Rice OsLRG2 gene and its application in rice blast resistance
By cloning and applying the rice OsLRG2 gene and constructing a recombinant vector using CRISPR/Cas9 technology, the problems of narrow resistance spectrum and insufficient stability of existing rice blast resistance genes were solved, and broad-spectrum resistance and enhanced stability of rice against rice blast were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-09
- Publication Date
- 2026-04-03
AI Technical Summary
Existing rice blast resistance genes have problems such as narrow resistance spectrum and insufficient stability, making it difficult to meet the rapid mutation and evolutionary capacity of rice blast, which increases the complexity of breeding work.
The rice OsLRG2 gene was cloned and applied. A recombinant vector was constructed using CRISPR/Cas9 technology, and the gene was knocked out to obtain the OsLRG2 gene knockout mutant. Its tolerance to rice blast fungus was observed to verify its disease resistance.
The OsLRG2 gene significantly improves rice resistance to rice blast, broadens the resistance spectrum, and enhances the effectiveness and stability of breeding.
Smart Images

Figure CN119752942B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to rice. OsLRG2 Genes and their application in rice blast resistance. Background Technology
[0002] Rice ( Oryza sativa Rice (L.) is one of the world's most important food crops, providing a primary food source for more than half of the world's population. However, with the intensification of global climate change and the large-scale outbreak of natural diseases, rice production faces unprecedented challenges. This is especially true for rice blast fungi (L.). Magnaporthe oryzae Rice blast, caused by *Strombus haematous*, is known as the "cancer" of rice cultivation, posing a serious threat to rice yield and quality. It can infect rice at multiple stages of its growth, including leaves, stems, and spikelets, and in severe cases can lead to yield losses of up to 80% or even total crop failure. Although the damage caused by rice blast has been mitigated through agronomic management, chemical control, and the promotion of resistant varieties, its rapid mutation and evolutionary capabilities limit the lifespan of existing resistant varieties, making it difficult to meet production demands. Breeding resistant varieties is considered the most economical, environmentally friendly, and efficient strategy for rice blast control. However, the key to resistant breeding lies in the discovery and utilization of resistance genes. To date, more than 100 loci related to rice blast resistance have been located in the rice genome, but only about 30 resistance genes have been cloned, and most of them suffer from narrow resistance spectrums and insufficient stability. The high variability of *Strombus haematous* further complicates breeding efforts. Therefore, discovering and applying new genes with broad-spectrum and durable resistance to rice blast has become the core task of rice resistance breeding research. Summary of the Invention
[0003] The purpose of this invention is to provide rice OsLRG2 The study aims to investigate the genes and their application in rice blast resistance, thereby addressing the deficiencies in existing rice blast resistance genes and applying them to rice breeding to improve rice disease resistance, especially resistance to rice blast. This will provide important genetic resources for the green control of rice blast through resistance breeding.
[0004] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0005] This invention proposes a rice blast resistance gene. OsLRG2 Its nucleotide sequence is shown in SEQ ID NO.1.
[0006] Furthermore, the rice blast resistance gene... OsLRG2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.
[0007] This invention also provides a novel rice blast resistance gene containing the above-mentioned gene. OsLRG2 Recombinant vectors and recombinant engineered bacteria.
[0008] This invention also provides the above-mentioned rice blast resistance gene. OsLRG2 Application in the prevention and control of rice blast disease.
[0009] This invention also provides the above-mentioned rice blast resistance gene. OsLRG2 Application in inducing tobacco hypersensitivity reactions.
[0010] This invention also provides a novel gene for rice resistance to rice blast. OsLRG2 The functional identification method includes the following steps:
[0011] S1: Introducing a new gene for rice resistance to rice blast. OsLRG2 The expression vector was cloned into the pYLCRISPR / Cas9Pubi-H vector.
[0012] S2: The expression vector was transformed into rice using Agrobacterium-mediated transformation to obtain... OsLRG2 Gene knockout mutant plants;
[0013] S3: Will OsLRG2 After the seeds of gene knockout mutant plants were cultured to the three-leaf stage, they were inoculated with a spore suspension of rice blast fungus. After 7 days of culture, the leaf lesion area was observed, recorded, and analyzed.
[0014] Furthermore, S1 specifically includes the following steps:
[0015] Reference sequencing OsLRG2 The sequence was obtained, and the knockout target was predicted using CRISPR-P online analysis software;
[0016] After designing target primers, the target fragment was amplified. After confirming the target band, the amplified fragment was recovered. The recovered fragment was ligated into the pYLCRISPR / Cas9Pubi-H expression vector via Goldden Gate cloning and transformed into E. coli DH5α.
[0017] Furthermore, the target primers include:
[0018] OsLRG2-TF, the sequence of which is shown in SEQ ID NO.5; and OsLRG2-TR, the sequence of which is shown in SEQ ID NO.6.
[0019] Furthermore, S2 also includes... OsLRG2 Molecular identification of DNA from gene knockout mutant plants;
[0020] Molecular identification methods specifically include the following steps:
[0021] Hygromycin primers hygF and hygR were designed, and a segment of the hygromycin gene in the gene knockout mutant plants was amplified. A 1035bp fragment was amplified, resulting in a positive plant.
[0022] Seeds from positive plants were collected, and DNA was extracted from young leaves after sowing to detect mutations at target sites.
[0023] Primers OsLRG2-LF and OsLRG2-LR, which contain target site fragment PCR, were designed to amplify an 808bp fragment for sequencing analysis. Plants with frameshift mutations were identified as homozygous knockout plants, and their offspring were identified as homozygous Cas9 knockout mutant plants.
[0024] The sequence of hygF is shown in SEQ ID NO.7, the sequence of hygR is shown in SEQ ID NO.8; the sequence of OsLRG2-LF is shown in SEQ ID NO.9, and the sequence of OsLRG2-LR is shown in SEQ ID NO.10.
[0025] Furthermore, after inoculating S3 with a spore suspension of rice blast fungus and culturing for 7 days, the area of leaf lesions was observed, recorded, and analyzed. The specific steps were as follows:
[0026] Inoculation was performed using a high-pressure atomizer at a spray depth of 1.0 × 10⁻� 5 ~2.0×10 5 A spore suspension of *Magnapordica oryzae* at a concentration of 100 spores / mL was cultured in an inoculation room for 7 days. Leaf lesions were then observed (based on the second young leaf), photographed, and the lesion area was analyzed using ImageJ software.
[0027] The beneficial effects of this invention are as follows:
[0028] The novel rice blast resistance gene of this invention OsLRG2 This is the first protein cloned from rice, with a CDS length of 2742 bp encoding a 914-amino acid protein. Online CDD analysis revealed that the protein possesses CC, NB-ARC, and LRR domains, classifying it as a typical NBS-LRR protein. Comparison of the tolerance of rice Cas9 knockout mutants and wild-type rice to rice blast fungus showed... OsLRG2 Genes can enhance rice's resistance to rice blast. Applying them to the field of genetic engineering has significant economic value and promising prospects. Attached Figure Description
[0029] Figure 1 As in Embodiment 1 of the present invention OsLRG2 Electrophoresis image of PCR products on an agarose gel.
[0030] Figure 2 As in Embodiment 1 of the present invention OsLRG2 Predicted map of conserved domains of gene-encoded proteins.
[0031] Figure 3 The image shows agarose gel electrophoresis results of target fragment amplification (A) and positive colony detection (B) during the construction of the pYLCRISPR / Cas9Pubi-H-OsLRG2 vector in Example 2 of this invention.
[0032] Figure 4 This is a flowchart of Agrobacterium-mediated rice genetic transformation in Example 3 of the present invention.
[0033] Figure 5 The image shows a mutation detection diagram of the DNA target site in the young leaves of T0-positive transgenic plants in Example 3.
[0034] Figure 6 This is Example 4 of the present invention. OsLRG2 Comparison of leaf area (A) and leaf lesion area (B) of mutant plants and wild-type rice 7 days after inoculation with rice blast fungus.
[0035] Figure 7 This is Example 5 of the present invention. OsLRG2 The results of transient expression of the gene and its mutant genes (M-1 and M-2) in tobacco inducing tobacco hypersensitivity. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.
[0037] In the following embodiments, a new gene for rice resistance to rice blast is introduced. OsLRG2 Abbreviated as OsLRG2 .
[0038] Example 1
[0039] This embodiment provides a method for cloning a novel rice blast resistance gene, OsLRG2, including the following steps:
[0040] (1) Preparation of materials
[0041] Rice varietal materials and Escherichia coli DH5α (Takara 9057). Among them, rice varietal ZH11 was used for RNA extraction and was provided by Wuhan Boyuan Biotechnology Co., Ltd.
[0042] (2) New genes for rice resistance to rice blast OsLRG2 Cloning and transformation
[0043] according to OsLRG2The annotation information is as follows: its full length is 2742bp. A pair of specific primers was designed using Primer 5.0, and their nucleotide sequences are as follows:
[0044] OsLRG2-F: ATGGCAGAAGCTGTGCTGCT (SEQ ID NO.3);
[0045] OsLRG2-R: TCACCACCCTACATGGATCTCT (SEQ ID NO. 4).
[0046] Total RNA was extracted from three-leaf stage rice seedlings using the Trizol reagent method and reverse transcribed into cDNA, which was then used as a template for PCR. Amplification was performed using Vazyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China). OsLRG2 The PCR reaction system for the gene is shown in Table 1, with a total volume of 50 μL. The PCR reaction procedure is as follows:
[0047] Pre-denaturation at 95℃ for 3 min → (denaturation at 95℃ for 30 s → annealing at 58℃ for 15 s → extension at 72℃ for 30 s) × 30 cycles → complete extension at 65℃ for 5 min → storage at 4℃.
[0048] PCR products were detected and purified by 1% agarose gel electrophoresis (e.g.) Figure 1 (As shown), the bacterial culture was then treated with DNA A-Tailing Kit (Takara 6109) and TA cloned using the pMD18-T vector. Three positive clones were selected for sequencing. The cloned novel rice blast resistance gene was obtained. OsLRG2 The full length is 2742 bp. Analysis and prediction of protein domains using the CDD online program revealed that the OsLRG2 protein possesses CC, NB-ARC, and LRR domains, belonging to the typical NBS-LRR class of proteins (e.g., ...). Figure 2 (As shown).
[0049] Table 1. PCR reaction system for amplifying the OsLRG2 gene.
[0050]
[0051] Example 2
[0052] This embodiment provides a method for constructing the pYLCRISPR / Cas9Pubi-H-OsLRG2 vector, including the following steps:
[0053] (1) Material preparation: OsLRG2Knockout mutant materials and their wild rice varieties, Cas9 knockout vector: pYLCRISPR / Cas9Pubi-H, Agrobacterium EHA105. All vectors were purchased from Wuhan Boyuan Biotechnology Co., Ltd. Agrobacterium EHA105 was available from Shanghai Weidi Biotechnology Co., Ltd.
[0054] (2) Reference sequencing OsLRG2 The sequence was obtained using CRISPR-P (http: / / cbi.hzau.edu).
[0055] The online analysis software (cn / cgi-bin / CRISPR) predicts knockout targets and designs target primers.
[0056] OsLRG2-TF (SEQ ID NO.5): cagtGGTCTCaTGCAAGTCAGTCCGCTCATACCCATGGGTTTTAGAGCTAGAAATAGC;
[0057] OsLRG2-TR (SEQ ID NO. 6): cagtGGTCTCaAAACCCAGTACCGCACAAGGCTCTCACTGCACCAGCCGGGAATCGAA;
[0058] (3) Subsequently, the target adapter amplification reaction was performed. The PCR reaction conditions were: 98℃ pre-denaturation for 3 min → (98℃ denaturation for 15 s → 55℃ annealing for 15 s → 72℃ extension for 30 s) × 25 cycles → 72℃ complete extension for 5 min → storage at 4℃. The reaction system is shown in Table 2.
[0059] Table 2 Dual-target fragment amplification reaction system
[0060]
[0061] (4) Detect the PCR products using 1% agarose gel electrophoresis (e.g., Figure 3 (As shown in A), after confirming the target band, the amplified fragment was recovered (gel recovery product). The recovered fragment was ligated into the pYLCRISPR / Cas9Pubi-H expression vector using Goldden Gate cloning to obtain pYLCRISPR / Cas9Pubi-H-OsLRG2. Reaction conditions: incubation at 37℃ for 30-60 min, followed by termination at 65℃ for 20 min. The reaction system is shown in Table 3.
[0062] Table 3. Reaction system for Goldden Gate cloning
[0063]
[0064] (5) Subsequently, the ligation product was transformed into Escherichia coli DH5α, positive clones were picked for colony PCR, and the PCR products were detected by 1% agarose gel electrophoresis (e.g. Figure 3 (As shown in B), select clear and bright double-banded bacterial solutions for sequencing. After successful alignment, extract plasmids using the TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 (9760) and transform them into Agrobacterium EHA105. Select positive clones and store them at -80℃ for later use.
[0065] Example 3
[0066] This embodiment provides an Agrobacterium-mediated rice genetic transformation method (rice genetic transformation flowchart as shown below). Figure 4 (As shown), including the following steps:
[0067] Take 1000 mature rice seeds, remove the husks, disinfect by soaking in 2.5% sodium hypochlorite for 30 min, wash 5 times with sterile water, and inoculate the disinfected seeds into callus induction medium, and culture at 28℃ under light for 7 days; culture Agrobacterium EHA105 containing the target vector (pYLCRISPR / Cas9Pubi-H-OsLRG2) in YEB medium (50 mg / L kanamycin, 50 mg / L rifampin) until OD600 = 0.5, centrifuge at 4000 rpm for 10 min to collect the bacterial pellet, resuspend the bacterial cells in AAM medium (100 μM acetylsyl syringone) to prepare an engineered bacterial suspension with OD600 = 0.2, and place on ice for 1 h; then inoculate the rice callus... The callus tissue was immersed in the engineered bacterial solution for 10 min, the surface bacterial solution was blotted dry with sterile filter paper, and then inoculated onto a co-culture medium and cultured in the dark at 25℃ for 3 days. The infected callus tissue was then immersed in a 500 mg / L carbenicillin solution for 15 min, repeated twice. The surface moisture of the callus tissue was blotted dry with filter paper, and then inoculated onto a selection medium and cultured under light at 28℃. The newly grown resistant callus tissue blocks were subcultured onto a shoot induction medium and cultured under light at 30℃ for 1–2 weeks until adventitious shoots emerged. The adventitious shoots were then subcultured onto a rooting medium and cultured under light at 30℃ for 1–2 weeks until the seedlings had developed most of their adventitious roots. The rooted seedlings were removed, the medium was washed off, and the roots were immersed in sterile water for 3–7 days to harden them off before transplanting them to the field or greenhouse. The culture medium formula required for genetic transformation is as follows:
[0068] Callus induction medium: 24.1g N6 medium + 300mg / L hydrolyzed casein + 2.878g / L proline + 100mg / L inositol + 2mg / L 2,4-D + 30g sucrose + 8g plant gel, pH = 5.8;
[0069] Co-culture medium: 24.1g N6 medium + 2mg / L 2,4-D + 300mg / L hydrolyzed casein + 100mg / L inositol + 10g / L glucose + 30g sucrose + 100μM acetosyringone (AS) + 10g plant gel, pH = 5.2;
[0070] Screening medium: 24.1g N6 medium + 2mg / L 2,4-D + 300mg / L hydrolyzed casein + 2.878g / L proline + 100mg / L inositol + 30g sucrose + 300mg / L termethin (TIM) + 50mg / L hygromycin + 50mg / L Kan + 8g plant gel, pH = 5.8.
[0071] Predifferentiation medium: 24.1g N6 medium + 30g sucrose + 30g sorbitol + 2g / L hydrolyzed casein 0.02mg / L NAA + 2mg / L kinetin + 50mg / mL hygromycin + 50mg / L Kan + 8g plant gel, pH 5.8;
[0072] Rooting medium: MS medium + 30g glucose, pH= 7.2.
[0073] DNA was extracted from the transformed plants for molecular identification. Hygromycin primers hygF (CCGGAAGTGCTTGACATTGG, SEQ ID NO.7) and hygR (GCCGAATTAATTCGGGG, SEQ ID NO.8) were designed to amplify a segment of the hygromycin gene in the transgenic plants. Plants that amplified a 1035 bp fragment were considered positive. Seeds from T0 positive transgenic plants were collected, and DNA was extracted from young leaves after sowing for target site mutation detection. The primers for target site PCR were:
[0074] OsLRG2-LF:ACTGGGAAAAACCACCCTGG (SEQ ID NO.9);
[0075] OsLRG2-LR:TTCGGCCACATCTTCTGGTC (SEQ ID NO.10), an 808bp fragment was amplified and sequenced.
[0076] like Figure 5 As shown in the figure, the frameshift mutation plants are homozygous knockout plants, namely the seeds of rice M-1 and M-2. OsLRG2 A homozygous Cas9 knockout mutant of the gene.
[0077] Example 4
[0078] This embodiment provides the identification of rice blast resistance in rice Cas9 knockout mutants, including the following steps:
[0079] (1) Take the mutants (M-1, M-2) and wild-type rice seeds obtained in Example 3, soak them in water, and germinate them in a 30℃ incubator for 2-3 days. Then, sow the germinated rice seeds in small flower pots (10cm in diameter) filled with soil, 8-10 seeds per pot, and set up 3 replicates for each treatment. Cultivate the rice seedlings in a greenhouse with a light intensity of 10000Lx, a photoperiod of 14h light / 10h darkness, and 28℃ until the rice grows to three leaves and one heart or four leaves and one heart.
[0080] (2) The activated rice blast fungus was cultured in the dark on rice bran medium (20 g / L rice bran, 40 g / L agarose, pH=6.5) for 8-10 days until the mycelium covered the culture dish. A layer of mycelium was scraped off from the surface of the medium, and the fungus was cultured under 60% light for 3-5 days to induce spore production. Then, the scraped rice bran plate was washed with 3-5 mL of sterile water containing 0.02% Tween-20. The washing solution was filtered through a single layer of lens paper, and the filtrate was counted using a cell counting chamber to achieve a final spore suspension concentration of 1.0 × 10⁻⁶. 5 ~2.0×10 5 The diluted spore suspension was evenly sprayed onto rice leaves using a high-pressure atomizer, with 15 mL of spore suspension sprayed onto each leaf. The inoculated seedlings were then placed in an inoculation room at 26°C and humidity above 90% for 24 hours in the dark. Afterward, the photoperiod was changed to 12 hours of light / 12 hours of darkness, and the seedlings were cultured for another 7 days.
[0081] Figure 6 This is Example 4 of the present invention. OsLRG2 A comparison of leaves and leaf lesion area 7 days after inoculation of gene mutant plants and wild-type rice (WT) with rice blast fungus. From Figure 6 As can be seen from A, OsLRG2 The mutants (M-1, M-2) exhibited severe leaf disease, with typical spindle-shaped lesions characterized by a white central spot, brown edges, and a pale yellow halo; some lesions were quite large. Wild-type rice leaves did not show lesions. ImageJ software was used to analyze the lesion area on leaves of the OsLRG2 gene mutants and wild-type rice 7 days after inoculation with *Oryza sativa*. Figure 6 As shown in Figure B, the wild type has no obvious lesions, and the lesion area is the smallest, with a disease grade of 1 (resistant). Both mutants have lesion areas between 30% and 40%, and both have a disease grade of 4, indicating... OsLRG2 Gene mutation caused wild-type rice to change from resistant to susceptible, confirming that... OsLRG2 Genes can enhance rice's resistance to blast disease.
[0082] Example 5
[0083] This embodiment provides a method for observing the cell death induced in tobacco leaves by transient expression of resistance genes. It includes the following steps:
[0084] (1) Following the method in Example 1, OsLRG2 The sequences of the gene and its mutants (M-1, M-2) were ligated into the pCAMBIA3301-GFP vector to obtain recombinant plasmids, which were then transformed into Agrobacterium GV3101 competent cells. Adapter primers were designed:
[0085] OsLRG2-GFP-F: cgagctcggtacccgggatccATGGCAGAAGCTGTGCTGCT (SEQ ID NO. 11);
[0086] OsLRG2-GFP-R: gctcaccattctagaggatccTCACCACCCTACATGGATCTCT (SEQ IDNO.12);
[0087] M1-GFP-F: cgagctcggtacccgggatccATGGCAGAAGCTGTGCTGCT (SEQ ID NO. 13);
[0088] M1-GFP-R: gctcaccattctagaggatccCTATTGTGTTCGATTCTCACCG (SEQ ID NO. 14);
[0089] M2-GFP-F: cgagctcggtacccgggatccATGGCAGAAGCTGTGCTGCT (SEQ ID NO. 15);
[0090] M2-GFP-R: gctcaccattctagaggatccCTATTGTGTTCGATTCTCACCG (SEQ ID NO. 16).
[0091] (2) Single colonies were activated by shaking in liquid YEP medium (50 mg / L kanamycin, 50 mg / L rifampin) and cultured overnight at 28°C and 200 rpm. The activated GV3101 cells were then inoculated into the corresponding liquid YEP medium at a ratio of 1:50 and cultured at 28°C and 200 rpm for approximately 12 h. Subsequently, the cells were collected by centrifugation at 28°C and 5000 rpm for 10 min. The cells were washed twice with injection buffer (10 mM MES (pH=5.6) + 10 mM MgCl2) and resuspended with injection buffer until the OD600 of the bacterial culture reached 1.0. The culture was then incubated horizontally at 28°C for 3-4 h.
[0092] (3) Select a few healthy tobacco leaves (about 4 weeks old), and use a 1mL medical syringe with the needle removed to slowly inject the bacterial solution between the upper and lower epidermis of the tobacco leaf on the far-axis surface of the tobacco leaf, making each injection area as circular as possible (1-2 cm). Incubate in the dark at 25℃ for 2-3 days, observe whether the leaves show symptoms of hypersensitivity reaction, and take pictures.
[0093] Figure 7 This is Example 5 of the present invention. OsLRG2 The results of transient expression of OsLRG2 and its mutant genes (M-1 and M-2) in tobacco inducing tobacco hypersensitivity are shown in the figure, with the empty vector GFP as a control. At 48 h, strong cell death was observed in tobacco leaves triggered by OsLRG2, while no significant cell death was observed in tobacco leaves infiltrated by Agrobacterium strains containing mutants (M-1 and M-2), indicating that… OsLRG2 It can trigger an allergic reaction and cell death in tobacco leaves.
[0094] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. New genes for rice resistance to rice blast OsLRG2 Its application in inducing tobacco hypersensitivity reactions is characterized by: Its nucleotide sequence is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that: The novel gene for rice resistance to rice blast OsLRG2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.
2.
3. New genes for rice resistance to rice blast OsLRG2 Its application in the control of rice blast disease is characterized by: Its nucleotide sequence is as shown in SEQ ID NO.1, knockout OsLRG2 Genes reduce rice's resistance to rice blast fungus.