A PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood and sputum specimens

Abstract

The invention provides a PCR template amplification method for improving the sensitivity of mycobacterium blood sample and sputum sample detection and identification, which relates to the technical field of biological detection and comprises the following steps: S1: preparing a PCR template from a sample to be detected; S2: selecting a gene conservative region sequence of the 16srRNA 3' end and the 23srRNA 5' end of the mycobacterium, and designing template amplification primers Mp1 and Mp2; S3: performing PCR template amplification for real-time fluorescence PCR detection and identification of the mycobacterium through the Mp1 and Mp2 primers. The present invention prepares a PCR template for a sputum sample or a blood sample, then uses Mp1 and Mp2 as primers to perform template amplification, and designs specific real-time fluorescent PCR primers and corresponding fluorescent labeling probes for each mycobacterium species according to the internal transcription spacer sequence of the 16s-23s rRNA gene of the mycobacterium genus, and performs real-time fluorescent PCR detection and identification with the amplified template, thereby improving the detection positive rates of mycobacterium tuberculosis and non-tuberculous mycobacteria at the same time. Due to the improvement of the detection sensitivity, it is more advantageous to detect blood samples, and more effective and reliable specimen selection and high-sensitivity experimental methods are provided for studying mycobacterium infection including mycobacterium tuberculosis.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a real-time fluorescent PCR template amplification method for improving the sensitivity of detection and identification of mycobacterium blood specimens and sputum specimens. Background Art

[0002] Mycobacterium includes Mycobacterium tuberculosis and dozens of other mycobacteria (collectively referred to as non-tuberculous mycobacteria). The mycobacteria associated with human diseases are mainly Mycobacterium tuberculosis and more than a dozen non-tuberculous mycobacteria, such as Mycobacterium avium, Mycobacterium gordonii, etc.

[0003] The current mainstream real-time fluorescence PCR detection method is represented by the GeneXpert detector in the United States. The sensitivity of this method is only about 40% positive rate, and it can only detect Mycobacterium tuberculosis, not non-tuberculous mycobacteria. GeneXpert mainly detects sputum samples of patients, and there are no confirmed positive reports of blood sample testing.

[0004] There are three shortcomings of the existing technology: first, the patient's lesions are not in the lungs (such as lymph node tuberculosis) or the lesions in the lungs are not serious (that is, the lesions are not ruptured and are not connected to the bronchus); there is no Mycobacterium tuberculosis in the sputum or the concentration is lower than its detection limit; second, there is low-energy pathogen DNA in the blood, but it is lower than the detection limit of the current real-time fluorescence PCR method; third, the GeneXpert detector cannot detect non-tuberculous mycobacteria. Summary of the invention

[0005] The object of the present invention is to provide a PCR template amplification method for improving the sensitivity of real-time fluorescence PCR detection and identification of mycobacterium blood specimens and sputum specimens for non-diagnostic purposes, so as to improve the sensitivity of real-time fluorescence PCR detection, especially the detection of blood specimens. For the case where the concentration of the target gene is extremely low, after improving the detection sensitivity, various mycobacterium infections can be successfully detected, thereby promoting the positive rate of mycobacterium infection detection.

[0006] The present invention is implemented by the following technical solution: comprising the following steps;

[0007] S1: Preparation of PCR template from the sample to be tested:

[0008] S2: Select the conserved region sequences of the 16s rRNA 3' end and 23s rRNA 5' end genes of Mycobacterium and design template amplification primers Mp1 and Mp2;

[0009] S3: PCR template amplification for real-time fluorescence PCR detection and identification of Mycobacterium spp. using primers Mp1 and Mp2.

[0010] In order to better realize the present invention, further,

[0011] The gene sequences of the Mp1 and Mp2 are as follows:

[0012] Mp1:GACGAAGTCGATTCAAGGTAG;

[0013] Mp2:GCAGCCTCGTTCGTCCTTC.

[0014] In order to better realize the present invention, further,

[0015] The sample to be tested is a blood sample and / or a sputum sample.

[0016] In order to better implement the present invention, further, the steps of preparing PCR template from sputum specimen are as follows:

[0017] Take a sputum specimen, add 4 times the volume of 4% sodium hydroxide solution, shake well, liquefy at room temperature for 25 to 35 minutes, take 1 to 1.5 mL, centrifuge at 13,000 rpm for 3 to 8 minutes, discard the supernatant, mix the precipitate with 1 mL of sterile saline, centrifuge at 15,000 rpm for 3 to 8 minutes, repeat washing 1 to 3 times, discard the supernatant, add 50 μL PBS to the precipitate, mix thoroughly and boil in water bath for 5 to 25 minutes, centrifuge at 13,000 rpm for 5 to 15 minutes, take 5 μL of sample and add it to the PCR tube.

[0018] In order to better implement the present invention, further, the steps of preparing PCR template from sputum specimen are as follows:

[0019] Take a sputum sample, add 4 times the volume of 4% sodium hydroxide solution, shake well, liquefy at room temperature for 30 minutes, take 1-1.5mL, centrifuge at 13000rpm for 5min, discard the supernatant, mix the precipitate with 1mL of sterile saline, centrifuge at 15000rpm for 5min, repeat washing once, discard the supernatant, add 50μL PBS to the precipitate, mix thoroughly and boil in water bath for 10-15min, centrifuge at 13000rpm for 10min, take 5μL sample and add it to the PCR tube.

[0020] In order to better implement the present invention, further, the steps of preparing PCR template from the blood sample are as follows:

[0021] 1. Add 500ul Trizol to 500ul plasma and store at -20℃ to start DNA extraction from step 2;

[0022] 2. Vortex for 30-90 seconds and centrifuge briefly;

[0023] 3. Add 160ul chloroform and vortex for 30 seconds;

[0024] 4. Spin at 14,000 rpm for 2 to 10 minutes to separate the phases;

[0025] 5. Transfer the upper aqueous phase to a 1.5 ml tube;

[0026] 6. Add 400ul of ice-cold isopropanol, mix by inversion 5 times, and let the sample precipitate overnight at -20℃;

[0027] 7. Pellet the RNA by spinning at 14,000 rpm for 10 to 25 minutes at RT and remove the supernatant.

[0028] 8. Wash the particles in 200ul-70% ethanol-RNase-free conditions, rotating at 14000rpm for 5-15 minutes;

[0029] 9. Remove the supernatant, removing as much as possible without disturbing the pellet;

[0030] 10. Air dry for 2 to 15 minutes;

[0031] 11. Solidify the particles in 20ul of RNase-free deionized water;

[0032] 12. Take 5ul as regular PCR template.

[0033] In order to better implement the present invention, further, the steps of preparing PCR template from the blood sample are as follows:

[0034] 1. Add 500ul Trizol to 500ul plasma and store at -20℃ to start DNA extraction from step 2;

[0035] 2. Vortex for 30-60 seconds and centrifuge briefly;

[0036] 3. Add 160ul chloroform and vortex for 30 seconds;

[0037] 4. Spin at 14,000 rpm for 5 minutes to separate the phases;

[0038] 5. Transfer the upper aqueous phase to a 1.5 ml tube;

[0039] 6. Add 400ul of ice-cold isopropanol, mix by inversion 5 times, and let the sample precipitate overnight at -20℃;

[0040] 7. Pellet the RNA by spinning at 14,000 rpm for 15 minutes at RT and remove the supernatant;

[0041] 8. Wash the particles in 200ul-70% ethanol-RNase-free conditions, rotating at 14000rpm for 10 minutes;

[0042] 9. Remove the supernatant, removing as much as possible without disturbing the pellet;

[0043] 10. Air dry for 8 minutes;

[0044] 11. Solidify the particles in 20ul of RNase-free deionized water;

[0045] 12. Take 5ul as regular PCR template.

[0046] In order to better realize the present invention, further,

[0047] The step S3 comprises the following steps:

[0048] The reaction system is 30 μl:

[0049] 15μl PCR mix, 1μl primers Mp1 and Mp2, 8μl H2O, 5μl template,

[0050] PCR amplification procedure:

[0051] Pre-denaturation at 94°C for 5 min; 40 cycles at 94°C for 30 s; maintain at 57°C for 15 s, maintain at 72°C for 30 s, and finally maintain at 72°C for 5 min.

[0052] The beneficial effects of the present invention are:

[0053] The invention prepares a PCR template for a sputum sample or a blood sample first, and specifically amplifies the template, then designs species-specific real-time fluorescence PCR detection primers and corresponding fluorescent labeling probes for each mycobacterium according to the internal transcription spacer sequence of the 16s-23s rRNA gene of the mycobacterium, and performs real-time fluorescence PCR detection and identification, thereby improving the sensitivity / positive rate of sputum sample and blood sample detection. The detection method provided by the invention improves the detection positive rate of the sputum sample to 60%, which is greatly improved compared with the prior art. At the same time, the blood sample can also be detected, and the detection positive rate is about 40%. Compared with the prior art where the real-time fluorescence PCR detection positive rate of the blood sample is basically zero, the invention has obvious outstanding progress and is more conducive to subsequent research. DETAILED DESCRIPTION

[0054] The technical solution of the present invention will be described below in conjunction with the embodiments of the present invention.

[0055] Embodiment 1:

[0056] Methods for improving identification sensitivity by PCR template amplification of sputum specimens:

[0057] S1: Preparation of PCR template from the sample to be tested:

[0058] The steps of preparing PCR template from sputum sample are as follows:

[0059] Take a sputum sample, add 4 times the volume of 4% sodium hydroxide solution, shake well, liquefy at room temperature for 30 minutes, take 1-1.5mL, centrifuge at 13000rpm for 5min, discard the supernatant, mix the precipitate with 1mL of sterile saline, centrifuge at 15000rpm for 5min, repeat washing once, discard the supernatant, add 50μL PBS to the precipitate, mix thoroughly and boil in water bath for 10-15min, centrifuge at 13000rpm for 10min, take 5μL sample and add it to the PCR tube.

[0060] S2: Select the conserved region sequences of the 16s rRNA 3' end and 23s rRNA 5' end genes of Mycobacterium and design template amplification primers Mp1 and Mp2;

[0061] The gene sequences of the Mp1 and Mp2 are as follows:

[0062] Mp1:GACGAAGTCGATTCAAGGTAG;

[0063] Mp2:GCAGCCTCGTTCGTCCTTC

[0064] S3: PCR template amplification for real-time fluorescence PCR detection and identification of Mycobacterium spp. using primers Mp1 and Mp2.

[0065] The reaction system is 30 μl:

[0066] 15μl PCR mix, 1μl primers Mp1 and Mp2, 8μl H2O, 5μl template,

[0067] PCR amplification procedure:

[0068] Pre-denaturation at 94°C for 5 min; 40 cycles at 94°C for 30 s; maintain at 57°C for 15 s, maintain at 72°C for 30 s, and finally maintain at 72°C for 5 min.

[0069] Embodiment 2:

[0070] Methods for improving identification sensitivity by PCR template amplification of blood samples:

[0071] S1: Preparation of PCR template from the sample to be tested:

[0072] The steps of preparing PCR template from blood sample are as follows:

[0073] 1. Add 500ul Trizol to 500ul plasma and store at -20℃ to start DNA extraction from step 2;

[0074] 2. Vortex for 30-60 seconds and centrifuge briefly;

[0075] 3. Add 160ul chloroform and vortex for 30 seconds;

[0076] 4. Spin at 14,000 rpm for 5 minutes to separate the phases;

[0077] 5. Transfer the upper aqueous phase to a 1.5 ml tube;

[0078] 6. Add 400ul of ice-cold isopropanol, mix by inversion 5 times, and let the sample precipitate overnight at -20℃;

[0079] 7. Pellet the RNA by spinning at 14,000 rpm for 15 minutes at RT and remove the supernatant;

[0080] 8. Wash the particles in 200ul-70% ethanol-RNase-free conditions, rotating at 14000rpm for 10 minutes;

[0081] 9. Remove the supernatant, removing as much as possible without disturbing the pellet;

[0082] 10. Air dry for 8 minutes;

[0083] 11. Solidify the particles in 20ul of RNase-free deionized water;

[0084] 12. Take 5ul as regular PCR template.

[0085] S2: Select the conserved region sequences of the 16s rRNA 3' end and 23s rRNA 5' end genes of Mycobacterium and design template amplification primers Mp1 and Mp2;

[0086] The gene sequences of the Mp1 and Mp2 are as follows:

[0087] Mp1:GACGAAGTCGATTCAAGGTAG;

[0088] Mp2:GCAGCCTCGTTCGTCCTTC.

[0089] S3: PCR template amplification for real-time fluorescence PCR detection and identification of Mycobacterium spp. using primers Mp1 and Mp2.

[0090] The reaction system is 30 μl:

[0091] 15μl PCR mix, 1μl primers Mp1 and Mp2, 8μl H2O, 5μl template,

[0092] PCR amplification procedure:

[0093] Pre-denaturation at 94°C for 5 min; 40 cycles at 94°C for 30 s; maintain at 57°C for 15 s, maintain at 72°C for 30 s, and finally maintain at 72°C for 5 min.

[0094] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A PCR template amplification method for improving the sensitivity of mycobacterium blood specimen and sputum specimen detection and identification, characterized in that: The steps include: S1: Preparation of PCR template from the sample to be tested: S2: Select the conserved region sequences of the 16s rRNA 3' end and 23s rRNA 5' end genes of Mycobacterium and design template amplification primers Mp1 and Mp2; S3: PCR template amplification for real-time fluorescence PCR detection and identification of Mycobacterium spp. using primers Mp1 and Mp2.

2. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 1, characterized in that: The gene sequences of the Mp1 and Mp2 are as follows: Mp1:GACGAAGTCGATTCAAGGTAG; Mp2:GCAGCCTCGTTCGTCCTTC.

3. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 1, characterized in that: The sample to be tested is a blood sample and / or a sputum sample.

4. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 3, characterized in that: The steps of preparing PCR template from sputum sample are as follows: Take a sputum specimen, add 4 times the volume of 4% sodium hydroxide solution, shake well, liquefy at room temperature for 25 to 35 minutes, take 1 to 1.5 mL, centrifuge at 13,000 rpm for 3 to 8 minutes, discard the supernatant, mix the precipitate with 1 mL of sterile saline, centrifuge at 15,000 rpm for 3 to 8 minutes, repeat washing 1 to 3 times, discard the supernatant, add 50 μL PBS to the precipitate, mix thoroughly and boil in water bath for 5 to 25 minutes, centrifuge at 13,000 rpm for 5 to 15 minutes, take 5 μL of sample and add it to the PCR tube.

5. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 4, characterized in that: The steps of preparing PCR template from sputum sample are as follows: Take a sputum sample, add 4 times the volume of 4% sodium hydroxide solution, shake well, liquefy at room temperature for 30 minutes, take 1-1.5mL, centrifuge at 13000rpm for 5min, discard the supernatant, mix the precipitate with 1mL of sterile saline, centrifuge at 15000rpm for 5min, repeat washing once, discard the supernatant, add 50μL PBS to the precipitate, mix thoroughly and boil in water bath for 10-15min, centrifuge at 13000rpm for 10min, take 5μL sample and add it to the PCR tube.

6. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 3, characterized in that: The steps of preparing PCR template from blood sample are as follows:

1. Add 500ul Trizol to 500ul plasma and store at -20℃; 2. Vortex for 30-90 seconds and centrifuge briefly; 3. Add 160ul chloroform and vortex for 30 seconds; 4. Spin at 14,000 rpm for 2 to 10 minutes to separate the phases; 5. Transfer the upper aqueous phase to a 1.5 ml tube; 6. Add 400ul of ice-cold isopropanol, mix by inversion 5 times, and let the sample precipitate overnight at -20℃; 7. Pellet the RNA by spinning at 14,000 rpm for 10 to 25 minutes at RT and remove the supernatant.

8. Wash the particles in 200ul-70% ethanol-RNase-free conditions, rotating at 14000rpm for 5-15 minutes; 9. Remove the supernatant, removing as much as possible without disturbing the pellet; 10. Air dry for 2 to 15 minutes; 11. Solidify the particles in 20ul of RNase-free deionized water; 12. Take 5ul as regular PCR template.

7. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 6, characterized in that: The steps of preparing PCR template from blood sample are as follows:

1. Add 500ul Trizol to 500ul plasma and store at -20℃ to start DNA extraction from step 2; 2. Vortex for 30-60 seconds and centrifuge briefly; 3. Add 160ul chloroform and vortex for 30 seconds; 4. Spin at 14,000 rpm for 5 minutes to separate the phases; 5. Transfer the upper aqueous phase to a 1.5 ml tube; 6. Add 400ul of ice-cold isopropanol, mix by inversion 5 times, and let the sample precipitate overnight at -20℃; 7. Pellet the RNA by spinning at 14,000 rpm for 15 minutes at RT and remove the supernatant; 8. Wash the particles in 200ul-70% ethanol-RNase-free conditions, rotating at 14000rpm for 10 minutes; 9. Remove the supernatant, removing as much as possible without disturbing the pellet; 10. Air dry for 8 minutes; 11. Solidify the particles in 20ul of RNase-free deionized water; 12. Take 5ul as regular PCR template.

8. The PCR template amplification method for improving the sensitivity of detection and identification of mycobacteria in blood specimens and sputum specimens according to claim 3, characterized in that: The step S3 comprises the following steps: The reaction system is 30 μl: 15μl PCR mix, 1μl primers Mp1 and Mp2, 8μl H2O, 5μl template, PCR amplification procedure: Pre-denaturation at 94°C for 5 min; 40 cycles at 94°C for 30 s; maintain at 57°C for 15 s, maintain at 72°C for 30 s, and finally maintain at 72°C for 5 min.