HBA and HBB mutation detection system and method for non-disease diagnosis purpose

Abstract

The invention relates to the technical field of gene detection, in particular to an HBA and HBB mutation detection system and a non-disease diagnosis purpose method. The system comprises a collection module used for collecting peripheral blood of a to-be-detected person and extracting and breaking high molecular weight DNA, a Y-shaped pre-library preparation module used for conducting end repair and joint connection on fragmented DNA to construct a Y-shaped pre-library, and a targeted enrichment module used for conducting hybridization and targeted enrichment on target genes through a target area capture probe. The single-molecule real-time sequencing library construction module is used for carrying out three-generation sequencing linker connection to obtain a single-molecule real-time sequencing library, and the single-molecule real-time sequencing analysis module is used for carrying out single-molecule real-time sequencing to obtain sequencing data of a target area, and carrying out disassembly and analysis on the sequencing data of the target area to obtain HBA and HBB variation types; the detection result is accurate, and mutation of HBA1 / HBA2 can be distinguished.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to an HBA and HBB mutation detection system and a method for non-disease diagnosis purposes. Background Art

[0002] Thalassemia is a common hereditary anemia with high morbidity and mortality worldwide, especially in Southeast Asia, the Middle East, and the Mediterranean region. α-Thalassemia and β-Thalassemia are the two main types of thalassemia caused by mutations in the HBA1 / 2 and HBB genes, resulting in abnormal α and β globin synthesis and hemoglobin structural defects, respectively.

[0003] Because of the complexity of the HBA locus and the need for the HBA and HBB genes, it is very challenging to perform a joint analysis for the molecular diagnosis of different stages of thalassemia carriers (silent, mild and moderate) and disease states. The HBA locus contains two essentially identical genes, HBA1 and HBA2, which encode the α-hemoglobin chain. The loss of part or all of the function of the HBA1 and HBA2 genes causes α-thalassemia, which is the most common genetic mutation. Including large fragment deletions -THAI, -FIL, -MED and -SEA and small fragment deletions -a 3.7 and -a 4.2 Based on the Ithanet, HbVar, LOVD, and LOVD-China thalassemia databases, about 50 deletions in the α-globin gene cluster region and more than 900 non-deletion mutations in the HBA1 and HBA2 genes have been found worldwide, which can lead to reduced or absent α-globin expression. In addition, there are some rare structural variations, such as ααα anti3.7 , ααα anti4.2 , HKαα and antiHKαα, etc. Relatively speaking, β-thalassemia is simpler, encoding only a single HBB gene for the b-hemoglobin chain. The main genetic lesions found in the HBB gene are mainly single nucleotide variants (SNVs), insertions and deletions. To date, more than 200 pathogenic variants have been identified worldwide.

[0004] Molecular diagnostic methods can effectively detect mutations in HBA1 / 2 and HBB genes. There are currently a variety of molecular diagnostic methods for HBA1 / 2 and HBB genes, such as gap-PCR, PCR reverse dot hybridization (PCR-RDB), PCR oligonucleotide probe method (PCR-ASO), and next-generation sequencing (NGS) technology. However, the current traditional detection methods are not only cumbersome to operate, but also cannot accurately detect complex structural variations, such as being unable to distinguish between HKαα and -α 3.7, and cannot distinguish between antiHKαα and -α 4.2 At the same time, it is difficult to detect all mutation types of HBA and HBB at the same time, especially uncommon mutation types. In addition, some patients will have two HBA and HBB gene mutations at the same time, and these traditional detection methods cannot detect whether the two mutations are linked. Although some detection methods have been derived based on the third-generation sequencing, such as using different primers to perform Long-PCR on the target fragment and then detect the target mutation, this type of method has the limitation that it can only detect known mutations, and PCR has preferences. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a HBA and HBB mutation detection system and a method for non-disease diagnosis purposes, so as to detect the complex variation types of the HBA gene and whether the two mutations of the HBA and HBB genes are linked.

[0006] In order to solve the above problems, the present invention adopts the following technical solutions:

[0007] In one aspect, the present invention provides an HBA and HBB mutation detection system, comprising an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module, and a single-molecule real-time sequencing analysis module;

[0008] The collection module is used to collect peripheral blood from the subject to be tested and to extract and shear high molecular weight DNA;

[0009] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, and perform Y-shaped adapter connection, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0010] The targeted enrichment module is used to hybridize and target-enrich the target gene using the target region capture probe according to the Y-shaped pre-library to obtain a capture library;

[0011] The single-molecule real-time sequencing library construction module is used to perform sequencing adapter connection according to the captured library to obtain a single-molecule real-time sequencing library;

[0012] The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of a target region, decompose the sequencing data of the target region, and analyze the variation types of HBA and HBB.

[0013] Further, the target region capture range of the target region capture probe labeled with biotin is: HBA1: chr16: 203679-207521, HBA2: chr16: 202875-203709 and HBB: chr11: 5226694-5228301;

[0014] The nucleotide sequences of the target region capture probes labeled with biotin are shown in SEQ ID No: 1-SEQ ID No232.

[0015] In another aspect, the present invention provides a method for detecting HBA and HBB mutations for non-disease diagnosis purposes, comprising:

[0016] Collect peripheral blood from the subjects and perform high molecular weight DNA extraction and shearing;

[0017] The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation is performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library;

[0018] Based on the Y-shaped pre-library, the target region capture probe is used to hybridize and target enrich the target gene to obtain a capture library;

[0019] According to the captured library, the sequencing adapter is connected to obtain a single-molecule real-time sequencing library;

[0020] Single-molecule real-time sequencing was performed using a single-molecule real-time sequencing library to obtain sequencing data of the target region, which was then decomposed to analyze the variation types of HBA and HBB.

[0021] The beneficial effects of the present invention are: the detection results are accurate. In addition to conventional detection, it can accurately distinguish mutations in HBA1 / HBA2 and accurately detect complex structural variations such as large fragment deletions and triplets. It can detect whether the two mutations of HBA and HBB genes are linked, and detect unknown mutations that have not been reported so far. The accuracy is high. PacBio's dumbbell-shaped library can be interpreted multiple times during sequencing. The base accuracy of the sequencing results after correction is greater than 99%. In addition, PacBio sequencing errors are random. The base accuracy is greater than 99.9% after sequencing depth correction, and the gene mutations within the primer detection range can be accurately interpreted. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a quality inspection diagram of the fragment length distribution of the captured library of the present invention; wherein, LM20 indicates that the DNA in the quality inspection marker is a band of 20 bp in size, and LM1000 indicates that the DNA in the quality inspection marker is a band of 1000 bp in size.

[0023] Figure 2 HBA of the present invention, -α 3.7 PacBio sequencing results of / αα gene mutation samples.

[0024] Figure 3 This is a graph showing the PacBio test results for the HBB gene mutation samples of the present invention. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with specific embodiments.

[0026] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention all fall within the scope of protection claimed by the present invention.

[0027] Example 1 Construction of HBA / HBB mutation detection process

[0028] 1. Collect 10 mL of peripheral blood from the patient using an EDTA anticoagulant tube.

[0029] 2. Extraction of genomic DNA.

[0030] The peripheral blood of the subjects to be tested was extracted using a special high molecular weight DNA extraction kit to obtain high molecular weight gDNA, and the concentration was measured and the integrity of the genomic DNA was detected by agarose gel electrophoresis.

[0031] 3. Fragmentation of high molecular weight gDNA

[0032] 3 μg of genomic DNA was taken and sheared by centrifugation using a Covaris g-tube tube at 6000 rpm for 2 min.

[0033] 4. Screening of fragmented DNA

[0034] (1) AmpureXP beads (Beckman, A63881) were diluted with 1 mM Tris-HCl pH 8 at 1×, 2×, 3× or 4× ratios.

[0035] (2) Mix the fragmented DNA to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3, or 1:4.

[0036] (3) Briefly centrifuge the tube to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0037] (4) Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, remove the 80% ethanol with a pipette.

[0038] (5) Eluting the cleaned magnetic beads to obtain fragmented DNA after fragment screening.

[0039] 5. Use the S3 cartridge for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. The proportion of fragments below 3 kbp should be less than 10%, otherwise it will be regarded as unqualified fragmented DNA.

[0040] 6. Preparation of pre-library

[0041] (1) Use a long fragment library construction kit to construct a long fragment Y-shaped pre-library. Dilute the purified fragmented DNA that has passed the quality inspection to 50 μL, and prepare the end repair and 3'A-tailing reactions according to Table 1.

[0042] Table 1 Preparation of end repair and 3'A-tailing reaction reagents

[0043]

[0044] Set up the PCR program according to Table 2 to perform end repair and 3'A-tailing reactions.

[0045] Table 2 End repair and 3'A-tailing reaction PCR program

[0046]

[0047] (2) Adapter ligation: Add the following components in order according to Table 3 to the end repair and 3'A-tailing reaction products.

[0048] Table 3 Connector connection reagents

[0049]

[0050] Vortex to mix, centrifuge briefly to ensure that all the solution is at the bottom of the tube, and immediately incubate in a PCR instrument at 20°C for 10 min, 20 min, 30 min, or 1 h with the heated lid set to 85°C.

[0051] Adapter sequence

[0052] A.ACACTCTTTCCCTACACGACGCTCTTCCGATC*T

[0053] BP-GATCGGAAGAGCACACGTCT

[0054] P: Phosphorylation*Phosphorylation

[0055] (3) Fragment screening of adapter ligation products

[0056] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at 1×, 2×, 3× or 4× ratios.

[0057] ② Mix the adapter-ligated product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3 or 1:4.

[0058] ③ Centrifuge the centrifuge tube momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0059] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0060] ⑤ Elute the cleaned magnetic beads to obtain the adapter connection product after fragment screening.

[0061] (3) The ligation product was subjected to long-fragment PCR amplification using a dedicated enzyme for long-fragment amplification, and the reaction system was configured according to Table 4; the dedicated enzyme for long-fragment amplification was Takara LA Taq DNA Polymerase Hot-Start Version (Takara, RR042A).

[0062] Table 4 Long fragment PCR amplification reagents

[0063]

[0064] Different tags can be single nucleotide sequences of lengths such as 8nt, 10nt, or 12nt.

[0065] Index primer sequence

[0066] Sequence 1:

[0067] CAAGCAGAAGACGGCATACGAGATNNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

[0068] Sequence 2:

[0069] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNAACACTCTTTCCCTACACGAGCTCTTCCGATCT.

[0070] N is any base of A, T, C or G.

[0071] Carry out PCR reaction according to Table 5.

[0072] Table 5 Long fragment PCR amplification program

[0073]

[0074] (4) The Y-shaped pre-library PCR products were screened for fragments, aiming to control short fragments below 3 kb to less than 10%.

[0075] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at 1×, 2×, 3× or 4× ratios.

[0076] ② Mix the Y-shaped pre-library PCR product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3 or 1:4.

[0077] ③ Centrifuge momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on the magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0078] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0079] ⑤ Elute the cleaned magnetic beads to obtain the Y-shaped pre-library PCR product after fragment screening.

[0080] ⑥ Use the S3 card holder for large fragment detection (Houze, c105106) to perform Qsep100 quality inspection on the Y-shaped pre-library PCR product after fragment screening. The proportion of fragments below 3kbp should be less than 10%, otherwise it will be regarded as an unqualified Y-shaped pre-library PCR product.

[0081] 7. Hybridization of the Y-shaped pre-library with the biotin-labeled double-stranded DNA probe

[0082] The components of the capture kit used in this example refer to patent ZL202011284834.1

[0083] (1) In this embodiment, the target gene region is shown in Table 6. The target gene region and the upstream and downstream extended 500bp-1.5kb sequence are extracted from the UCSC or NCBI database with the GRCh37 / hg19 gene sequence as the reference genome sequence. The probe is designed after removing the repeated region. 120bp is intercepted from the first base as the first probe sequence. At the same time, the density of the probe is adjusted according to the size of the GC content, wherein the HBA probe region is GRCh37 / hg19, chr16: 201565-208687; the HBB probe region is GRCh37 / hg19, chr11: 5225768-5229935. The capture probe used to enrich the target gene and the flanking region is a biotin-labeled DNA double-stranded probe, and the probe sequence table is shown in Table 7.

[0084] Table 6 Target area capture range table

[0085] Gene chromosome Starting Finish HBA1 chr16 203679 207521 HBA2 chr16 202875 203709 HBB chr11 5226694 5228301

[0086] Table 7 Probe sequence list

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101] (2) The hybridization reaction can be performed as a single hybrid or a multi-hybrid. For a multi-hybrid, multiple Y-shaped pre-libraries need to be mixed at equal molecular weights according to the following formula: fmol = (concentration * 10 6 ) / [650*length(bp)].

[0102] (3) Vacuum concentrate a single library or a mixed library of equal molecular weight to a dry powder state, and resuspend the library according to the components in Table 8.

[0103] Table 8 Library resuspension reagents

[0104]

[0105] (4) Denature the resuspended library and probe according to the PCR program in Table 9.

[0106] Table 9 Denaturation PCR program table

[0107]

[0108]

[0109] (5) Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured pre-library and probe mixture. Incubate the mixture at 65°C with the heated lid at 85°C for 16-18 hours.

[0110] 8. Targeted Enrichment

[0111] (1) Preheat the streptavidin magnetic beads at 65°C for at least 10 min, then transfer the hybridization products directly from the 65°C condition to the 65°C streptavidin magnetic beads. Be sure not to cool the hybridization product temperature to room temperature, otherwise it will cause serious off-target effects.

[0112] (2) After the hybridization product is bound to the streptavidin magnetic beads, the hybridization product and the streptavidin magnetic beads are rinsed and eluted.

[0113] (3) The eluted product was captured and then PCR was performed using a long fragment specific amplification enzyme. The amplification system is shown in Table 10.

[0114] Table 10 Capture library amplification system

[0115]

[0116] Universal primer sequences:

[0117] AATGATACGGCGACCACCGAG

[0118] CAAGCAGAAGACGGCATACGA.

[0119] Amplify according to the amplification program in Table 11.

[0120] Table 11 Capture library amplification program

[0121]

[0122]

[0123] (4) Purify the PCR product using 0.8* purification magnetic beads to obtain a capture library.

[0124] (5) The captured library is tested for concentration and fragment length distribution by Qubit and Qsep100. The length of the captured library should be 3k-10k. Figure 1 .

[0125] 9. PacBio third-generation library construction (kit from PacBio)

[0126] (1) DNA damage repair

[0127] Configure the DNA damage repair system according to Table 12.

[0128] Table 12 Damage repair system

[0129]

[0130] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 20 min; maintained at 4°C.

[0131] (2) End repair and purification

[0132] Configure the end repair and purification reaction system according to Table 13.

[0133] Table 13 End repair and purification reaction system

[0134]

[0135] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 5 min; maintained at 4°C.

[0136] (3) Connector connection

[0137] Configure the adapter ligation reaction system according to Table 14.

[0138] Table 14 Linker connection reaction system

[0139]

[0140] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 24h; 65°C, 10min; maintained at 4°C.

[0141] (4) Digestion of failed ligation DNA and adapter sequences.

[0142] The reaction system was configured according to Table 15.

[0143] Table 15 Digestion reaction system

[0144]

[0145] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 1h; maintained at 4°C.

[0146] 7. Sequencing and result analysis

[0147] The prepared library was sequenced using a third-generation single-molecule sequencer (PacBio Revio), so that the average sequencing depth of the target region reached more than 50×.

[0148] The obtained data is split and analyzed. The specific analysis method is as follows:

[0149] 1) Sample data splitting:

[0150] Lima software was used to split the PacBio sequencing data according to the index in the sample, and the index sequence was removed to obtain the cleaned data. This step ensures the purity and accuracy of the sample data and lays the foundation for subsequent analysis.

[0151] 2) Alignment to the reference genome:

[0152] Minimap2 was used to align the sequencing data to the human reference genome (hg19). During the alignment process, all non-human sequences that were not aligned to the reference genome were removed to ensure the accuracy and specificity of the data.

[0153] 3) Data quality control:

[0154] NanoPlot was used to perform quality control statistical analysis on the sequencing data of the target region, covering the following indicators:

[0155] Data volume: Count the total amount of sequencing data to ensure sufficient data;

[0156] Mapping rate: the ratio of sequencing data of the target region mapped to the reference genome (hg19);

[0157] Fragment length: Evaluate the fragment length distribution of the data to determine the quality of the sequencing data;

[0158] Capture efficiency: Evaluate the capture efficiency of the target area to ensure that the target area is adequately covered.

[0159] Coverage statistics: Ensure that the coverage depth of the target area is greater than 50X. Coverage is a key indicator for judging whether the sequencing data is sufficient. High coverage helps improve the accuracy of variant detection.

[0160] 4) SNV analysis:

[0161] Single nucleotide variant (SNV) analysis was performed on the BAM files of the samples using the DeepVariant tool. DeepVariant is a deep learning-based variant detection tool with high accuracy and sensitivity, capable of identifying various SNVs in the HBA and HBB genes.

[0162] 5) SV analysis:

[0163] Use cuteSV to perform structural variation (SV) analysis on the sample BAM file. SV analysis can identify a wide range of genomic rearrangements, such as deletions, insertions, inversions, etc. The SV analysis results are compared with known common variant types (such as 3.7, 4.2, 2.4, SEA, Hong Kong, Thai type, etc.) to accurately determine the mutation type of the target region.

[0164] 6) Variant annotation and disease association analysis:

[0165] Annovar and VEP were used to annotate SNVs in detail. The annotation contents included:

[0166] Mutation information: such as nucleotide changes, amino acid changes, HGVS nomenclature, genotype, etc.;

[0167] Population frequency: for example, the frequency of mutations in the 1000g and gnomAD databases;

[0168] Disease and phenotype information: including ACMG pathogenicity judgment of the variant, inheritance mode (such as dominant, recessive), disease phenotypic characteristics, etc.;

[0169] Prediction tools and scoring: such as spliceAI, SIFT, PolyPhen-2, REVEL_score, GERP++, etc., are used to evaluate the potential impact of variants on gene function.

[0170] According to the above construction process, an HBA and HBB mutation detection system was constructed, including an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module, and a single-molecule real-time sequencing analysis module;

[0171] The collection module is used to collect peripheral blood from the subject to be tested and to extract and shear high molecular weight DNA;

[0172] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, and perform Y-shaped adapter connection, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0173] The targeted enrichment module is used to hybridize and target-enrich the target gene using the target region capture probe according to the Y-shaped pre-library to obtain a capture library;

[0174] The single-molecule real-time sequencing library construction module is used to perform sequencing adapter connection based on the captured library to obtain a single-molecule real-time sequencing library;

[0175] The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation types of HBA and HBB.

[0176] Example 2

[0177] 10 positive test samples were tested according to the HBA and HBB mutation detection systems in Example 1. The results showed that the present invention can intuitively and correctly detect the mutation types of positive samples (Table 16), and for samples that are vaguely judged by traditional methods (samples 3, 5, 8, and 9), the mutation types can also be clearly determined, and the breakpoint positions can be accurately seen. At the same time, samples with inconsistent results were verified by PCR or PCR-Sanger sequencing, and the results were consistent with the method of the present invention.

[0178] Table 16 Test sample test results

[0179]

[0180]

[0181] illustrate:

[0182] Sample 1: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0183] Sample 2: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0184] Sample 3: See Figure 2 , Figure 3 The present invention has a wider detection range. The second-generation sequencing data fluctuates greatly and it is impossible to determine whether HBA is a 3.7kb deletion. After repeated verification by PCR-Sanger, it is indeed HBA.

[0185] -α3.7 / αα, the method used in the present invention directly indicates HBA, -α3.7 / αα, and the breakpoint position can be clearly seen; the second generation of HBB point mutation is consistent with the method used in the present invention.

[0186] Sample 4: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0187] Sample 5: The method of using the present invention can distinguish -α 3.7 The second generation judgment result is relatively vague, and the method used in the present invention can directly judge it as ααα anti4.2 / -α 3.7 Compound mutations were detected, and the breakpoints were clearly visible. The results were verified by PCR-Sanger analysis, which was consistent with the results of the present invention.

[0188] Sample 6: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0189] Sample 7: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0190] Sample 8: The present invention has a wider detection range. The missing 29kb fragment region includes 3.7kb and 2.4kb regions. The second-generation sequencing can only roughly determine it as HBA, -α 3.7 / -α 2.4 Compound deletion mutation, while the method used in the present invention can directly determine the unknown 29kb deletion mutation and clearly see the breakpoint position.

[0191] Sample 9: The detection range of structural variation of the present invention is wider. The method of the present invention can directly determine the variation type as HBA, αααα anti3.7 / ααα anti3.7 , and the breakpoint position can be clearly seen. And it is consistent with the PCR-Sanger repeated verification results.

[0192] Sample 10: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0193] In summary, the present invention can detect complex mutation types such as HBA / HBB point mutations, large fragment deletions, multi-copy mutations, Hong Kong type and anti-Hong Kong type, and can accurately identify cis- and trans-mutations without the need for family verification and negative sample controls.

[0194] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A HBA and HBB mutation detection system, characterized in that: It includes acquisition module, Y-shaped pre-library preparation module, targeted enrichment module, single-molecule real-time sequencing library construction module and single-molecule real-time sequencing analysis module; The collection module is used to collect peripheral blood from the subject to be tested and to extract and shear high molecular weight DNA; The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, and perform Y-shaped adapter connection, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library; The targeted enrichment module is used to hybridize and target-enrich the target gene using the target region capture probe according to the Y-shaped pre-library to obtain a capture library; The single-molecule real-time sequencing library construction module is used to perform sequencing adapter connection according to the captured library to obtain a single-molecule real-time sequencing library; The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of a target region, decompose the sequencing data of the target region, and analyze the variation types of HBA and HBB.

2. The HBA and HBB mutation detection system according to claim 1, characterized in that: The short fragments below 3 kb in the Y-shaped pre-library accounted for less than 10%.

3. The HBA and HBB mutation detection system according to claim 1, characterized in that: The PCR program for performing end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA is: 20°C, 30 minutes, 65°C, 30 minutes, and 4°C; the PCR program for performing long-fragment PCR amplification using a long-fragment amplification enzyme is: 94°C, 2 minutes; 98°C, 10 seconds, 58.8°C, 30 seconds, 68°C, 15 minutes, repeated 6 times; 68°C, 10 minutes; and 4°C.

4. The HBA and HBB mutation detection system according to claim 1, characterized in that: The method comprises: hybridizing the Y-shaped pre-library with the target region capture probe and performing targeted enrichment on the target gene according to the Y-shaped pre-library, and obtaining the capture library, comprising: hybridizing the Y-shaped pre-library with the target region capture probe labeled with biotin, combining the hybridized target DNA fragments with magnetic beads labeled with streptavidin, and eluting the target DNA fragments obtained by the elution, and performing long-fragment PCR amplification on the target DNA fragments to obtain the capture library.

5. The HBA and HBB mutation detection system according to claim 4, characterized in that: The procedure of the long-fragment PCR amplification is 94° C., 2 min; 98° C., 10 s, 58.8° C., 30 s, 68° C., 15 min, repeated 12 times; 68° C., 10 min; and hold at 4° C.

6. The HBA and HBB mutation detection system according to claim 1, characterized in that: The target region capture ranges of the target region capture probes labeled with biotin are: HBA1: chr16: 203679-207521, HBA2: chr16: 202875-203709 and HBB: chr11: 5226694-5228301; The nucleotide sequences of the target region capture probes labeled with biotin are shown in SEQ ID No: 1-SEQ ID No232.

7. The HBA and HBB mutation detection system according to claim 1, characterized in that: The method of connecting the sequencing adapters according to the captured library to obtain the single-molecule real-time sequencing library comprises: Performing DNA damage repair on the captured library; Then perform end repair and purification; The purified product was connected to the third-generation sequencing adapter; Digest unligated DNA fragments and next-generation sequencing adapters.

8. The HBA and HBB mutation detection system according to claim 1, characterized in that: The single molecule real-time sequencing analysis module is used for: Lima software was used to perform sample splitting on the sequencing data of the target region; Minimap2 was used to align the sequencing data to the hg19 genome and remove the non-human sequences that were not aligned; NanoPlot was used to perform quality control statistical analysis on the sequencing data of the target region, including data volume, mapping rate, fragment length, capture efficiency, and coverage; Use DeepVariant to perform SNV analysis of HBA and HBB genes on the sample BAM files; Perform SV analysis on sample BAM files using cutSV; Annovar and VEP were used to annotate SNVs in detail, including variant information, population frequency, disease and phenotype information, and prediction tools and scores.

9. A method for detecting HBA and HBB mutations for non-disease diagnosis purposes, characterized in that: include: Collect peripheral blood from the subjects and perform high molecular weight DNA extraction and shearing; The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation is performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library; Based on the Y-shaped pre-library, the target region capture probe is used to hybridize and target enrich the target gene to obtain a capture library; According to the captured library, the sequencing adapter is connected to obtain a single-molecule real-time sequencing library; Single-molecule real-time sequencing was performed using a single-molecule real-time sequencing library to obtain sequencing data of the target region, which was then decomposed to analyze the variation types of HBA and HBB.

10. The method for detecting HBA and HBB mutations for non-disease diagnosis purposes according to claim 9, characterized in that: The PCR program for performing end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA is: 20°C, 30 minutes, 65°C, 30 minutes, and 4°C; the PCR program for performing long-fragment PCR amplification using a long-fragment amplification enzyme is: 94°C, 2 minutes; 98°C, 10 seconds, 58.8°C, 30 seconds, 68°C, 15 minutes, repeated 6 times; 68°C, 10 minutes; and 4°C.

Images