Rice insect-resistant key gene OsPYL5 and application thereof

Abstract

The invention discloses a rice insect-resistant key gene OsPYL5 and application thereof, the rice insect-resistant key gene OsPYL5 has an amino acid sequence as shown in SEQ ID NO: 2, or has an amino acid sequence with more than 95% of homology with the amino acid sequence as shown in SEQ ID NO: 2, and retains the insect-resistant function of rice. The rice OsPYL5 overexpression and knockout mutant strain is constructed, the insect resistance of the rice is influenced by regulating and controlling the expression quantity of the OsPYL5 gene, the OsPYL5 is proved to be a key gene for resisting the brown planthopper of the rice, and a new path is provided for the resistance of the rice to the brown planthopper through cloning and functional research on the OsPYL5 gene.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a key gene OsPYL5 for rice resistance to brown planthoppers and an application thereof. Background Art

[0002] Rice is an important food crop in my country, and the threat of rice pests is an important factor restricting its yield increase. Brown planthoppers are monophagous pests that feed on rice phloem sap through their mouthparts. Because of their strong reproductive ability and environmental adaptability, once the damage breaks out, the area of ​​occurrence will expand, the frequency of outbreaks will increase, and the degree of damage will increase. In recent years, with the extensive use of various pesticides, the environmental and resistance problems they bring have become increasingly prominent.

[0003] At present, the application of chemical pesticides is still the main method for field control of brown planthoppers. However, the widespread use of these compounds is harmful to human health and the environment, and has side effects that affect the natural enemies of brown planthoppers. Therefore, other brown planthopper management strategies that are more environmentally friendly, healthier and more sustainable must be developed. The development of green biopesticides and the use of rice's inherent resistance genes to breed resistant rice varieties have been widely recognized as the most cost-effective methods for sustainable control of brown planthoppers. Green biopesticides refer to preparations that directly use living organisms to control agricultural pests, and plant hormones are one of the important sources of botanical pesticides.

[0004] Plant hormones play an indispensable role in regulating plant growth and development and participating in plant stress resistance. Abscisic acid (ABA) is one of the most important hormones regulating plants and is also a plant-derived biochemical pesticide. Under abiotic stress, plants activate their own stress resistance immune system by accumulating ABA, inducing plants to produce characteristics such as cold resistance, salt resistance and drought resistance. Changes in ABA content in plant tissues trigger signal cascades, which depend on the induced expression of genes controlled by ABA. In the case of increased ABA content, receptor proteins perceive signals by binding to ABA. Receptor proteins initiate signal cascades, transmit information to effector sites through transmitters, and respond to stimuli through gene expression products under ABA control, thereby inducing the plant to respond to specific conditions of the external or internal environment. The key component of the ABA signaling pathway, which regulates the sensitivity of plant tissues to this plant hormone, is the ABA receptor (PYL / PYR / RCAR) that binds to ABA.

[0005] PYL receptors have a conserved steroidogenic acute regulation-associated lipid transfer (START) domain and therefore belong to the superfamily of START proteins. Fourteen genes encoding protein ABA receptors have been identified in the Arabidopsis genome, characterized by a conserved amino acid sequence. The best-known ABA receptor in monocots is the rice receptor. So far, 13 homologous genes of PYL receptors have been identified in this species, 10 of which are considered active. These proteins can simultaneously bind plant hormones and inhibit PP2C, leading to the activation of other elements of the ABA signaling pathway. Inhibition of the activity of type 2C phosphatases restores the activity of SnRK2 kinases, whose phosphorylation induces signal transduction and initiates the transcription of genes that depend on increased ABA concentrations (e.g. genes involved in adaptation to stress conditions). PYL5, PYL8, and PYL9 in Arabidopsis are induced under drought conditions. In turn, experiments have shown that all identified Arabidopsis PYR / PYL receptors (except AtPYL13) can induce signaling through their receptor activity.

[0006] The present invention further screens out the rice hormone ABA receptor PYL5, analyzes its structure and function, constructs a recombinant vector for directed mutation of the OsPYL5 gene using the CRISPR / Cas9 technology, genetically transforms Zhonghua 11 (ZH11) rice using the vector, screens the transformed strains and identifies mutations, and obtains mutant strains of the rice gene; detects the resistance of the mutants to brown planthoppers, and provides new exploration for the mechanism of rice resistance to brown planthoppers. Summary of the invention

[0007] Technical problem to be solved: In view of the deficiencies in the prior art, the present invention provides a rice insect-resistant key gene OsPYL5 and its application in regulating rice insect resistance.

[0008] Technical solution: A rice insect-resistant protein has an amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence with more than 95% homology to the amino acid sequence shown in SEQ ID NO: 2, and retains the function of rice insect resistance.

[0009] The gene OsPYL5 encoding the protein has a nucleic acid sequence as shown in SEQ ID NO: 1, or a nucleic acid sequence with at least 95% homology to the nucleic acid sequence shown in SEQ ID NO: 1, and can encode and regulate rice insect-resistant protein.

[0010] A vector for rice genetic transformation, comprising a gene OsPYL5 encoding a protein having an amino acid sequence shown in SEQ ID NO: 2 or at least 95% homology thereof and retaining insect-resistant function, and necessary regulatory elements, for expressing the gene in rice cells.

[0011] The application of the above genes as positive regulators in regulating rice resistance to brown planthoppers.

[0012] A method for improving rice resistance to brown planthoppers comprises the step of increasing the expression of the above protein.

[0013] A method for breeding rice varieties with resistance to brown planthoppers comprises screening out plants with enhanced expression of the above gene.

[0014] A kit for detecting the presence or expression level of the protein in rice comprises an antibody that specifically recognizes the protein or a probe that specifically binds to the gene.

[0015] The protein is used as a detection marker in the preparation of a biological agent for detecting the ability of rice to resist brown planthoppers.

[0016] The above gene is used as a detection marker in the preparation of transgenic rice or biological preparations for detecting the ability of rice to resist brown planthoppers.

[0017] Beneficial effects: The present invention constructs rice OsPYL5 overexpression and knockout mutant lines, affects rice insect resistance by regulating the expression level of the OsPYL5 gene, confirms that OsPYL5 is a key gene for rice resistance to brown planthoppers, and provides a new path for rice resistance to brown planthoppers by cloning and functional research on the OsPYL5 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The cDNA sequence and amino acid sequence of rice OsPYL5 were obtained by searching the MSU_Locus database in the National Rice Data Center to find the complete genome sequence, CDS region and protein sequence of OsPYL5. The full length of the OsPYL5 sequence is 2468 bp, the full length of the CDS region is 630 bp, and there are 209 amino acids in total.

[0019] Figure 2 The amino acid sequence alignment and phylogenetic relationship of PYL5 between species; the phylogenetic tree analysis of PYL5 amino acid sequence using the neighbor method found that the tree was divided into dicotyledon and monocotyledon and other branches, among which rice and goat grass were the closest, followed by wheat. PYL5 between plants of the same family but different families also had a genetic relationship.

[0020] Figure 3 The temporal and spatial expression pattern of OsPYL5 was detected by fluorescence quantitative analysis. The expression level of OsPYL5 gene in rice seedling, tillering and maturity stages and in root, stem, leaf and sheath tissues was detected.

[0021] Figure 4The subcellular localization of OsPYL5; the subcellular localization pattern of OsPYL5 was detected using injected tobacco and Confocol. Confocal microscopy showed that OsPYL5 was localized in the cytoplasm and nucleus, and the addition of ABA did not affect its localization, and it was still stably expressed in the nucleus and cytoplasm.

[0022] Figure 5 To quantitatively detect hygromycin in the rice homozygous lines OsPYL5-OE8 and OsPYL5-OE34, the full-length CDS of OsPYL5 was cloned and connected with the vector pCambia1301 to construct a recombinant plasmid. Two generations were screened and hygromycin was identified through rice tissue culture technology. A total of two OsPYL5 gene overexpression homozygous lines OsPYL5-OE8 and OsPYL-OE34 were identified.

[0023] Figure 6 Target design, sequencing and quantitative detection were performed for the rice knockout mutant lines ospyl5-3 and ospyl5-9. The knockout target of the target gene was designed on the targetDesign (scau.edu.cn) website using CRISPR-Cas9 technology, and two knockout targets, Target1 and Target2, were designed on the mRNA of OsPYL5.

[0024] Figure 7 The phenotype of OsPYL5 overexpression plants after being infested with brown planthoppers; after OsPYL5-OE8, OsPYL5-OE34 overexpression plants and WT were inoculated with insects, the overexpression plants survived after the WT plants died ( Figure 7 ).

[0025] Figure 8 The phenotype of ospyl5 knockout mutant plants after being infested by brown planthoppers; the fresh weight and dry weight of the overexpression plants after feeding by brown planthoppers were greater than those of WT. After inoculation of ospyl5-3 and ospyl5-9 knockout mutant plants and WT, the knockout mutant plants died, while the WT plants still survived, and the trend of brown planthoppers feeding on the knockout mutant plants increased significantly. The fresh weight and dry weight of WT after feeding by brown planthoppers were greater than those of the knockout mutant plants.

[0026] Fig. 9The average damage level and plant function loss index of OsPYL5 overexpression and knockout mutant plants after being infested by brown planthoppers; after comprehensive evaluation of the average damage level and function loss index of OsPYL5 overexpression and knockout mutant plants, the damage level of brown planthoppers feeding on the overexpression strain was significantly lower than that of WT and knockout mutant plants, and the plant function loss index was also significantly reduced, with the damage level reduced by 20%. However, the average damage level of the knockout mutant plants reached level 9, and the plant function loss index was as high as 100%, which was 30% higher than that of WT, indicating that brown planthoppers are more inclined to feed on knockout mutant plants.

[0027] Fig.10 To identify the insect resistance of OsPYL5 overexpression and knockout mutant plants; the feeding tendency of brown planthoppers on WT, overexpression and knockout mutant plants was measured, and the number of brown planthoppers on the overexpression plants was 18, on the WT was 31, and on the knockout mutant plants was 42; there were also large differences in the amount of egg laying, with 90 eggs laid in the overexpression plants, 200 eggs laid on the WT, and a significant increase on the knockout mutant plants, reaching 325 eggs; the amount of honeydew of brown planthoppers was only 1.5μL on the overexpression plants, 19.0μL on the WT, and 45.0μL on the knockout mutant plants; the survival rate of 3-day-old nymphs was the lowest in the overexpression strain, only 17.5%, which increased to 52.5% in the WT, and the survival rate of 3-day-old nymphs on the knockout mutant plants reached 65.0%. The above results indicate that OsPYL5 can affect the feeding behavior, egg-laying amount and honeydew amount of brown planthoppers, thereby playing a positive regulatory role in rice resistance to brown planthoppers, reducing the feeding of brown planthoppers and reducing the damage caused by brown planthoppers.

[0028] Fig.11 The results showed that the OsPYL5 overexpression and knockout mutant plants were infested with brown planthoppers and had significantly increased levels of flavonoids, total plant phenols, hydrogen peroxide (H2O2) and MDA in the OsPYL5 overexpression plants, but the total plant phenols in the ospyl5 knockout mutant plants were significantly higher than those in the WT plants. The other three antibiotics were significantly decreased.

[0029] Fig.12 The enzyme activities of OsPYL5 overexpression and knockout mutant plants were detected after being infested by brown planthoppers. The enzyme activities of POD, PPO, SOD and CAT increased significantly in the overexpression plants, which were 2.0, 1.4, 30.0 and 4.0 times higher than those of WT, respectively. Except for the CAT enzyme activity in the knockout mutant plants, which had no significant difference with WT, the enzyme activities of POD, PPO and SOD decreased significantly by 1.58, 4.43 and 2.24 times compared with WT. DETAILED DESCRIPTION

[0030] The technical solution of the present invention is further described in detail below through specific implementation.

[0031] Example 1 Cloning of Rice OsPYL5 Gene

[0032] (1) Based on the National Rice Data Center, Snap Gene was used to design primers, where the PYL5 forward primer was: 5'-ATGGTGGGGCTTGTGGGAGG-3', and the reverse primer was: 5'-CTACTGTTCAAGTGGCGAGG-3'; the high-fidelity PCR reaction system was as follows: 2× Primer star Buffer 25μL; forward primer (10μM) 1μL, reverse primer (10μM) 1μL, template (rice ZH11 cDNA), ddH2O supplemented to 50μL. Reaction procedure: (98℃10s-55℃15s-72℃1min30s)×32 cycles, stored at -4℃.

[0033] (2) CRISPR-Cas9 target design and transformation

[0034] Design target primers according to the Sg Sequence provided by BioGene Technology (Jiangsu) Co., Ltd. The target 1 primer sequence is:

[0035] PYL5-gRT1: acggcttgta cctctgcggc gttttagagc tagaaat;

[0036] PYL5-OsU6bT1: gccgcagagg tacaagccgt caacacaagc ggcagc.

[0037] The primer sequence for target 2 is:

[0038] PYL5-gRT2:tgctagccgctctgatacctgttttagagctagaaat;

[0039] PYL5-OsU6cT2:aggtatcagagcggctagcactgagcctcagcgcag.

[0040] Prepare oligo dimer, then construct CRISPR-Cas vector, connect reaction system, Vector 2μL, EnzymeMix 1μL, Oligo dimer 1μL, H2O 6μL, reaction conditions are 25℃ for 1h. Transform competent state, transform competent state.

[0041] Take 5μL of the above reaction solution, add 20μL competent cells (DH5α), mix and place on ice for 30min (do not shake); take out gently, heat shock at 42℃ for 35s, and immediately place on ice for 2min; add 100μL LB, shake and culture at 37℃ for 1h; take 60μL of bacterial solution and spread on LB plate containing kanamycin, invert and culture at 37℃ overnight. Select single clones, extract plasmids and send for sequencing. The sequencing primer is PUV4-R: 5'-TCCCAGTCACGACGTTGTAA.

[0042] Example 2 Genetic transformation of OsPYL5 gene

[0043] The constructed CRISPR-Cas9 vector was transferred into rice through Agrobacterium infection. The experimental steps included induction for 10 days, subculture for 5 days, Agrobacterium streaking for 2 days, co-cultivation for 3 days, screening for 30 days, differentiation for 30 days, and rooting for 7 days, for a total of 87 days.

[0044] (1) Callus induction and subculture Select mature rice seeds (preferably newly harvested in the current year), peel off the husks, pour into a 50 mL centrifuge tube, add 75% ethanol to disinfect for 1 min, pour out the ethanol, rinse with sterile water once, pour out, add 30% sodium hypochlorite to disinfect for 20 min, pour out the sodium hypochlorite and rinse with sterile water 5-6 times. Use a pipette to absorb excess water (sterilized filter paper can be used to absorb dry), and transfer the seeds to the induction medium, 20-25 seeds per dish.

[0045] (2) After the callus grows, the original embryo can be used for direct transformation. The small particles growing next to the original embryo can be picked out and transferred to a new induction medium for subculture. When they grow to an appropriate size, they can also be transformed.

[0046] (3) Agrobacterium culture: Streak the Agrobacterium EHA105 containing the target gene vector on a plate containing the corresponding antibiotic and culture it in the dark at 28°C for 2 days until a single colony appears.

[0047] (4) Agrobacterium infection: prepare the infection solution, use a pipette to absorb the infection solution and wash off the Agrobacterium on the plate, which is the Agrobacterium suspension for co-culture transformation of rice. Select a sufficient number of callus tissues (the callus is in good condition, bright yellow in color, round and hard in texture, and the particle diameter is about 3 mm), put them into a 100 mL sterile conical flask, add an appropriate amount of Agrobacterium suspension (make sure there is enough bacterial liquid in contact with the material), and leave it at room temperature for infection for 20 minutes, shaking it from time to time. Pour out the bacterial liquid, place the callus tissue on a sterile filter paper to absorb the excess bacterial liquid, and then transfer it to a solid co-culture medium covered with a layer of sterile filter paper, and culture it in the dark at 26°C for 3 days.

[0048] (5) Screening culture: After 3 days of co-culture, the callus tissue needs to be cleaned. Use a 1 mL blue pipette tip to sow the callus on the co-culture medium into a sterilized Erlenmeyer flask, add sterile water to rinse both sides, and rinse once with sterile water containing 500 μL / L carbenicillin for the third time. After the excess water is sucked off with a pipette, the callus is transferred to sterile filter paper and the water on the callus is blown dry with the air from the clean bench. The blowing time is controlled to about 30 minutes. After the callus is blown dry, it is transferred to the screening medium for screening culture. The culture conditions are 28-30°C and dark culture. The screening period is 3-4 weeks.

[0049] (6) Differentiation and regeneration: After one month of screening, positive calli with bright yellow color can be seen growing. At this time, the positive calli can be picked and placed on the differentiation medium for differentiation and regeneration. 16 positive calli are placed on each differentiation dish and placed in a 28-30℃ greenhouse for light culture. Generally, green spots will emerge from the calli in about 10 days, and seedlings will differentiate after about 10 days.

[0050] (7) Rooting of seedlings: When the differentiated seedlings grow to about 2-3 cm and have obvious root systems, they can be transferred to rooting medium to grow. The rooting medium should be poured into a relatively high bottle or tube so that the rooted seedlings have enough space to grow taller. The rooting culture conditions are 28-30℃ and sterile light culture.

[0051] Example 3 Transient expression of exogenous protein in tobacco and detection of subcellular localization

[0052] The exogenous OsPYL5 recombinant plasmid was introduced into tobacco leaves for expression using Agrobacterium. The experimental steps are as follows:

[0053] (1) Pick up the Agrobacterium clone containing the OsPYL5 recombinant plasmid and transfer it to 5 mL of K + The cells were cultured in LB medium at 30°C in a constant temperature shaker at 250 rpm for 1 day.

[0054] (2) The cultured Agrobacterium liquid was centrifuged and recovered, and 50 μL of Agrobacterium cells were inoculated into a new 5 mL LB medium containing K+. 100 μL of 0.5 M MES and 2 μL of 100 mM AS were added. The liquid was cultured at 250 rpm in a 30°C constant temperature shaker until the OD600 reached 1.0. The cells were recovered by centrifugation at 4000 rpm for 10 min at room temperature.

[0055] (3) Resuspend the recovered bacteria with 10 mM MgCl2 and dilute to OD600 of 1.0. Add the corresponding AS at a ratio of 2 μL of AS to 1 mL of resuspended bacterial solution, and let the bacterial solution stand at room temperature for more than 3 h.

[0056] (4) Take a well-growing tobacco leaf, use a 1 mL syringe to absorb the above-mentioned bacterial solution, use a needle to make a small hole on the back of the leaf, and inject the bacterial solution into the leaf from the back of the leaf.

[0057] After the tobacco injected with Agrobacterium was cultured in a constant temperature incubator at 23°C for 2 days, about 1 cm of the injection site was taken for fluorescence imaging under a laser confocal microscope to see if there was fluorescence through corresponding excitation light imaging.

[0058] Example 4 Identification of insect resistance of OsPYL5 overexpression and knockout mutant plants

[0059] Determination of the effect of OsPYL5 overexpression and knockout mutant rice plants on the feeding tendency of brown planthopper

[0060] The rice seeds of WT, OsPYL5 overexpression and knockout mutant plants were soaked and germinated and hydroponically cultured in a plant growth chamber until the 4-leaf stage. The cultured rice was placed in a black glass cup and the cups were placed in three positions with equal spacing between the cups. 15 plants were taken for each treatment, and each cup represented a replicate, with a total of 15 replicates. 120 4th-instar nymphs were starved for 1 hour before inoculation. Brown planthoppers were placed in the middle of the three rice plants and allowed to freely choose rice to feed on. The experiment was carried out and observed at room temperature, and the number of brown planthoppers on each seedling was recorded.

[0061] Determination of the average damage level and plant function loss index after brown planthoppers fed on rice plants with OsPYL5 overexpression and knockout mutant plants

[0062] The rice seeds of WT, OsPYL5 overexpression and knockout mutant plants were soaked and germinated and cultured hydroponically in a plant growth chamber until the 4-leaf stage. Eight rice seedlings of the same growth were selected for each line, and each plant represented a replicate. The rice plant was inserted into the middle of a PVC sheet with holes drilled in it, and the rice stem was surrounded by a transparent plastic cover and sealed with a round sponge. 80 3-4-year-old brown planthopper nymphs were starved for 1 hour, and then all the brown planthopper nymphs were poured into a cup. After culturing at room temperature, the round sponge was removed after 7 days and the brown planthopper was sucked out with a sucking tube. The damage level of the rice plants in each cup was checked. The identification criteria are shown in Table 1.

[0063] After the rice plants with the average damage level were determined, the damage was determined and the rice plants were cut into slices, washed, dried at 110°C for 20 min, and then dried at 60°C to constant weight. The dry weight was measured using a precision electronic balance, and the functional plant loss index (FPLI) was calculated according to the method described by Chen Jianming et al. (2009).

[0064]

[0065] Table 1 Identification criteria for rice resistance to brown planthopper infestation

[0066] Damage level at seedling stage (level) IRRI Standards 0 No harm 1 The damage was minor 3 The first and second leaves of most plants turn yellow 5 The plants are obviously yellowing and dwarfing, or more than half of the plants are withering and dying. 7 More than half of the plants withered and died, and the rest were severely stunted and on the verge of death. 9 All plants died

[0067] Changes in egg laying, nymph mortality, survival rate, and honeydew yield after brown planthoppers fed on rice plants with OsPYL5 overexpression and knockout mutants

[0068] The 4th instar nymphs of brown planthoppers were released and raised on OsPYL5 knockout mutant and overexpression rice plants. A pair of brown planthoppers raised on transgenic rice were paired, and the paired adults were placed on overexpression and knockout mutant plants for experiments. The survival rate, mortality rate and egg laying amount were then recorded (a pair of male and female adults was a replicate, and each treatment had 15 replicates). The egg laying amount of brown planthoppers was continuously observed for 14 days using an optical microscope. The honeydew amount was recorded by Wu et al.

[0069] Example 5 Determination of the content of rice defense-related molecules and antibiotic substances

[0070] Flavonoid content detection: Take the sample after the brown planthopper infestation and dry it to constant weight. According to the method of the rice flavonoid extraction kit, take the supernatant for testing. Adjust the distilled water to zero. Add the reagents in Table 2 in sequence:

[0071] Table 2

[0072]

[0073] For the detection of hydrogen peroxide H2O2 content, take the tissue sample after the brown planthopper is damaged, and according to the method of the rice hydrogen peroxide extraction kit, take the supernatant and place it on ice for testing.

[0074] Table 3

[0075]

[0076] Malondialdehyde (MDA) content detection: Take tissue samples after brown planthopper infestation, and according to the method of the rice MDA content extraction kit, take the supernatant and place it on ice for testing. Determine the absorbance value at 532nm and 600nm, ΔA = A532-A600. Substitute it into the calculation formula.

[0077] For the detection of total phenols content, according to the instructions of the total phenols extraction kit of Suzhou Keming Biotechnology Co., Ltd., the supernatant was taken and the volume was made up to 2 mL with the extraction solution for testing. There were 3 biological replicates in each group.

[0078] Table 4

[0079]

[0080] Catalase (CAT) content detection: take tissue samples after being infested by brown planthoppers, extract the supernatant according to the method of the rice CAT content extraction kit, and place it on ice for detection.

[0081] Preheat the spectrophotometer for more than 30 minutes and adjust the wavelength to 405nm. Add the following reagents into the EP tube:

[0082] Table 5

[0083]

[0084] For the detection of superoxide dismutase (SOD) content, tissue samples after being infested by brown planthoppers were taken, and the supernatant was taken according to the method of the rice MDA content extraction kit, and placed on ice for detection.

[0085] Table 6

[0086] Reagent Name (μL) Determination tube Control tube Reagent 1 240 240 Reagent 2 6 6 sample 90 Distilled water 90 Reagent 3 180 180 Reagent 4 510 510

[0087] For the detection of polyphenol oxidase (PPO) content, tissue samples after being infested by brown planthoppers were taken, and the supernatant was taken for detection according to the method of the rice PPO content extraction kit.

[0088] Table 7

[0089] Reagent Name (μL) Determination tube Control tube sample 180 Boiled samples 180 Reagent 1 720 720 Reagent 2 180 Distilled water 180

[0090] Peroxidase (POD), take tissue samples after brown planthopper infestation, and record the absorbance value A1 at 1 minute and the absorbance value A2 at 2 minutes at 470nm according to the method of the rice POD content extraction kit (the time interval between A2 and A1 is 1 minute). Calculate ΔA=A2-A1.

[0091] Example 6 Data Analysis

[0092] One-way ANOVA was used for data analysis. All data are expressed as mean ± SEM. P ≤ 0.05 indicates significant difference (*), and P ≤ 0.01 indicates extremely significant difference (**). It can be clearly concluded from the results that ospyl5 reduces rice insect resistance and makes it more susceptible to brown planthoppers. Overexpression of OsPYL5 improves rice insect resistance, indicating that OsPYL5 is a key gene regulating rice resistance to brown planthoppers.

[0093] The above embodiments are descriptions of preferred embodiments of the present invention, and are not intended to limit the present invention. Without departing from the spirit or scope of the present invention, technical improvements and equivalent substitutions made by relevant technical personnel to the present invention are within the protection scope of the present invention.

Claims

1. A rice insect-resistant protein, characterized in that: The amino acid sequence is as shown in SEQ ID NO: 2, or an amino acid sequence with more than 95% homology to the amino acid sequence shown in SEQ ID NO: 2, and retains the function of rice insect resistance.

2. The gene encoding the protein of claim 1 OsPYL5 , characterized in that, A nucleic acid sequence having a nucleic acid sequence as shown in SEQ ID NO: 1, or a nucleic acid sequence having at least 95% homology with the nucleic acid sequence shown in SEQ ID NO: 1, and being able to encode and regulate rice insect-resistant protein.

3. A vector for rice genetic transformation, characterized in that: The vector comprises a gene OsPYL5 encoding a protein having an amino acid sequence shown in SEQ ID NO: 2 or at least 95% homology thereof and retaining insect-resistant function, and necessary regulatory elements, and is used for expressing the gene in rice cells.

4. Use of the gene according to claim 2 as a positive regulator in regulating rice resistance to brown planthoppers.

5. A method for improving rice resistance to brown planthoppers, characterized in that: The method comprises the step of increasing the expression of the protein according to claim 1.

6. A method for breeding rice varieties resistant to brown planthoppers, characterized in that: The method comprises screening out plants with enhanced expression of the gene according to claim 2.

7. A kit for detecting the presence or expression level of the protein according to claim 1 in rice, characterized in that: It comprises an antibody that specifically recognizes the protein or a probe that specifically binds to the gene.

8. Use of the protein according to claim 1 as a detection marker in the preparation of a biological agent for detecting the ability of rice to resist brown planthoppers.

9. Use of the gene according to claim 2 as a detection marker in the preparation of transgenic rice or biological agents for detecting the ability of rice to resist brown planthoppers.

Images