCGCGTTCAGTTTTAC.

[0009] The present invention further provides a primer and probe combination, comprising the aforementioned primer pair and a probe; the probe comprising: VZV-probe1:CGATACTGGGCCACCGGTTC.

[0010] In a second aspect, the present invention provides a primer and probe combination, including: a primer combination and a probe combination; the primer combination includes the following primer pairs: MeV-F1: AGGATGAGGCGGACCAATAC, MeV-R1: AATTTGGGCTAGGATGGTAC; MuV-F1: TATATCCTCAAGTCAGCAAC, MuV-R1: CTCATCCCAGTCTCCCAC; RuV-F1:AACGGAACGCGTTCTCAGT, RuV-R1:GTGTAGACATCAGTGAGGT; and VZV-F1: TGCCGAAGCAATTTATCAC, VZV-R1:AACCGCGTTCAGTTTTAC; The probe combination includes the following probes: MeV-probe1: CCAGGTTCGGATGGTTTGAGAAC, MuV-probe1: ACGATACAACGAGAATGGTGATTCC, RuV-probe1:TCGACCCTCCGCACTGCTG, VZV-probe1:CGATACTGGGCCACCGGTTC.

[0011] Furthermore, each probe in the probe combination carries a fluorescent label and / or a quencher, and the fluorescent label includes one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, VIC, SYBR Green, DAPI, FITC or Texas Red; the quencher includes BHQ or TQ.

[0012] In a second aspect, the present invention provides a kit, comprising the aforementioned primer pair, or the aforementioned primer and probe combination.

[0013] In a third aspect, the present invention provides the use of the aforementioned primer pair, or the aforementioned primer and probe combination in detecting varicella-zoster virus.

[0014] In a fourth aspect, the present invention provides a method for synchronously detecting measles, mumps, rubella virus and varicella-zoster virus, comprising: The RNA of the sample to be tested is extracted, and PCR amplification is performed using the aforementioned primer and probe combination, and the sample to be tested is judged based on the amplification result.

[0015] Furthermore, the PCR amplification system includes: 2X One Step RT-PCR Buffer III reagent 20~30μl, 5U / μl TaKaRa Ex Taq HS reagent 0.8~1.2μl, PrimeScript RT Enzyme Mix II reagent 0.8~1.2μl, 50X ROX Reference Dye reagent 0.8~1.2μl, 10μmol / L measles upstream primer 0.6~1.0μl, 10μmol / L measles downstream primer 0.6~1.0μl, 10μmol / L measles probe primer 1.4~1.8μl, 10μmol / L mumps upstream primer 0.6~1.0μl, 10μmol / L mumps downstream primer 0.6~1.0μl, 10μmol / L mumps probe primer 1.4 ~1.8μl, 10μmol / L Rubella upstream primer 0.8~1.2μl, 10μmol / L Rubella downstream primer 0.8~1.2μl, 10μmol / L Rubella probe primer 1.8~2.2μl, 10μmol / L varicella upstream primer 1~1.2μl, 10μmol / L varicella downstream primer 1~1.2μl, 10μmol / L varicella probe primer 2~2.4μl and RNA template 5~8μl.

[0016] Furthermore, the procedure of the PCR amplification includes: 40~45℃ 4~10min; 94~98℃ 10s; 94~98℃ 4~10s, 55~65℃ 30~38s, repeat 35~45 cycles.

[0017] Further, judging the sample to be tested according to the test result includes any of the following: (1) Determining whether the sample to be tested contains measles, mumps, rubella virus or varicella-zoster virus; (2) Determining the titer of measles, mumps, rubella virus and varicella-zoster virus of the test sample.

[0018] Furthermore, the above determination of the titer of the measles, mumps, rubella virus and varicella-zoster virus of the test sample can be performed by the following method: A standard curve was drawn based on the fluorescence detection results of cells infected with different titer virus mixture standards after 12 to 48 hours of culture; The samples to be tested are cultured and fluorescently detected for the same period of time, and the test results are compared with the standard curve to obtain the titers of measles, mumps, rubella virus and varicella-zoster virus in the samples to be tested.

[0019] Furthermore, the cells are MRC-5 cells.

[0020] Furthermore, standard curves of measles, mumps, rubella virus and varicella-zoster virus were drawn respectively, with the ordinate being the Ct value and the abscissa being the virus titer.

[0021] The above methods for detecting viruses are not for the purpose of disease diagnosis or treatment. Those skilled in the art know that the above methods for detecting viruses can also be applied to the detection of live attenuated vaccines (qualitative detection, or direct detection of virus titer).

[0022] The present invention has the following beneficial effects: The present invention provides a primer and probe combination for detecting varicella virus, which has high specificity and sensitivity. On this basis, the present invention provides a primer and probe combination for synchronously detecting measles, mumps, rubella virus and varicella-zoster virus, which has high compatibility and can detect four viruses in one system without interfering with each other. This is of great significance in virus detection, especially in the field of combined vaccine detection.

[0023] The present invention establishes a multiplex fluorescence quantitative PCR reaction method based on the above primer and probe combination, which can detect four different types of viruses in one reaction system, effectively reducing the steps of the fluorescence quantitative PCR reaction and shortening the time required for the fluorescence quantitative PCR by more than three quarters.

[0024] The present invention effectively solves the problem that the titer of measles, mumps, rubella virus and varicella-zoster virus can only be determined by TCID 50 The difficulty of the method or plaque method has greatly shortened the time required for virus titer determination and subsequent vaccine production. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 This is the standard curve established by the varicella-zoster virus fluorescence quantitative PCR method provided in Example 1 of the present invention.

[0027] Figure 2 This is the standard curve of varicella-zoster virus at different culture times provided in Example 1 of the present invention.

[0028] Figure 3 This is the standard curve of measles virus cultured at different times provided in Example 1 of the present invention.

[0029] Figure 4 This is the standard curve of mumps virus cultured at different times provided in Example 1 of the present invention.

[0030] Figure 5 This is the standard curve of different culture times of Rubella virus provided in Example 1 of the present invention.

[0031] Figure 6 This is the standard curve established by the multiplex fluorescence quantitative PCR method provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0034] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0035] Example 1 The present invention performs sequence alignment on varicella-zoster virus sequences, and taking into account the compatibility of multiple PCR primers, designs a set of primer pairs and probes for measles (Mev), mumps (Muv), rubella virus (RuV) and varicella-zoster virus (VZV), as shown in Table 1: Table 1 Primer pairs and probe sequences for each virus

[0036] Mev, MuV and RuV are primer pairs and probes designed by the present invention, and these three sets of primer pairs and probes have good compatibility with the VZV provided by the present invention, and the designed primer pairs and probe sequences are synthesized, and experiments with different primer pairs and probes are performed.

[0037] 1. Screening of primer pairs and probes for varicella-zoster virus (1) The following experiments were performed for two sets of primer pairs and probes: combination 1 (VZV-F1, VZV-R1, and VZV-probe1) and combination 2 (VZV-F2, VZV-R2, and VZV-probe2): The varicella-zoster virus DNA was extracted using a nucleic acid extraction kit and stored at -70°C for future use. The varicella-zoster virus DNA was used as a template, and qPCR was performed with the synthesized primers and probes. The TAKARA reagent was used, and the reaction system was: Premix Ex Taq (Probe qPCR) (2X) reagent 10μl, ROX Reference Dye (50X) reagent 0.4μl, 10μmol / L upstream primer 0.4μl, 10μmol / L downstream primer 0.4μl, 10μmol / L probe primer 0.8μl.

[0038] The reaction program was 95°C for 30s, 95°C for 5s, 60°C for 34s, and repeated for 40 cycles. Primers and probes were screened by amplification curves, amplification efficiency, specificity, and other parameters.

[0039] The results are shown in Table 1: Table 1 Comparison of primer and probe combinations for varicella-zoster virus

[0040] From the results, it can be seen that the amplification efficiency of combination 2 is low, and the correlation coefficient R 2 Lower than 0.98, so combination 1 was selected for varicella-zoster virus detection and subsequent experiments. The standard curve of combination 1 is as follows Figure 1 shown.

[0041] (2) Prepare a 3×10 5 100ul / well of cell suspension was plated on a 96-well cell culture plate and cultured in a 37°C, 5% CO2 constant temperature incubator. After the cells grew into a monolayer, the culture medium was discarded, and the cells were washed twice with 0.01M PBS solution, and the PBS solution was discarded. The varicella-zoster virus was serially diluted 5-fold and diluted to 5 3 After fold increase, add the mixture of different dilutions to the cells, 100ul per well, and culture in a 37.0℃, 5% CO2 incubator. Collect samples after 12-48h of culture. First, discard the culture medium, wash the cells twice with 0.01M PBS solution, lyse the cells with 0.001M PBS, and place in a -70℃ refrigerator for later use.

[0042] Extract sample RNA and perform qRT-PCR using TAKARA reagents. The reaction system is: 2X One Step RT-PCRBuffer III reagent 10.0μl, TaKaRa Ex Taq HS (5 U / μl) reagent 0.4μl, PrimeScript RT EnzymeMix II reagent 0.4μl, ROX Reference Dye (50X) reagent 0.4μl, 10μmol / L upstream primer 0.4μl, 10μmol / L downstream primer 0.4μl, 10μmol / L probe primer 0.8μl. The reaction program is 42℃ 5min, 95℃ 10s, 95℃ 5s, 60℃, 34s, repeated 40 cycles. With the virus titer as the horizontal axis and the Ct value as the vertical axis, a linear standard curve is drawn to calculate its R 2 The results are shown in Table 2 and Figure 2 As shown: Table 2. Standard curves of varicella-zoster virus at different culture times

[0043] Note: The titer unit is lgPFU / ml.

[0044] (3) Use the qRT-PCR method and the cytopathic effect method to test at least 3 batches of samples at the same time, calculate the relative error of the two methods, and determine the correlation between the cytopathic effect method and the qRT-PCR test. The results are shown in Table 3 below: Table 3 Virus titer test results of two methods (varicella-zoster virus)

[0045] The results showed that there was no significant difference between the detection of varicella-zoster virus using fluorescent quantitative PCR and cytopathic method, which was within the corresponding detection error.

[0046] 2. Detection of measles virus titer by fluorescence quantitative PCR The concentration of 3×10 5 100ul / well of cell suspension was plated on a 96-well cell culture plate and cultured in a 37°C, 5% CO2 constant temperature incubator. After the cells grew into a monolayer, the culture medium was discarded, and the cells were washed twice with 0.01M PBS solution, and the PBS solution was discarded. The measles virus was serially diluted 5-fold and diluted to 5 3After 100 μl of the mixture was diluted to 50 μl, the mixture was added to the cells, 100 μl per well, and cultured in a 37.0°C, 5% CO2 incubator. After 12-48 h of culture, the samples were collected. First, the culture medium was discarded, the cells were washed twice with 0.01 M PBS solution, and the cells were lysed with 0.001 M PBS and placed in a -70°C refrigerator for use. Sample RNA was extracted and qRT-PCR was performed using TAKARA reagents. The reaction system was: 2X One Step RT-PCR Buffer III reagent 10.0 μl, TaKaRa Ex Taq HS (5 U / μl) reagent 0.4 μl, PrimeScript RTEnzyme Mix II reagent 0.4 μl, ROX Reference Dye (50X) reagent 0.4 μl, 10 μmol / L upstream primer 0.4 μl, 10 μmol / L downstream primer 0.4 μl, 10 μmol / L probe primer 0.8 μl.

[0047] The reaction program was 42°C for 5 min, 95°C for 10 s, 95°C for 5 s, 60°C for 34 s, and repeated for 40 cycles. A linear standard curve was drawn with the virus titer as the horizontal axis and the Ct value as the vertical axis, and its R was calculated. 2 Values ​​and formulas. The results are shown in Table 4 and Figure 3 As shown: Table 4. Standard curves of measles virus culture at different times

[0048] Note: Titer unit is lgCCID 50 / ml.

[0049] (2) Use the qRT-PCR method and the cytopathic effect method to test at least 3 batches of samples, calculate the relative error of the two methods, and determine the correlation between the cytopathic effect method and the qRT-PCR test. The results are shown in Table 5: Table 5 Virus titer test results of two methods (measles virus)

[0050] The results showed that there was no significant difference between the detection of measles virus using the fluorescence quantitative PCR method and the cytopathic method, which was within the corresponding detection error.

[0051] 3. Detection of mumps virus titer by fluorescence quantitative PCR The results showed that there was no significant difference between the detection of measles virus using the fluorescence quantitative PCR method and the cytopathic method, which was within the corresponding detection error.

[0052] The concentration of 3×10 5100ul / well of cell suspension was plated on a 96-well cell culture plate and cultured in a 37°C, 5% CO2 constant temperature incubator. After the cells grew into a monolayer, the culture medium was discarded, and the cells were washed twice with 0.01M PBS solution, and the PBS solution was discarded. The mumps virus was serially diluted 5-fold and diluted to 5 3 After 100 μl of the mixture was diluted to 50 μl, the mixture was added to the cells, 100 μl per well, and cultured in a 37.0°C, 5% CO2 incubator. After 12-48 h of culture, the samples were collected. First, the culture medium was discarded, the cells were washed twice with 0.01 M PBS solution, and the cells were lysed with 0.001 M PBS and placed in a -70°C refrigerator for use. Sample RNA was extracted and qRT-PCR was performed using TAKARA reagents. The reaction system was: 2X OneStep RT-PCR Buffer Ⅲ reagent 10.0 μl, TaKaRa Ex Taq HS (5 U / μl) reagent 0.4 μl, PrimeScriptRT Enzyme Mix Ⅱ reagent 0.4 μl, ROX Reference Dye (50X) reagent 0.4 μl, 10 μmol / L upstream primer 0.4 μl, 10 μmol / L downstream primer 0.4 μl, 10 μmol / L probe primer 0.8 μl. The reaction program was 42°C for 5 min, 95°C for 10 s, 95°C for 5 s, 60°C for 34 s, and repeated for 40 cycles. A linear standard curve was drawn with the virus titer as the horizontal axis and the Ct value as the vertical axis, and its R was calculated. 2 Values ​​and formulas. The results are shown in Table 6 and Figure 4 As shown: Table 6. Standard curves of mumps virus culture at different time periods

[0053] Note: Titer unit is lgCCID 50 / ml.

[0054] (2) Use the qRT-PCR method and the cytopathic effect method to test at least 3 batches of samples, calculate the relative error of the two methods, and determine the correlation between the cytopathic effect method and the qRT-PCR test. The results are shown in Table 7: Table 7 Virus titer test results of two methods (mumps virus)

[0055] The results showed that there was no significant difference between the detection of mumps virus using fluorescent quantitative PCR and cytopathic method, and it was within the corresponding detection error.

[0056] 4. Detection of Rubella Virus Titer by Fluorescence Quantitative PCR The concentration of 3×105 100ul / well of cell suspension was plated on a 96-well cell culture plate and cultured in a 37°C, 5% CO2 constant temperature incubator. After the cells grew into a monolayer, the culture medium was discarded, and the cells were washed twice with 0.01M PBS solution, and the PBS solution was discarded. Rubella virus was serially diluted 5-fold and diluted to 5 3 After 100 μl of the mixture was diluted to 50 μl, the mixture was added to the cells, 100 μl per well, and cultured in a 37.0°C, 5% CO2 incubator. After 12-48 h of culture, the samples were collected. First, the culture medium was discarded, the cells were washed twice with 0.01 M PBS solution, and the cells were lysed with 0.001 M PBS and placed in a -70°C refrigerator for use. Sample RNA was extracted and qRT-PCR was performed using TAKARA reagents. The reaction system was: 2X One Step RT-PCR Buffer III reagent 10.0 μl, TaKaRa Ex Taq HS (5 U / μl) reagent 0.4 μl, PrimeScript RTEnzyme Mix II reagent 0.4 μl, ROX Reference Dye (50X) reagent 0.4 μl, 10 μmol / L upstream primer 0.4 μl, 10 μmol / L downstream primer 0.4 μl, 10 μmol / L probe primer 0.8 μl. The reaction program was 42°C for 5 min, 95°C for 10 s, 95°C for 5 s, 60°C for 34 s, and repeated for 40 cycles. A linear standard curve was drawn with the virus titer as the horizontal axis and the Ct value as the vertical axis, and its R was calculated. 2 The results are shown in Table 8 and Figure 5 As shown: Table 8. Standard curves of Rubella virus at different culture times

[0057] Note: Titer unit is lgCCID 50 / ml.

[0058] At least 3 batches of samples were tested using both the qRT-PCR method and the cytopathic method, and the relative errors of the two methods were calculated to determine the correlation between the cytopathic method and the qRT-PCR test. The results are shown in Table 9: Table 9. Virus titer test results of two methods (Rubella virus)

[0059] The results showed that there was no significant difference between the detection of rubella virus using fluorescent quantitative PCR and cytopathic method, which was within the corresponding detection error.

[0060] Example 2 Multiplex fluorescence quantitative PCR method for detecting measles, mumps, rubella virus and varicella-zoster virus titers The concentration of 3×10 5 100ul / well of cell suspension was plated on a 96-well cell culture plate and cultured in a 37°C, 5% CO2 constant temperature incubator. After the cells grew into a monolayer, the culture medium was discarded, and the cells were washed twice with 0.01M PBS solution, and the PBS solution was discarded. An equal amount of measles virus titer standard, mumps virus titer standard, rubella virus titer standard, and varicella-zoster virus were mixed and shaken, and the mixed virus solution was serially diluted 5-fold and diluted to 5 3 After 5 times, the mixture of different dilutions was added to the cells, 100ul per well, and placed in a 37.0℃, 5% CO2 incubator for culture. At the same time, the sample to be tested was diluted 5 times in series and inoculated into the cells in the same way. After the culture was completed (12-48 hours), the culture medium was discarded, the cells were washed twice with 0.01M PBS solution, and the cells were lysed with 0.001M PBS and placed in a -70℃ refrigerator for use. Before the test, the sample was thawed at room temperature, shaken evenly, and qRT-PCR was performed.

[0061] Using TAKARA reagent, the following three reaction systems were adopted: (1) The reaction system is 1: 2X One Step RT-PCR Buffer III reagent 25.0μl, TaKaRa Ex TaqHS (5 U / μl) reagent 1.0μl, PrimeScript RT Enzyme Mix II reagent 1.0μl, ROX Reference Dye (50X) reagent 1.0μl, 10μmol / L measles upstream primer 0.6μl, 10μmol / L measles downstream primer 0.6μl, 10μmol / L measles probe primer 1.2μl, 10μmol / L mumps upstream primer 0.8μl, 10μmol / L mumps downstream primer 0.8μl, 10μmol / L mumps probe primer 1.6μl, 10μmol / L Rubella upstream primer 0.8μl, 10μmol / L Rubella downstream primer 0.8μl, 10μmol / L Rubella probe primer 1.6μl, 10μmol / L varicella upstream primer 0.8μl, 10μmol / L varicella downstream primer 0.8μl, 10μmol / L varicella probe primer 1.6μl.

[0062] (2) The reaction system is 2: 2X One Step RT-PCR Buffer III reagent 25.0μl, TaKaRa Ex TaqHS (5 U / μl) reagent 1.0μl, PrimeScript RT Enzyme Mix II reagent 1.0μl, ROX Reference Dye (50X) reagent 1.0μl, 10μmol / L measles upstream primer 0.8μl, 10μmol / L measles downstream primer 0.8μl, 10μmol / L measles probe primer 1.6μl, 10μmol / L mumps upstream primer 0.8μl, 10μmol / L mumps downstream primer 0.8μl, 10μmol / L mumps probe primer 1.6μl, 10μmol / L rubella upstream primer 0.9μl, 10μmol / L rubella downstream primer 0.9μl, 10μmol / L rubella probe primer 1.8μl, 10μmol / L varicella upstream primer 0.9μl, 10μmol / L varicella downstream primer 0.9μl, 10μmol / L varicella probe primer 1.8μl.

[0063] (3) The reaction system is 3: 2X One Step RT-PCR Buffer III reagent 25.0μl, TaKaRa Ex TaqHS (5 U / μl) reagent 1.0μl, PrimeScript RT Enzyme Mix II reagent 1.0μl, ROX Reference Dye (50X) reagent 1.0μl, 10μmol / L measles upstream primer 0.8μl, 10μmol / L measles downstream primer 0.8μl, 10μmol / L measles probe primer 1.6μl, 10μmol / L mumps upstream primer 0.8μl, 10μmol / L mumps downstream primer 0.8μl, 10μmol / L mumps probe primer 1.6μl, 10μmol / L Rubella upstream primer 1μl, 10μmol / L Rubella downstream primer 1μl, 10μmol / L Rubella probe primer 2μl, 10μmol / L varicella upstream primer 1.1μl, 10μmol / L varicella downstream primer 1.1μl, 10μmol / L varicella probe primer 2.2μl.

[0064] The reaction program was 42°C for 5 min, 95°C for 10 s, 95°C for 5 s, 60°C for 34 s, and repeated for 40 cycles. Three linear standard curves were drawn with the virus titers as the horizontal axis and the Ct values ​​as the vertical axis, and their R 2 The virus titers in the samples to be tested were calculated using different standard curves.

[0065] The results are shown in Table 10-12 (cultured for 24 hours): Table 10. Standard curves of varicella-zoster virus at different incubation times (system 1)

[0066] Table 11. Standard curves of varicella-zoster virus at different incubation times (system 2)

[0067] Table 12. Standard curves of varicella-zoster virus at different incubation times (system 3)

[0068] The results showed that in reaction system 1, only the standard curve of mumps virus reached above 0.98, while the standard curves of other viruses did not reach 0.98. In reaction system 2, only the standard curves of measles virus and mumps reached above 0.98, while the standard curves of other viruses did not reach 0.98. In reaction system 3, the standard curves of the four viruses all reached above 0.98, which was suitable for the simultaneous detection of the four viruses of measles, mumps, rubella and varicella.

[0069] (2) Comparison of the correlation between the cytopathic effect method and multiplex fluorescence quantitative PCR. The multiplex fluorescence quantitative PCR method and the cytopathic effect method were used to test the samples at the same time to determine the correlation between the cytopathic effect method and the qRT-PCR test. The results are shown in Table 13: Table 13. Virus titer detection results of two methods

[0070] The results showed that the virus titer detected by the established multiplex fluorescence quantitative PCR method had no significant difference with that detected by the cytopathic method and was within the corresponding detection error. Therefore, this method is suitable for detecting the four viruses of measles, mumps, rubella and varicella.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer pair, characterized in that: The primers included are: VZV-F1: TGCCGAAGCAATTTATCAC, VZV-R1:AACCGCGTTCAGTTTTAC.

2. A primer and probe combination, characterized in that: The method comprises the primer pair according to claim 1, and further comprises a probe; the probe comprises: VZV-probe1:CGATACTGGGCCACCGGTTC.

3. A primer and probe combination, characterized in that: It includes a primer combination and a probe combination; the primer combination includes the following primer pairs: MeV-F1: AGGATGAGGCGGACCAATAC, MeV-R1: AATTTGGGCTAGGATGGTAC; MuV-F1: TATATCCTCAAGTCAGCAAC, MuV-R1: CTCATCCCAGTCTCCCAC; RuV-F1:AACGGAACGCGTTCTCAGT, RuV-R1:GTGTAGACATCAGTGAGGT; and VZV-F1: TGCCGAAGCAATTTATCAC, VZV-R1:AACCGCGTTCAGTTTTAC; The probe combination includes the following probes: MeV-probe1: CCAGGTTCGGATGGTTTGAGAAC, MuV-probe1: ACGATACAACGAGAATGGTGATTCC, RuV-probe1:TCGACCCTCCGCACTGCTG, VZV-probe1:CGATACTGGGCCACCGGTTC.

4. A kit, characterized in that: The kit comprises the primer combination according to claim 1, or the primer and probe combination according to claim 2 or 3.

5. Use of the primer pair according to claim 1, or the primer and probe combination according to claim 2 in detecting varicella-zoster virus.

6. Use of the primer and probe combination of claim 3 in the simultaneous detection of measles, mumps, rubella virus and varicella-zoster virus.

7. A method for synchronously detecting measles, mumps, rubella virus and varicella-zoster virus, characterized in that: include: Extract RNA from the sample to be tested, perform PCR amplification using the primer and probe combination described in claim 3, and judge the sample to be tested based on the amplification result.

8. The method according to claim 7, characterized in that The system of the PCR amplification comprises: 2X One Step RT-PCR Buffer III reagent 20~30μl, 5U / μl TaKaRa Ex Taq HS reagent 0.8~1.2μl, PrimeScript RT Enzyme Mix II reagent 0.8~1.2μl, 50X ROX Reference Dye reagent 0.8~1.2μl, 10μmol / L measles upstream primer 0.6~1.0μl, 10μmol / L measles downstream primer 0.6~1.0μl, 10μmol / L measles probe primer 1.4~1.8μl, 10μmol / L mumps upstream primer 0.6~1.0μl, 10μmol / L mumps downstream primer 0.6~1.0μl, 10μmol / L mumps probe primer 1.4 ~1.8μl, 10μmol / L Rubella upstream primer 0.8~1.2μl, 10μmol / L Rubella downstream primer 0.8~1.2μl, 10μmol / L Rubella probe primer 1.8~2.2μl, 10μmol / L varicella upstream primer 1~1.2μl, 10μmol / L varicella downstream primer 1~1.2μl, 10μmol / L varicella probe primer 2~2.4μl and RNA template 5~8μl.

9. The method according to claim 7 or 8, characterized in that: The procedure of the PCR amplification includes: 40~45℃ 4~10min; 94~98℃ 10s； 94~98℃ 4~10s, 55~65℃ 30~38s, repeat 35~45 cycles.

10. The method according to claim 7, characterized in that The judging of the sample to be tested according to the test result includes any of the following: (1) Determining whether the sample to be tested contains measles, mumps, rubella virus or varicella-zoster virus; (2) Determining the titer of measles, mumps, rubella virus and varicella-zoster virus of the test sample.

Images