Method for rapid visual detection of corn virus nucleic acid

Abstract

The invention provides a method for rapid visual detection of corn virus nucleic acid. Based on two quarantine maize viruses, namely maize chlorotic mottle virus and maize dwarf mosaic virus, the invention provides a primer probe composition capable of simultaneously detecting the two viruses and a rapid visual detection method. The primer probe composition and the detection method provided by the invention can be used for detecting two important viruses, a reliable theoretical basis is provided for rapidly identifying pathogens of plant related diseases, and outbreak and prevalence of related host plant diseases caused by pathogen invasion are delayed and even avoided; the kit has the characteristics of stability, specificity, sensitivity and suitability for on-site rapid detection.

Description

Technical Field

[0001] The invention relates to the technical field of virus detection, and in particular to a method for rapid visual detection of corn virus nucleic acid. Background Art

[0002] As one of the most widely planted cereal crops in the world, corn has been used as food, feed and raw material for a large number of industrial products for centuries. Corn virus disease is a common disease in corn production, which can seriously affect the yield and quality of corn. According to relevant reports, there are more than 40 types of corn virus diseases worldwide, and their impact on corn production is also showing a trend of increasing year by year.

[0003] Maize chlorotic mottle virus (MCMV) belongs to the family Tombusviridae and the genus Machlomovirus. MCMV was first discovered in Peru in 1974 and has spread widely around the world in the following decades, across different countries in several continents, including Argentina, Thailand, Mexico, Uganda, and Spain. Under natural infection, MCMV can cause a 10%-15% reduction in corn yield. MCMV can infect the host alone, causing the host leaves to turn green, yellow, and mottled, or form necrotic spots, curled leaves, and dieback, causing the plant to become dwarfed, prematurely aged, and stunted, thus seriously affecting the fruit set rate and yield of the entire plant; it can also infect with other viruses (such as sugarcane mosaic virus or maize dwarf mosaic virus).

[0004] Maize dwarf mosaic virus (MDMV) belongs to the Potyviridae family and is widely distributed around the world. It was listed in the List of Quarantine Pests for Plants Entering the People's Republic of China in April 2021. When MDMV infects corn, it will cause the corn plants to become dwarfed, the leaves to turn green, sterile, and may cause the corn to die prematurely. This infection usually reduces corn yields by more than 20%, and in severe cases, it may even lead to a total loss of corn harvest.

[0005] Strengthening virus inspection and quarantine is an important way to prevent and control the outbreak and epidemic of corn diseases caused by virus infection. However, the type of virus that infects corn cannot be fully confirmed by corn symptoms / phenotypes alone; for example, MDMV and sugarcane mosaic virus (SCMV), sorghum mosaic virus (SrMV), and Johnsongrass mosaic virus (JGMV) can all cause corn dwarf mosaic disease, and the symptoms they cause are very similar, so it is often difficult to distinguish them. Therefore, how to quickly and visually detect the above two important corn viruses is one of the technical problems that need to be solved in this field. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a method for rapid visual detection of nucleic acids of maize chlorotic mottle virus (MCMV) and maize dwarf mosaic virus (MDMV).

[0007] In a first aspect, the present invention provides a composition for detecting viruses, comprising: a first composition for detecting maize chlorotic mottle virus and a second composition for detecting maize dwarf mosaic virus;

[0008] Wherein, the first composition comprises a first forward primer and a first reverse primer, the nucleotide sequence of the first forward primer is SEQ ID No.1, and the nucleotide sequence of the first reverse primer is SEQ ID No.2;

[0009] The second composition includes a second forward primer and a second reverse primer, the nucleotide sequence of the second forward primer is SEQ ID No.3, and the nucleotide sequence of the second reverse primer is SEQ ID No.4.

[0010] In the composition as described above, the MCMV includes MCMV from three different strains, specifically at least one of MCMV-KS1 (GenBank sequence number is X14736.2), MCMV-NFU2 (GenBank sequence number is KJ782300.1), and MCMV-M1 (GenBank sequence number is KP772217.1).

[0011] In the composition as described above, the MDMV includes at least one of Maize dwarf mosaic virus isolate MK1 (sequence number of GenBank is MW026054.1), Maize dwarf mosaic virus, isolate Mv0804 (sequence number of GenBank is FM883167.1), and Maize dwarf mosaic virus isolate MD2 (the GenBank number of its partial protein coding sequence is MH332875.1).

[0012] In the composition as described above, the nucleotide sequences of the first forward primer and the first reverse primer for detecting MCMV are specifically as follows:

[0013] SEQ ID No.1: 5'-CAGCACAATCACAGATGTGGAATACAATTG-3';

[0014] SEQ ID No. 2: 5'-CACCTGAACACAGTGCGGTTTTGTGG-3'.

[0015] The nucleotide sequences of the second forward primer and the second reverse primer for detecting MDMV are specifically as follows:

[0016] SEQ ID No.3: 5'-AGTGTCAGTACCCAAGCTCAAAGCCATGTC-3';

[0017] SEQ ID No. 4: 5'-TGCTTCATACCACCTATCAAAATTCAGCCCT-3'.

[0018] The composition provided according to the first aspect of the present invention can realize the detection of viruses, specifically comprising: extracting RNA of the sample to be detected, obtaining a cDNA sample by reverse transcription, and amplifying the cDNA sample with the above composition, and detecting the amplified product by agarose gel electrophoresis, and determining whether the sample to be detected contains viruses or contains viruses above the minimum detection limit based on whether there are amplified bands.

[0019] In order to achieve rapid visual detection of viruses, in a second aspect, the present invention provides a composition for detecting viruses, comprising: a third composition for detecting maize chlorotic mottle virus and a fourth composition for detecting maize dwarf mosaic virus;

[0020] The third composition comprises a first forward primer, a first reverse primer modified with a first labeling group, and a first probe, the nucleotide sequence of the first forward primer is SEQ ID No. 1, the nucleotide sequence of the first reverse primer is SEQ ID No. 2, and the structure of the first probe is as shown in Formula 1;

[0021] 5'-Y1-(n)aH-(n)b-Z1-3'Formula 1;

[0022] In Formula 1, Y1 is the first fluorescent group, (n)a is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 5, H is a tetrahydrofuran residue, (n)b is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 6, and Z1 is a first blocking group;

[0023] The fourth composition comprises a second forward primer, a second reverse primer modified with a second labeling group, and a second probe, the nucleotide sequence of the second forward primer is SEQ ID No. 3, the nucleotide sequence of the second reverse primer is SEQ ID No. 4, and the structure of the second probe is shown in Formula 2;

[0024] 5'-Y2-(n)mH-(n)n-Z2-3' formula 2;

[0025] In Formula 2, Y2 is the second fluorescent group, (n)m is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 7, H is a tetrahydrofuran residue, (n)n is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 8, and Z2 is a second blocking group.

[0026] In the composition as described above, the first labeling group and the second labeling group are biotin, and the first labeling group and the second labeling group are modified at the 5' end of the reverse primer.

[0027] In the composition as described above, the first fluorescent group and the second fluorescent group are independently selected from one of FAM, FITC, TAMRA, HEX, CY3, CY5, ROX, Texas Red, and digoxin. Further, the first fluorescent group and the second fluorescent group are different, and visual detection is achieved by binding to different anti-fluorescent group antibodies coated on the detection area of ​​the test paper; further, the first fluorescent group is FAM and the second fluorescent group is digoxin.

[0028] In the composition as described above, the first blocking group and the second blocking group are C3 spacers.

[0029] In a third aspect, the present invention provides a composition selected from any one of A1) to A4);

[0030] A1) a first composition for detecting maize chlorotic mottle virus in the composition provided in the first aspect of the present invention;

[0031] A2) the first composition for detecting corn dwarf mosaic virus in the composition provided by the first aspect of the present invention;

[0032] A3) a third composition for detecting maize chlorotic mottle virus in the composition provided in the second aspect of the present invention;

[0033] A4) The fourth composition for detecting corn dwarf mosaic virus among the compositions provided in the second aspect of the present invention.

[0034] In a fourth aspect, the present invention provides a product comprising any of the above compositions.

[0035] The product as described above may be a kit.

[0036] The product as described above may also include reagents such as enzymes used in amplification reactions, which may be specifically confirmed according to conventional technical means in the art.

[0037] The product as described above may also include a test strip, which is prepared based on colloidal gold immunochromatography technology.

[0038] In a fifth aspect, the present invention provides an application of the above composition, wherein the application is selected from any one of B1) to B2):

[0039] B1) Application in virus detection or auxiliary detection;

[0040] B2) Application in the preparation of products for virus detection or auxiliary detection;

[0041] The virus includes at least one of maize chlorotic mottle virus and maize dwarf mosaic virus.

[0042] In a sixth aspect, the present invention provides a method for detecting a virus, comprising:

[0043] Extracting RNA from the sample to be tested, and reverse transcribing the RNA to obtain a cDNA sample;

[0044] Using the cDNA sample as a template, and using the composition provided by the second aspect of the present invention to perform an amplification reaction on the cDNA sample to obtain an amplification product;

[0045] The amplification product is dripped onto the sample application area of ​​the test paper, and whether the sample to be tested contains the virus or contains a virus above the minimum detection limit is determined based on the strips in the detection area;

[0046] The virus includes at least one of maize chlorotic mottle virus and maize dwarf mosaic virus.

[0047] In the above method, RNA extraction, reverse transcription and amplification of the sample to be tested can be performed according to conventional techniques in the art. Furthermore, the reaction time of the amplification reaction is preferably 8 minutes, which helps to avoid the occurrence of false positives.

[0048] The method described above determines whether the sample to be tested contains the virus or contains the virus above the minimum detection limit according to the strips in the detection area of ​​the test paper; specifically, the detection area of ​​the test paper includes a T1 detection line (for detecting MCMV virus), a T2 detection line (for detecting MDMV virus) and a quality control line C, the T1 detection line is close to the quality control line C, and the T2 detection line is close to the sample loading hole; when T1 presents a red stripe, T2 does not present a red stripe and the quality control line C presents a red stripe, it indicates that the sample to be tested contains MCMV virus, does not contain MDMV virus or contains MDMV virus below the minimum detection limit; when T2 presents a red stripe, T1 does not present a red stripe, When red stripes appear on both T1 and T2 and a red stripe appears on the quality control line C, it indicates that the sample to be tested contains MDMV virus, does not contain MCMV virus, or contains MCMV virus below the minimum detection limit; when red stripes appear on both T1 and T2 and a red stripe appears on the quality control line C, it indicates that the sample to be tested contains both MCMV virus and MDMV virus; when no red stripes appear on T1 and T2 and a red stripe appears on the quality control line C, it indicates that the sample to be tested does not contain MCMV virus and MDMV virus, or contains MCMV virus and MDMV virus below the minimum detection limit; when no red stripe appears on the quality control line C, it indicates that the test result is invalid.

[0049] In the method as described above, the sample to be detected is a plant or a tissue derived from a plant.

[0050] Further, the plant or tissue derived from the plant is mainly a plant susceptible to MCMV or MDMV infection, for example, plants susceptible to MCMV infection include corn, millet, sugarcane, millet, sorghum, wheat, coix and other food crops; or for example, gramineous plants such as sorghum, sorghum, crabgrass, and foxtail grass; plants susceptible to corn dwarf mosaic virus infection include a variety of gramineous plants, mainly corn, sorghum, millet, sweet millet, millet, sudan grass and many weeds such as cricket grass, foxtail grass, miscanthus, barnyard grass, teff, crabgrass and bullwhip. Further, the plant is a gramineous plant. Further, the plant is corn, and the variety of corn is not further restricted.

[0051] The present invention provides a rapid visualization detection composition and method for nucleic acid of two viruses (MCMV and MDMV) that are easily infecting the above-mentioned plants. The composition and method can be used for the detection of two common plant diseases, provide a reliable theoretical basis for the rapid identification of plant disease pathogens, delay the invasion of pathogens and cause large-scale damage to plants, and have the characteristics of strong stability, high specificity, high sensitivity and suitability for rapid on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 The results of gene sequence comparison analysis of three different strains of MCMV and three other control viruses;

[0053] Figure 2 The agarose gel electrophoresis detection results of the amplified products obtained after amplifying the healthy corn sample, the negative control, and the plasmid containing the MCMV cDNA amplification product using the primer combination provided in Example 1; wherein M is a marker, lane 1 is the healthy corn sample, lane 2 is the negative control, and lane 3 is the plasmid containing the MCMV cDNA amplification product;

[0054] Figure 3 The sensitivity test results of the primer combination provided in Example 1 for detecting MCMV; wherein, M is a marker, lane 1 indicates a plasmid concentration of 172.5 ng / μL, lane 2 indicates a plasmid concentration of 172.5×10 -1 ng / μL, lane 3 indicates the plasmid concentration is 172.5×10 -2 ng / μL, lane 4 indicates the plasmid concentration is 172.5×10 -3 ng / μL, lane 5 indicates the plasmid concentration is 172.5×10 -4 ng / μL, lane 6 indicates the plasmid concentration is 172.5×10 -5 ng / μL, lane 7 indicates the plasmid concentration is 172.5×10 -6 ng / μL, lane 8 indicates the plasmid concentration is 172.5×10 -7 ng / μL, lane 9 indicates the plasmid concentration is 172.5×10 -8 ng / μL, lane 10 represents the negative control, and lane 11 represents the blank sample;

[0055] Figure 4 The double RP-LED test results of different positive samples; 1 is a double positive sample, 2 is a positive sample with only MCMV added, 3 is a positive sample with only MDMV added, and 4 is a negative control;

[0056] Figure 5The results of double RPA-LFD specificity detection; 1 is a double-positive sample, 2 is a sample with only MCMV, 3 is a sample with only MDMV, 4 is a SrMV sample, 5 is a SCMV sample, 6 is a PalMV sample, and 7 is a negative control;

[0057] Figure 6 is the sensitivity test result of dual RPA-LFD; 1 means the plasmid concentration of MCMV cDNA amplification product is 68.2 ng / μL and the plasmid concentration of MDMV cDNA amplification product is 90.0 ng / μL, 2 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -1 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -1 ng / μL, 3 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -2 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -2 ng / μL, 4 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -3 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -3 ng / μL, 5 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 - 4 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -4 ng / μL, 6 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -5 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -5 ng / μL, 7 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -6 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -6 ng / μL, 8 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -7 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -7 ng / μL, 9 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 - 8 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -8ng / μL, 10 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -9 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -9 ng / μL, 11 as negative control;

[0058] Figure 7 are the detection results of different RPA reaction times; wherein, 1 represents the detection result of the double-positive sample at an RPA reaction time of 4 min, 2 represents the detection result of the double-positive sample at an RPA reaction time of 8 min, 3 represents the detection result of the double-positive sample at an RPA reaction time of 10 min, 4 represents the detection result of the double-positive sample at an RPA reaction time of 12 min, 5 represents the detection result of the double-positive sample at an RPA reaction time of 16 min, 6 represents the detection result of the negative control sample at an RPA reaction time of 4 min, 7 represents the detection result of the negative control sample at an RPA reaction time of 8 min, 8 represents the detection result of the negative control sample at an RPA reaction time of 10 min, 9 represents the detection result of the negative control sample at an RPA reaction time of 12 min, and 10 represents the detection result of the negative control sample at an RPA reaction time of 16 min. DETAILED DESCRIPTION

[0059] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0060] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0061] The extraction steps of the corn tissue RNA sample involved in the following embodiment include: placing 50-100 mg of corn tissue in a 2 mL EP tube, adding a small steel ball, freezing with liquid nitrogen, grinding in a grinder for 60 seconds, and removing the steel ball after grinding. Add 1 mL of TRIzol reagent to the EP tube, shake and mix thoroughly, and let stand at room temperature for 5 minutes; continue to add 200 μL of chloroform, mix thoroughly, shake vigorously for 15 seconds, then let stand at room temperature for 3 minutes, and centrifuge at 12000 rpm for 15 minutes at 4 ° C. After centrifugation, carefully transfer the upper aqueous phase to a new enzyme-free tube. Add an equal volume of isopropanol to the enzyme-free tube, mix it upside down, let stand at room temperature for 10 minutes when RNA precipitates, centrifuge at 12000 rpm for 15 minutes at 4 ° C, and discard the supernatant. Use DEPC water and anhydrous ethanol to prepare 75% ethanol, add 1mL of 75% ethanol to the centrifuge tube, wash the precipitate upside down, and then centrifuge at 7000rmp for 5min at 4℃, and discard the waste liquid. Repeat the washing 1-2 times to avoid the effect of organic solvents on RNA quality. After washing, centrifuge the reagent tube instantly, then use a pipette to absorb the excess ethanol solution, open the reagent tube at room temperature and dry it, add 10μL DEPC water, blow with a gun until the precipitate is dissolved and mixed, and obtain the RNA sample of corn tissue, which is stored in a -80℃ refrigerator.

[0062] The plasmid containing viral cDNA involved in the following embodiment is prepared according to the following steps: corn leaves susceptible to MCMV or MDMV are collected respectively, and viral RNA is extracted from the corn leaves susceptible to disease, and cDNA is obtained by reverse transcription. After sequencing and comparison, the collected viral cDNA is highly consistent with MCMV-KS1 (GenBank sequence number is X14736.2) and MDMV-MK1 (GenBank sequence number is MW026054.1), respectively, and it can be determined that the collected viruses are MCMV and MDMV. The T2 primer pair shown in Table 2 below and the primer pair shown in Table 4 are used to PCR amplify the viral cDNA to obtain a PCR product, and the PCR product is purified and connected to the TOPO TA / Blunt vector (purchased from Beijing Aidelai Biotechnology Co., Ltd., item number CV2201), and the connection product of cDNA and TOPO TA / Blunt vector is introduced into Escherichia coli competent cells, and the Escherichia coli successfully introduced is selected by resistance screening; the Escherichia coli successfully introduced is broken and the plasmid is extracted to obtain a plasmid containing viral cDNA.

[0063] Example 1: Design of primers and probes for detecting corn MCMV virus

[0064] 1. Primer design and screening

[0065] The gene sequences of three different strains of MCMV virus and other three control viruses were compared and analyzed in GenBank. Among them, the three different strains of MCMV virus were MCMV-KS1 (GenBank sequence number is X14736.2), MCMV-NFU2 (GenBank sequence number is KJ782300.1), and MCMV-M1 (GenBank sequence number is KP772217.1); the three control viruses were oat chlorotic stunt virus OCSV (GenBank sequence number is X83964.1), cucumber necrosis virus CuNV (GenBank sequence number is M25270.1), and tomato bushy stunt virus TBSV (GenBank sequence number is M21958.1). The analysis results are as follows: Figure 1 As shown, specific amplification of MCMV was achieved by selecting highly conserved fragments.

[0066] according to Figure 1 The results showed that the MCMV CP gene has a highly conservative characteristic and is suitable as a detection target gene in subsequent experiments. Taking the MCMV CP gene sequence as the target fragment, four pairs of primers were selected for subsequent primer screening through the NCBI primer online design tool and in accordance with the requirements for recombinase polymerase amplification (RPA) primer design. The nucleotide sequences of the primers are shown in Table 1. Using the plasmid containing MCMV cDNA as a template, the RPA experiment was performed using the four pairs of primers shown in Table 1. After the reaction, the RPA product was subjected to agarose gel electrophoresis, and the product size is shown in Table 1. According to the amplification product size shown in Table 1. The F1 / R1 and F2 / R3 primer combinations were selected for subsequent experiments.

[0067] Table 1 Nucleotide sequences of primer pairs used for specific amplification of MCMV viral genome

[0068]

[0069] Since colloidal gold particles can bind to biotin, it is necessary to carry a biotin label on the 5' end of the reverse primer so that the amplified product is labeled with biotin and can bind to the colloidal gold particles to produce intuitive detection results. According to the probe design rules of the DNA constant temperature rapid amplification kit (colloidal gold test strip type), a 46-52nt sequence complementary to the amplified fragment is designed in the middle of the amplified fragment, a FAM group is marked at the 5' end of the sequence, a C3-spacer is marked at the 3' end as a blocking group, and a tetrahydrofuran is marked in the middle position. According to the above principles, two pairs of primers and two probes are designed, and the nucleotide sequences are specifically shown in Table 2.

[0070] Table 2 RT-RPA-LFD primer and probe sequences

[0071]

[0072] The T1 primer pair will cause different degrees of false positives during the experiment. When only the upstream primer is added but not the downstream primer, the test strip has only one obvious quality control line. However, when only the downstream primer is added but not the upstream primer, the test strip will still report an obvious positive result, which will interfere with the final test result and make the final result inaccurate. On the contrary, the T2 primer pair can sensitively detect the presence of positive fragments and does not interfere with the test. Therefore, the T2 primer pair was selected for subsequent experiments and used for basic RPA experiments.

[0073] RNA samples from healthy corn leaves were reverse transcribed to obtain healthy corn cDNA samples; cDNA samples obtained from healthy corn leaves and plasmids containing MCMV virus cDNA were used as templates, and T2 primer probes were used to amplify the cDNA samples by RPA, with dd H2O as a negative control; agarose gel electrophoresis was performed on the amplified products, and the test results were as follows: Figure 2 As shown, it can be seen that the T2 primer pair is specific.

[0074] 2. Sensitivity of RT-PCR in detecting MCMV

[0075] The plasmid containing MCMV cDNA was used as a template and diluted to 172.5 ng / μL, 172.5×10 -1 ng / μL、172.5×10 -2 ng / μL、172.5×10 -3 ng / μL、172.5×10 -4 ng / μL、172.5×10 -5 ng / μL、172.5×10 -6 ng / μL、172.5×10 -7 ng / μL、172.5×10 -8 ng / μL, MCMV-RPA-F2 and MCMV-RPA-R3 were used as primers for RT-PCR amplification, negative control and blank samples were set up, and the amplification products were detected by agarose gel electrophoresis. Figure 3 As shown in the figure, the conventional RT-PCR method showed that the concentration of plasmid was 1.725×10 -3 ng / μL and above, there is a target band consistent with the expected size.

[0076] Example 2: Design of primers and probes for detecting corn MDMV

[0077] 1. Primer design and screening

[0078] The design principle of the maize MDMV primers is the same as above, and the final screening results of the primer probes are shown in Table 4.

[0079] Table 4 Primer probe composition for detecting corn MDMV virus

[0080] Primer probe name Nucleotide sequence (5'-3') MDMV-F2 AGGTTCAGTCCAAGCTCAAAGCCATGTC MDMV-R2 Biotin-TGCTTCATACCACCTATCAAATTCAGCCCT MDMV-RPA-probe Fam-TCAGGCAAAAGGGAAGAACATTCTTCATCT(THF)CCTTCTGAAATATAA-C3spacer

[0081] Example 3: Construction of a dual nucleic acid detection method based on RPA-LFD

[0082] 1. Construction of RPA-LFD detection system

[0083] Synthesize MCMV-F2, MCMV-R3, MDMV-F2, MDMV-R2 primers and MCMV-PROBE-2 and MDMV-RPA-probe probes as shown in the table above; Dissolve MCMV-F2, MCMV-R3, MDMV-F2, MDMV-R2 primers in ddH2O solvent to prepare primer solutions with a concentration of 10 μM; Dissolve MCMV-PROBE-2 and MDMV-RPA-probe probes in ddH2O to prepare probe solutions with a concentration of 10 μM; During the detection process, use a DNA constant temperature rapid amplification kit (colloidal gold test strip type) purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd. to amplify the cDNA template of the sample to be detected. According to the instructions of the kit, a dry powder reaction tube, 29.4 μl of A buffer, 1.2 μl MCMV-F2 solution, 1.2 μl MCMV-R3 solution, 1.2 μl MDMV-F2 solution, 1.2 μl MDMV-R2 solution, 0.5 μl MCMV-PROBE-2 solution, 0.5 μl MDMV-RPA-probe solution, 2.5 μl B buffer, and cDNA template were mixed, and the total volume was filled with ddH2O to 50 μl to obtain an amplification reaction system.

[0084] The above amplification reaction system was reacted in a 38°C water bath for 10 minutes. After the reaction, 10 μL of the amplified product was mixed with 190 μL of double distilled water (ddH2O), and 80 μL of the mixed product was added to the sample well of the double nucleic acid test strip (latex chromatography) (purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd., product number WLFS8202). By observing the color of the detection area T1 and T2, the type of virus contained in the corn to be tested was determined; the detection line close to the quality control line C was T1, and the detection line close to the sample well was T2. When T1 showed a red band, T2 did not show a red band, and the quality control line C showed a red band, it indicated that the sample to be tested contained MCM V, and does not contain MDMV or contains MDMV below the detection limit; when T2 presents a red stripe, T1 does not show a red stripe and the quality control line C shows a red stripe, it indicates that the sample to be tested contains MDMV, and does not contain MCMV or contains MCMV below the detection limit; when both T1 and T2 show red stripes and the quality control line C shows a red stripe, it indicates that the sample to be tested contains MCMV and MDMV; when both T1 and T2 do not show red stripes and the quality control line C shows a red stripe, it indicates that the sample to be tested does not contain MCMV and MDMV or contains MCMV and MDMV below the detection limit; when no red stripe appears on the quality control line C, it indicates that the test result is invalid.

[0085] 2. Using a mixture of plasmids containing MCMV cDNA amplification products and plasmids containing MDMV cDNA amplification products as template 1, the test was performed according to the above-mentioned PRA amplification and test strip detection method. The test results are as follows: Figure 4 As shown in the number 1; using the plasmid containing the MCMV cDNA amplification product as template 2, the detection was performed according to the above-mentioned PRA amplification and test strip detection method, and the detection results are shown in Figure 4 As shown in number 2; using the plasmid containing the MDMV cDNA amplification product as template 3, the detection was performed according to the above PRA amplification and test strip detection method, and the test results are shown in Figure 4 As shown in No. 3; ddH2O was used as the negative control and the same method was used for detection. The test results are as follows Figure 4 As shown in number 4.

[0086] according to Figure 4 The results shown indicate that the method provided by the present invention can simultaneously detect whether a sample contains MCMV and MDMV.

[0087] 3. Specificity experiment

[0088] The cDNA of Sorghum mosaic virus (SrMV), the gene plasmids of Sugarcane mosaic virus (SCMV) and Pennisetum alopecuroides mosaic virus (PalMV) were used as templates, and the above-mentioned PRA amplification and test strip detection method was used for detection to confirm the specificity of the above method, and ddH2O was used as a negative control.

[0089] Test results such as Figure 5 As shown, it can be seen that the test results are consistent with the actual situation. Only the addition of MCMV and MDMV positive samples can show red bands, while SrMV, SCMV, PalMV and negative controls do not show red bands.

[0090] 4. Sensitivity test

[0091] The plasmid containing the MCMV cDNA amplification product and the plasmid containing the MDMV cDNA amplification product were diluted with ddH2O in a 10-fold gradient to obtain 9 different concentrations of MCMV and MDMV plasmid solutions, which were marked as 1-10, respectively, where 1 represented the plasmid concentration of the MCMV cDNA amplification product of 68.2 ng / μL and the plasmid concentration of the MDMV cDNA amplification product of 90.0 ng / μL, and 2 represented the plasmid concentration of the MCMV cDNA amplification product of 68.2×10 -1 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -1 ng / μL, 3 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -2 ng / μL and the plasmid concentration of MDMVcDNA amplification product was 90.0×10 -2 ng / μL, 4 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -3 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -3 ng / μL, 5 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -4 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -4 ng / μL, 6 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -5 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -5ng / μL, 7 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -6 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -6 ng / μL, 8 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -7 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -7 ng / μL, 9 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -8 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -8 ng / μL, 10 means the plasmid concentration of MCMV cDNA amplification product is 68.2×10 -9 ng / μL and the plasmid concentration of MDMV cDNA amplification product was 90.0×10 -9 ng / μL, the above diluted plasmid was used as a template for amplification, and ddH2O was used as a negative control. After the reaction was completed, 10μL of the amplified product was mixed with 190μL of dd H2O, and 80μL of the mixed product was pipetted and added to the sample well of the test strip.

[0092] Test results such as Figure 6 As shown, when the MCMV concentration was 68.2×10 -4 ng / μL and MDMV concentration was 90.0×10 -6 ng / μL, all of them had red stripes, indicating that the lowest detection concentration of MCMV in the present invention was 68.2×10 -3 ng / μL, the minimum detection concentration of MDMV was 90.0×10 -5 ng / μL.

[0093] 5. Optimize response time

[0094] The RPA amplification reaction was carried out using a mixture of a plasmid containing MCMV cDNA amplification products and a plasmid containing MDMV cDNA amplification products as templates. The RPA amplification reaction time was controlled at 4 min, 8 min, 10 min, 12 min, and 16 min, respectively. At the same time, dd H2O was used as a negative control. After the same reaction time, 10 μL of the amplification product was mixed with 190 μL of ddH2O, and 80 μL of the mixed product was pipetted and added to the sample well of the test strip to observe the color development of the strip.

[0095] Test results such as Figure 7As shown, it can be seen that the five reaction times can detect both MDMV and MCMV viruses, but at 10min, 12min, and 16min, false positives will occur in the T1 line, so 8min is selected as the optimal detection time.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A composition for detecting a virus, characterized in that: include: a first composition for detecting maize chlorotic mottle virus and a second composition for detecting maize dwarf mosaic virus; Wherein, the first composition comprises a first forward primer and a first reverse primer, the nucleotide sequence of the first forward primer is SEQ ID No.1, and the nucleotide sequence of the first reverse primer is SEQ ID No.2; The second composition includes a second forward primer and a second reverse primer, the nucleotide sequence of the second forward primer is SEQ ID No.3, and the nucleotide sequence of the second reverse primer is SEQ ID No.

4.

2. A composition for detecting a virus, characterized in that: include: a third composition for detecting maize chlorotic mottle virus and a fourth composition for detecting maize dwarf mosaic virus; The third composition comprises a first forward primer, a first reverse primer modified with a first labeling group, and a first probe, the nucleotide sequence of the first forward primer is SEQ ID No. 1, the nucleotide sequence of the first reverse primer is SEQ ID No. 2, and the structure of the first probe is as shown in Formula 1; 5'-Y1-(n)aH-(n)b-Z1-3'Formula 1; In Formula 1, Y1 is the first fluorescent group, (n)a is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 5, H is a tetrahydrofuran residue, (n)b is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 6, and Z1 is a first blocking group; The fourth composition comprises a second forward primer, a second reverse primer modified with a second labeling group, and a second probe, the nucleotide sequence of the second forward primer is SEQ ID No. 3, the nucleotide sequence of the second reverse primer is SEQ ID No. 4, and the structure of the second probe is shown in Formula 2; 5'-Y2-(n)mH-(n)n-Z2-3' formula 2; In Formula 2, Y2 is the second fluorescent group, (n)m is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 7, H is a tetrahydrofuran residue, (n)n is a single-stranded DNA whose nucleotide sequence is SEQ ID No. 8, and Z2 is a second blocking group.

3. The composition according to claim 2, characterized in that The first labeling group and the second labeling group are biotin.

4. The composition according to claim 2, characterized in that The first fluorescent group and the second fluorescent group are independently selected from one of FAM, FITC, TAMRA, HEX, CY3, CY5, ROX, Texas Red, and digoxigenin.

5. The composition according to claim 2, characterized in that The first blocking group and the second blocking group are C3 spacer.

6. A composition, characterized in that Any one selected from A1) to A4); A1) a first composition for detecting maize chlorotic mottle virus in the composition of claim 1; A2) a second composition for detecting corn dwarf mosaic virus in the composition of claim 1; A3) a third composition for detecting maize chlorotic mottle virus in the composition of any one of claims 2 to 5; A4) A fourth composition for detecting corn dwarf mosaic virus in the composition according to any one of claims 2 to 5.

7. A product comprising the composition of any one of claims 1 to 6.

8. Use of the composition according to any one of claims 1 to 6, characterized in that: The application is selected from any one of B1) to B2): B1) Application in virus detection or auxiliary detection; B2) Application in the preparation of products for virus detection or auxiliary detection; The virus includes at least one of maize chlorotic mottle virus and maize dwarf mosaic virus.

9. A method for detecting a virus, characterized in that ,include: Extracting RNA from the sample to be tested, and reverse transcribing the RNA to obtain a cDNA sample; Using the cDNA sample as a template, and using the composition according to any one of claims 2 to 5 to perform an amplification reaction on the cDNA sample to obtain an amplification product; The amplification product is dripped onto the sample application area of ​​the test paper, and whether the sample to be tested contains the virus or contains a virus above the minimum detection limit is determined based on the strips in the detection area; The virus includes at least one of maize chlorotic mottle virus and maize dwarf mosaic virus.

10. The method according to claim 9, characterized in that The sample to be detected is a plant or a tissue derived from a plant.

Images