Single-tube quadruple qPCR (quantitative polymerase chain reaction) detection method for cattle respiratory disease syndrome pathogens and application

Abstract

The invention belongs to the technical field of bovine respiratory syndrome detection, and particularly relates to a bovine respiratory disease syndrome pathogen single-tube quadruple qPCR detection method and application. The invention establishes a quadruple fluorescent quantitative PCR method capable of simultaneously detecting four pathogens of pasteurella multocida, mycoplasma bovis, mannheimia haemolytica and IBRV (infectious bursal disease virus), and nucleotide sequences of a primer probe combination designed by the method are as shown in SEQ ID NO.1-SEQ ID NO.12. The primer probe combination has high sensitivity and specificity in detection of bovine respiratory syndrome pathogens; the method is simple in operation, stable in inter-batch repetition and intra-batch repetition, suitable for large-scale detection, capable of providing a sensitive, specific, multiple and rapid etiological detection means for clinical diagnosis of BRDC, and good in practical value.

Description

Technical Field

[0001] The invention belongs to the technical field of bovine respiratory syndrome detection, and specifically relates to a single-tube quadruple qPCR detection method and application of bovine respiratory disease syndrome pathogens. Background Art

[0002] Bovine respiratory disease complex (BRDC or BRD) is a common infectious disease in cattle caused by the combined action of multiple pathogens such as Mycoplasma bovis and induced by environmental stress factors, with bovine bronchopneumonia as the main symptom. BRD is widely prevalent around the world and can occur in cattle of all breeds and ages. With the development of the intensive and specialized model of modern cattle industry, the incidence is on the rise. Environmental stress factors such as long-distance transportation, herd transfer, climate change, and childbirth are common predisposing factors for the disease.

[0003] BRD can occur in all seasons. Typical symptoms include fever, depression, dyspnea, cough, increased eye discharge, drooling, etc. In acute cases, the patient may suddenly fall to the ground, with foamy fluid flowing out of the mouth and nose, and die quickly. BRD can cause permanent lung damage, slow growth of affected cattle, and make them more susceptible to subsequent environmental stress factors and relapse, thereby reducing the economic benefits of the farm.

[0004] Studies have shown that 70% to 80% of cattle diseases are related to BRD, and BRD kills 40% to 50% of cattle, causing significant losses to the cattle industry. Due to the complex etiology and limited measures for diagnosis, treatment and prevention of the disease, the disease has not yet been effectively controlled.

[0005] Mycoplasma bovis, Pasteurella multocida, Mannheimia hemolytica and IBRV are important pathogens that cause bovine respiratory syndrome. Since the disease is often accompanied by mixed and secondary infections, and there is a lack of effective vaccines and definite treatment methods in clinical practice, timely and effective diagnosis is particularly important. At present, research reports on the establishment of fluorescent quantitative PCR have gradually been reported, but most of them are single-plex fluorescent quantitative PCR, which cannot detect multiple pathogens at the same time and cannot complete large-scale clinical sample testing. Patent CN116103447A discloses a LAMP primer combination for detecting five pathogens of the bovine respiratory system. Compared with conventional PCR and other technologies, its primer design is more complicated, and its high sensitivity may lead to false positive results that are easily affected by contamination, and it is difficult to introduce anti-contamination systems such as UNG enzymes at the same time; Xu Enhong et al. disclosed the establishment of a multiplex qPCR method for the joint detection of seven pathogens of bovine respiratory disease syndrome, but it is essentially divided into three groups of amplification systems for amplification, the operation is more complicated, and the result interpretation cannot be displayed at the same time.

[0006] Therefore, establishing a quadruple qPCR detection method with strong specificity, high sensitivity, and good repeatability is of great significance for the early diagnosis of BRD, the implementation of precise treatment and prevention and control programs, the improvement of breeding efficiency, and the effective conduct of BRD etiology and epidemiological monitoring research. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a single-tube quadruple qPCR detection method and application of bovine respiratory disease syndrome pathogens, and establishes a quadruple fluorescence quantitative PCR method that can simultaneously detect four pathogens, Pasteurella multocida, Mycoplasma bovis, Mannheimia hemolytica and IBRV, in order to provide a sensitive, specific, multiple and rapid pathogen detection method for the clinical diagnosis of BRDC.

[0008] The technical solution of the present invention is as follows:

[0009] In a first aspect, the present invention provides a primer-probe combination for detecting bovine respiratory syndrome pathogens, wherein the bovine respiratory syndrome pathogens are a combination of Mycoplasma bovis (M. bovis), Pasteurella multocida (P. multocida), Mannheimia haemolytica (M. haemolytica) and IBRV, and the primer-probe combination consists of upstream and downstream primers and probes shown in (1)-(4):

[0010] (1) The upstream and downstream primers for detecting Mycoplasma bovis are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown in SEQ ID NO.3;

[0011] (2) The upstream and downstream primers for detecting Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe is shown in SEQ ID NO.6;

[0012] (3) The upstream and downstream primers for detecting Mannheimia hemolytica are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown in SEQ ID NO.9;

[0013] (4) The upstream and downstream primers for detecting IBRV are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe is shown in SEQ ID NO.12.

[0014] In a second aspect, the present invention provides a qPCR detection method for bovine respiratory syndrome pathogens, wherein the method uses RNA or DNA of a sample to be detected as a template, selects the P59 gene of Mycoplasma bovis, the omph gene of Pasteurella multocida, the Lkt gene of Mannheimia hemolytica, and the gD gene of IBRV as detection target genes, then compares the target gene sequences, determines the candidate regions of the gene sequences to be amplified, then designs quantitative PCR amplification primers according to the determined gene sequences, designs probes in the middle of the designed amplification primers, performs fluorescence quantitative PCR detection, and finally analyzes the fluorescence quantitative PCR amplification curve and Ct value to obtain the detection result;

[0015] The primer-probe combination consists of the upstream and downstream primers and probes shown in (1)-(4):

[0016] (1) The upstream and downstream primers for detecting Mycoplasma bovis are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown in SEQ ID NO.3;

[0017] (2) The upstream and downstream primers for detecting Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe is shown in SEQ ID NO.6;

[0018] (3) The upstream and downstream primers for detecting Mannheimia hemolytica are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown in SEQ ID NO.9;

[0019] (4) The upstream and downstream primers for detecting IBRV are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe is shown in SEQ ID NO.12.

[0020] In a third aspect, the present invention provides the use of the above primer-probe combination in the preparation of a product for detecting bovine respiratory syndrome pathogens.

[0021] In a fourth aspect, the present invention provides a kit for detecting bovine respiratory syndrome pathogens, comprising the above-mentioned primer-probe combination.

[0022] The beneficial technical effects of the above one or more technical solutions of the present invention are:

[0023] (1) The present invention screens and optimizes the designed primers. During the experiment, it was found that the commonly used BHQ1 / 2 modified Mycoplasma bovis probe could not be used for the detection of quadruple fluorescence quantitative PCR. MGB modified Mycoplasma bovis probe was selected, and finally 4 sets of primers with good specificity and high sensitivity were screened. The reactions were carried out in the same tube without obvious influence on each other. The screened primers had strong specificity and good amplification effect, and the four pathogens of Pasteurella multocida, Mycoplasma bovis, Mannheimia hemolytica and IBRV were detected simultaneously in one system, which shortened the detection time and saved costs. The invention has good application prospects.

[0024] (2) The present invention has a high detection sensitivity for Pasteurella multocida, Mycoplasma bovis, Mannheimia hemolytica and IBRV, which can reach 10 copies / μL.

[0025] (3) The detection method of the present invention has significantly better sensitivity than the standard detection method, and both inter-batch and intra-batch repetitions are very stable, making it suitable for large-scale detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0027] Figure 1 Schematic diagram of the screening of primers for each pathogen in Example 1 of the present invention, wherein (a) is the amplification curve of the primers for the genes P59, uvrC, oppD / F, and P48 of Mycoplasma bovis, (b) is the amplification curve of the primers for the genes omph and KMT of Pasteurella multocida, (c) is the amplification curve of the primers for the gene Lkt of Mannheimia hemolytica, and (d) is the amplification curve of the primers for the genes gB, gD, and gE of IBRV;

[0028] Figure 2 Schematic diagram of the screening of pathogen probes in Example 1 of the present invention, wherein (a) is the amplification curve of P59 and OPPD\F genes of Mycoplasma bovis, (b) is the amplification curve of KMT and omph genes of Pasteurella multocida, (c) is the amplification curve of Lkt gene of Mannheimia hemolytica, and (d) is the amplification curve of gD gene of IBRV;

[0029] Figure 3 Schematic diagram of optimization of primer probe concentrations for each pathogen in Example 1 of the present invention, wherein (a) is an amplification curve of primer probe concentration optimization for Mycoplasma bovis, (b) is an amplification curve of primer probe concentration optimization for Pasteurella multocida, (c) is an amplification curve of primer probe concentration optimization for Mannheimia hemolytica, and (d) is an amplification curve of primer probe concentration optimization for IBRV;

[0030] Figure 4The results of the quadruple fluorescent PCR specificity experiment in Example 2 of the present invention, wherein (a) is the amplification curve of Mycoplasma bovis, (b) is the amplification curve of Pasteurella multocida, (c) is the amplification curve of Mannheimia hemolytica, and (d) is the amplification curve of IBRV;

[0031] Figure 5 The results of the quadruple fluorescence quantitative PCR sensitivity experiment in Example 2 of the present invention, wherein (a) is the amplification curve of Mycoplasma bovis at different concentration gradients, (b) is the amplification curve of Pasteurella multocida at different concentration gradients, (c) is the amplification curve of Mannheimia hemolytica at different concentration gradients, and (d) is the amplification curve of IBRV at different concentration gradients;

[0032] Figure 6 are the standard curves of the pathogens in Example 2 of the present invention, wherein (a) is the standard curve of Mycoplasma bovis, (b) is the standard curve of Pasteurella multocida, (c) is the standard curve of Mannheimia hemolytica, and (d) is the standard curve of IBRV;

[0033] Figure 7 The results of the quadruple fluorescence quantitative PCR coincidence rate experiment in Example 2 of the present invention are shown in FIG. 1 , wherein (a) is the amplification curve of Mycoplasma bovis, (b) is the amplification curve of Pasteurella multocida, (c) is the amplification curve of Mannheimia hemolytica, and (d) is the amplification curve of IBRV. DETAILED DESCRIPTION

[0034] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0035] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention.

[0036] In one embodiment of the present invention, a primer-probe combination for detecting bovine respiratory syndrome pathogens is provided, wherein the bovine respiratory syndrome pathogens are a combination of Mycoplasma bovis (M. bovis), Pasteurella multocida (P. multocida), Mannheimia haemolytica (M. haemolytica) and IBRV, and the primer-probe combination is composed of the upstream and downstream primers and probes shown in (1)-(4):

[0037] (1) The upstream and downstream primers for detecting Mycoplasma bovis are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown in SEQ ID NO.3;

[0038] (2) The upstream and downstream primers for detecting Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe is shown in SEQ ID NO.6;

[0039] (3) The upstream and downstream primers for detecting Mannheimia hemolytica are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown in SEQ ID NO.9;

[0040] (4) The upstream and downstream primers for detecting IBRV are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe is shown in SEQ ID NO.12.

[0041] In a specific embodiment of the present invention, the Mycoplasma bovis probe is modified to MGB, and other pathogen probes are modified to BHQ1 or BHQ2.

[0042] Specifically, the inventors found during the experiment that the BHQ1 / 2 modified Mycoplasma bovis probe could not be used for the detection of quadruple fluorescence quantitative PCR, so MGB was used to modify the Mycoplasma bovis probe.

[0043] In a specific embodiment of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the fluorescent reporter groups of the probes do not interfere with each other; the 3' end of the probe is labeled with a fluorescent quencher group.

[0044] The "signals do not interfere with each other" described in the present invention means that the fluorescent groups used in the above-mentioned probes are different and will not affect each other's detection, that is, different channels can be used for detection. For example, FAM, ROX, VIC, and CY5 can be used. The absorbance values ​​of these groups are not close, and different channels can be selected. The signals of different channels will not interfere with each other; in addition, the three signals of each fluorescent channel can be distinguished by adding different probe concentrations to distinguish the fluorescence values, thereby forming different clustering signals, and further distinguished by clustering analysis software, without mutual interference.

[0045] In a specific embodiment of the present invention, the fluorescent reporter groups labeled at the 5' end of the probe used to detect the four pathogens of bovine respiratory syndrome are selected from FAM, ROX, VIC and CY5.

[0046] In a specific embodiment of the present invention, a qPCR detection method for bovine respiratory syndrome pathogens is provided. The method uses RNA or DNA of a sample to be detected as a template, selects the P59 gene of Mycoplasma bovis, the omph gene of Pasteurella multocida, the Lkt gene of Mannheimia hemolytica, and the gD gene of IBRV as detection target genes, then compares the target gene sequences, determines the candidate regions of the gene sequences to be amplified, then designs quantitative PCR amplification primers according to the determined gene sequences, designs probes in the middle of the designed amplification primers, performs fluorescence quantitative PCR detection, and finally analyzes the fluorescence quantitative PCR amplification curve and Ct value to obtain the detection result;

[0047] The primer-probe combination consists of the upstream and downstream primers and probes shown in (1)-(4):

[0048] (1) The upstream and downstream primers for detecting Mycoplasma bovis are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown in SEQ ID NO.3;

[0049] (2) The upstream and downstream primers for detecting Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe is shown in SEQ ID NO.6;

[0050] (3) The upstream and downstream primers for detecting Mannheimia hemolytica are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown in SEQ ID NO.9;

[0051] (4) The upstream and downstream primers for detecting IBRV are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe is shown in SEQ ID NO.12.

[0052] The bovine respiratory syndrome pathogens include, but are not limited to, Mycoplasma bovis, Pasteurella multocida, Mannheimia haemolytica and IBRV.

[0053] In a specific embodiment of the present invention, in the qPCR reaction system, the concentrations of P59-F and P59-R are 0.5 pmol / μL, P59-probe 0.2 pmol / μL, Lkt-F and Lkt-R are 0.6 pmol / μL, Lkt-probe 0.8 pmol / μL, omph-F and omph-R are 0.2 pmol / μL, omph-probe 0.8 pmol / μL, gD-10-F and gD-R are 0.4 pmol / μL, and gD-probe 0.8 pmol / μL; the above primer probe combination can also be amplified in a UDG enzyme reaction system. The specific reaction system is as follows: P59-F and P59-R are both 0.5 pmol / μL, P59-probe 0.2 pmol / μL, Lkt-F and Lkt-R are both 0.6 pmol / μL, Lkt-probe 0.8 pmol, omph-F and omph-R are both 0.2 pmol, omph-probe 0.8 pmol, gD-10-F and gD-R are both 0.4 pmol, gD-probe 0.8 pmol, 2×T5 Fast DUTP / Heat Labile System Probe qPCR mix 10 μL, template 1 μL, and DEPC water to 20 μL.

[0054] In one embodiment of the present invention, the qPCR reaction procedure is:

[0055] Step 1: 25°C, incubate with UDG enzyme for 10 min;

[0056] Step 2: 95°C, 2 min;

[0057] Step3: 95℃, 10s; 60℃, 30s;

[0058] Step 3 executes 45 cycles.

[0059] In one specific embodiment of the present invention, there is provided the use of the above primer-probe combination in the preparation of a product for detecting bovine respiratory syndrome pathogens.

[0060] The products for detecting bovine respiratory syndrome pathogens include but are not limited to reagents, test kits, chips, test papers, membrane strips or detection platforms.

[0061] In one embodiment of the present invention, a kit for detecting bovine respiratory syndrome pathogens is provided, which contains the above-mentioned primer-probe combination.

[0062] The bovine respiratory syndrome pathogens include, but are not limited to, Mycoplasma bovis, Pasteurella multocida, Mannheimia haemolytica and IBRV.

[0063] In a specific embodiment of the present invention, the kit further comprises an enzyme mixture, a negative quality control product, a positive quality control product, and a PCR buffer; the enzyme mixture contains at least one of a high-fidelity Taq enzyme, an UDG enzyme, magnesium ions, and dNTPs; the negative quality control product is pure water treated with diethyl pyrocarbonate (DEPC); and the positive quality control product is a plasmid containing the four pathogen-specific sequences described in the present invention.

[0064] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0065] Example 1

[0066] Primer and probe design

[0067] Referring to the genome sequences included in GenBank, the genome sequences of Mycoplasma bovis, Pasteurella multocida, Mannheimia haemolytica and IBRV were downloaded, and six pairs of primers were designed for P59, uvrC, oppD / F, and P48 genes of Mycoplasma bovis using Primer Premier v 5.0 software; two pairs of primers were designed for omph and KMT genes of Pasteurella multocida; one pair of primers was designed for Lkt gene of Mannheimia haemolytica; six pairs of primers were designed for gB, gD, and gE genes of IBRV, without hairpin structures between primers, and verified by BLAST comparison. After confirming their specificity, the primers and probes that met the requirements were selected and synthesized by Beijing Qingke Biotechnology Co., Ltd. for subsequent screening.

[0068] Table 1 Primer design sequences for four pathogens

[0069]

[0070]

[0071] The SYBR GREEN I fluorescent quantitative PCR method was used. Each pair of primers was added to the reaction system with Pasteurella multocida positive template, Mannheimia hemolytica positive template, Mycoplasma bovis positive template, and IBRV positive template (purchased from Beijing Qingke Biotechnology Co., Ltd.). The reaction system is shown in Table 2. According to the reaction conditions in Table 3, primers with high specificity and good sensitivity were selected according to the Ct value of the test results, the shape of the amplification curve, the fluorescence signal intensity, and the amplification efficiency for subsequent experiments.

[0072] Table 2SYBR GREEN I fluorescent quantitative PCR reaction system

[0073]

[0074]

[0075] Table 3SYBR GREEN I fluorescence quantitative PCR reaction conditions

[0076]

[0077] Results: Figure 1 As shown in (a), according to the Ct value, amplification curve, fluorescence signal intensity and other conditions, the primers designed for the uvrC and P48 genes of Mycoplasma bovis have the problem of low sensitivity. Finally, the P59 gene and OPPD\F gene of Mycoplasma bovis were selected for subsequent research; Figure 1 As shown in (b), the primers for KMT gene and omph gene of Pasteurella multocida have good specificity and sensitivity, and further research is needed; Figure 1 As shown in (c), the primers designed for the Lkt gene of Mannheimia haemolytica have good specificity and sensitivity; Figure 1 As shown in (d), the primers designed for the gB and gE genes of IBRV had disadvantages such as poor specificity and low sensitivity. Finally, the gD gene of IBRV was selected for subsequent experiments.

[0078] According to the results of primer screening, probes for uvrC, OPPD\F genes of Mycoplasma bovis, KMT and omph genes of Pasteurella multocida, Lkt gene of Mannheimia hemolytica, and gD gene of IBRV were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd. The probe sequence is shown in Table 4, and the reaction system and reaction conditions are shown in Tables 5 and 6. Probe screening was performed, and the probes with the highest specificity and the best sensitivity were selected according to the Ct value of the test results, the shape of the amplification curve, the fluorescence signal intensity, and the amplification efficiency for subsequent experiments.

[0079] Table 4 Probe design sequences

[0080]

[0081]

[0082] Table 5 Reaction system for fluorescent quantitative PCR probe screening

[0083] Components Volume (μL) <![CDATA[TaqMan TM Multiple Master Mixes]]> 10 Upstream primer (10 μM) 0.4 Probe (10 μM) 0.4 Downstream primer (10 μM) 0.4 DNA template 1 <![CDATA[RNase free H2O]]> 7.8 Total volume 20

[0084] Table 6 Reaction conditions for fluorescent quantitative PCR probe screening

[0085]

[0086] Results: Figure 2 As shown in (a), the probe designed for the OPPD / F gene of Mycoplasma bovis has a low sensitivity problem, and finally the probe of the P59 gene of Mycoplasma bovis was screened out for subsequent research; Figure 2 As shown in (b), the probe designed for the KMT gene of Pasteurella multocida has a low sensitivity problem, and finally the omph gene of Pasteurella multocida was screened out for subsequent research; Figure 2 As shown in (c), the primer probe designed for the Lkt gene of Mannheimia haemolytica has good specificity and sensitivity; Figure 2 As shown in (d) in Figure 7, the gD gene probe designed by IBRV has good specificity and is used for subsequent experiments. The specific primer probe sequence finally selected is shown in Table 7.

[0087] Table 7 Specific primers and TaqMan probe sequences

[0088]

[0089]

[0090] The positive templates of Mycoplasma bovis, Pasteurella multocida, Mannheimia hemolytica, and IBRV were used, and enzyme-free water was set as a negative control. They were added to the single-plex fluorescence quantitative PCR reaction system to optimize the annealing temperature of single-plex fluorescence quantitative PCR. The results are shown in Table 8. There was no significant difference in the Ct value of Mannheimia hemolytica when the annealing temperature was 56℃~60℃ (p<0.05), and the Ct value was the smallest and the fluorescence signal intensity was the highest at 60℃; there was no significant difference in the Ct value of Mycoplasma bovis when the annealing temperature was 56℃~60℃ (p<0.05), and the Ct value was the smallest and the fluorescence signal intensity was the highest at 60℃; there was no significant difference in the Ct value of IBRV when the annealing temperature was 56℃~60℃ (p<0.05); the Ct value of Pasteurella multocida was the smallest and the fluorescence signal intensity was the highest at 60℃, so 60℃ was established as its optimal annealing temperature. The control variable method was used to determine the optimal annealing temperature to be 60℃.

[0091] Table 8 Optimization of annealing temperature for each pathogen

[0092]

[0093] After determining the optimal annealing temperature, the screened probes and primers were combined in pairs, three combinations, and four combinations to gradually screen the primer and probe combinations that can be used for quadruple fluorescence quantitative PCR detection, and optimize the concentrations of primers and probes in the system. Using the control variable method, the three gradients of primer concentrations of 0.2pmol / μL, 0.4pmol / μL, and 0.6pmol / μL for Pasteurella multocida, Mannheimia hemolytica, and IBRV were optimized, and the probe concentrations were 0.2pmol / μL, 0.4pmol / μL, 0.6pmol / μL, and 0.8pmol / μL. 4 gradients were optimized, 3 replicates were set for each group, and the best primer probe concentration was screened out based on the Ct value, the height of the fluorescence signal and the change of the amplification curve; the primer concentrations of bovine Mycoplasma were optimized at 0.3pmol / μL, 0.5pmol / μL, 0.7pmol / μL and 0.9pmol / μL, and after the best primer concentration was screened out, the probe concentrations were optimized at 0.2pmol / μL, 0.4pmol / μL, 0.6pmol / μL and 0.8pmol / μL, and three replicates were set for each group, and the best probe workload was screened out based on the Ct value, the amplification curve and the fluorescence signal intensity. The above designs are shown in Tables 9, 10, 11, 12 and 13.

[0094] Table 9 Relationship between primer concentration and Ct value of Mycoplasma bovis

[0095]

[0096] Table 10 Relationship between probe concentration and Ct value of Mycoplasma bovis

[0097]

[0098] Table 11 Relationship between primer probe concentration and Ct value of Mannheimia hemolytica

[0099]

[0100] Table 12 Relationship between primer probe concentration and Ct value of Pasteurella multocida

[0101]

[0102] Table 13 Relationship between IBRV primer probe concentration and Ct value

[0103]

[0104] Note: The unit of primer and probe concentration in Tables 11, 12, and 13 above is pmol / μL.

[0105] Results: Figure 3As shown in (a), when the concentration of bovine Mycoplasma primers is 0.5 pmol / μL and the probe concentration is 0.2 pmol / μL, a more obvious plateau phase, a higher fluorescence signal and a lower average Ct value can be generated; Figure 3 As shown in (b), when the primer concentration of Mannheimia hemolytica was 0.6 pmol / μL and the probe concentration was 0.8 pmol / μL, a more obvious plateau phase, a higher fluorescence signal and a lower average Ct value were produced; Figure 3 As shown in (c), when the primer concentration of Pasteurella multocida is 0.2 pmol / μL and the probe concentration is 0.8 pmol / μL, a more obvious plateau phase, a higher fluorescence signal and a lower average Ct value can be generated; Figure 3 As shown in (d), an IBRV primer concentration of 0.4 pmol / μL and a probe concentration of 0.8 pmol / μL can produce a more obvious plateau phase, a higher fluorescence signal and a lower average Ct value.

[0106] Based on the above experiments, the optimal reaction concentrations of primers and probes were obtained as follows: P59-F and P59-R were both 0.5 pmol / μL, P59-probe 0.2 pmol / μL, Lkt-F and Lkt-R were both 0.6 pmol / μL, Lkt-probe 0.8 pmol / μL, omph-F and omph-R were both 0.2 pmol / μL, omph-probe 0.8 pmol / μL, gD-10-F and gD-R were both 0.4 pmol / μL, gD-probe 0.8 pmol / μL; the optimal annealing temperature was 60°C. The above primer-probe combinations were used for subsequent performance verification experiments in the UDG enzyme reaction system. The specific reaction system is as follows: P59-F and P59-R are both 0.5pmol / μL, P59-probe 0.2pmol / μL, Lkt-F and Lkt-R are both 0.6pmol / μL, Lkt-probe 0.8pmol, omph-F and omph-R are both 0.2pmol, omph-probe 0.8pmol, gD-10-F and gD-R are both 0.4pmol, gD-probe 0.8pmol, 2×T5 Fast DUTP / HeatLabile System Probe qPCR mix 10μL, DEPC water is added to 20μL. Among them, 2×T5 Fast DUTP / HeatLabile System Probe qPCR mix was purchased from Qingke Biotechnology.

[0107] The specific reaction procedure is as follows: Step 1: 25°C, UDG enzyme incubation for 10 min; Step 2: 95°C, 2 min; Step 3: 95°C, 10 s; 60°C, 30 s; Step 3 is performed for 45 cycles.

[0108] Specificity test:

[0109] Common cattle pathogens including Mycoplasma bovis positive nucleic acid samples, Pasteurella multocida positive nucleic acid samples, Mannheimia hemolytica positive nucleic acid samples, IBRV positive nucleic acid samples, Mycoplasma bovis positive nucleic acid samples, Shigella positive nucleic acid samples, Salmonella positive nucleic acid samples, Staphylococcus aureus positive nucleic acid samples, and Escherichia coli positive nucleic acid samples were selected as templates (purchased from Beijing Qingke Biotechnology Co., Ltd.), DEPC water was used as a negative control, and according to the optimized optimal reaction conditions, 60°C was selected as the optimal annealing temperature. According to the optimized reaction system, a specificity test of the quadruple fluorescence quantitative PCR method was carried out to analyze the specificity of the method.

[0110] Results: The results are as follows Figure 4 (a) Figure 4 (b) Figure 4 (c) and Figure 4 As shown in (d), the reaction system of the present invention can produce specific amplification curves of Mycoplasma bovis, Pasteurella multocida, Mannheimia hemolytica and IBRV in different channels, and has no cross reaction with other pathogens. No amplification curves and Ct values ​​appear for other pathogens, which proves that the established quadruple fluorescence quantitative PCR detection method has high specificity.

[0111] Sensitivity test:

[0112] Four pathogen-positive plasmid standards (purchased from Beijing Qingke Biotechnology Co., Ltd.) were used as templates and diluted to 1×10 9 copies / μL~1×10 1 A total of 9 gradients of 10 copies / μL were mixed, and a negative control was set up with enzyme-free water. According to the above reaction system and reaction conditions, quadruple fluorescence quantitative PCR amplification was performed under the same conditions to detect the minimum detection limit of this method.

[0113] The results are shown in Table 14. Figure 5 (a) Figure 5 (b) Figure 5 (c) and Figure 5 As shown in (d), the quadruple fluorescence quantitative PCR pathogen was 1×10 9 copies / μL~1×10 1The positive plasmid standards with 10 copies / μL all had relatively regular and obvious fluorescence signals. The minimum detection limits of pathogens were: Mycoplasma bovis 10 copies / μL, Pasteurella multocida 10 copies / μL, Mannheimia hemolytica 10 copies / μL, and IBRV 10 copies / μL.

[0114] Table 14 Quadruple fluorescence quantitative PCR sensitivity test

[0115]

[0116]

[0117] Establishment of standard curve:

[0118] Using the established reaction conditions and reaction system, mix 1×10 9 copies / μL~1×10 1 Four positive plasmid standards with a total of 9 copies / μL were used as templates, and DEPC water was used as a negative control. A quadruple fluorescence quantitative PCR test was performed, and a standard curve was drawn based on the data results to analyze its linear relationship.

[0119] Results: Figure 6 As shown in (a), Mycoplasma bovis: R2 is 0.9983, the amplification efficiency is 91.2%, and its linear regression equation is: y = -3.5537x + 40.57; Figure 6 As shown in (b), hemolytic Mannheimia: R2 is 0.9997, the amplification efficiency is 96.0%, and its linear regression equation is: y = -3.4208x + 39.716; Figure 6 As shown in (c), for Pasteurella multocida: R2 is 0.9998, the amplification efficiency is 93.0%, and its linear regression equation is: y = -3.5013x + 40.232; Figure 6 As shown in (d), IBRV: R2 is 0.9997, the amplification efficiency is 102.2%, and its linear regression equation is y=-3.27x+40.853.

[0120] In summary, the amplification efficiency was between 90% and 110%, and each reaction was performed at a dilution of (1×10 1 copies / μL~1×10 9 The linear relationship was good in the range of 100 copies / μL.

[0121] Repeatability test:

[0122] Mix 1×10 9 copies / μL~1×10 1Four positive plasmid standards with a total of 9 gradients of 10 copies / μL were used as templates, and enzyme-free water was set as the negative control. Quadruple fluorescent quantitative PCR reactions were performed, and each dilution concentration was repeated 3 times in parallel under the same conditions. The mean Ct value, standard deviation and coefficient of variation were calculated to evaluate the intra-group repeatability of this method; each dilution concentration was tested 3 times under the same conditions at different time points (24h, 48h, 72h), and the mean Ct value, standard deviation and coefficient of variation were calculated to evaluate the inter-group repeatability of this method.

[0123] The results are shown in Tables 15, 16, 17 and 18. The coefficient of variation of repeated tests within the group is less than 3%; the coefficient of variation of repeated tests between groups is less than 3%, and both are less than 3%, indicating that the method has good repeatability.

[0124] Table 15 Results of repeatability test of Mycoplasma bovis

[0125]

[0126]

[0127] Table 16 Results of the repeatability test of Mannheimia hemolytica

[0128]

[0129] Table 17 Pasteurella multocida repeatability test results

[0130]

[0131] Table 18 IBRV repeatability test results

[0132]

[0133]

[0134] Compliance test:

[0135] Fifteen clinical strain samples suspected of Pasteurella multocida, 15 clinical strain samples suspected of Mannheimia haemolytica, 45 clinical strain samples suspected of Mycoplasma bovis, and 10 clinical strain samples suspected of IBRV isolated in our laboratory were used to extract their DNA as templates. Mannheimia haemolytica was detected using the local standard (DB51 / T 2301-2016) PCR method, Pasteurella multocida was detected using the PCR method in Chapter 3.4.10 of the WOAH Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Mycoplasma bovis was detected using the industry standard (NY / T 3234-2018) PCR method, and IBRV was detected using the standard (GB / T 27981-2011) PCR method. The primer and probe sequences are shown in Table 19. Subsequently, the quadruple fluorescence quantitative PCR method established in this study was used for detection and the compliance rate was compared.

[0136] Table 19 Primer and probe sequences for standard methods

[0137]

[0138] Results: As shown in Table 20, the results of the standard method showed that the positive rates of Pasteurella multocida (P. multocida), Mannheimia haemolytica (M. haemolytica), Mycoplasma bovis (M. bovis) and IBRV were 93.3%, 86.7%, 88.9% and 80.0%, respectively. The quadruple fluorescence quantitative PCR method established in this study detected the samples, and the positive rates of Pasteurella multocida, Mannheimia haemolytica, Mycoplasma bovis and IBRV were 100%, 93.3%, 91.1% and 90.0%, respectively. The amplification curves are shown in Figure 7 shown.

[0139] Table 20 Compliance test

[0140]

[0141] The gene fragment sequence amplified by the primers in the above preferred primer-probe combination is as follows:

[0142] The amplified fragment of the Mycoplasma bovis p59 gene is: GGAACAAACCACGGAAACTCTTTAGCCAGATCGCTTTCTGGTGGTAACCAACAAAAAGCGATTG T (SEQ ID NO. 38);

[0143] The amplified fragment of the omph gene of Pasteurella multocida is: CCGCAAAATTAGTGGATAGCATTCAAAACGCGGTAAATACGGTTGCAAGAGAGAAAAACTATAC ATTAGTACTGAATGAAGGTGCAGTCGTGTTTGCTGCAGATGCAAAAAATATTACTGAAGATGTTC TAAAAGTCATTCCTGCGACACAGGCGAAATAA (SEQ ID NO. 39);

[0144] The amplified fragment of the Lkt gene of Mannheimia haemolytica is: ATCAACGCAGACAGGCCTCGATGATCAGAGCACCGGTTTCCGGTACGGTTCAGCAACTGAAAATTCACACTATAGGTGGTGTTGTTACGA CTGCTGAAAC (SEQ ID NO. 40);

[0145] The amplified fragment of the gD gene of IBRV was CCCGGCCCGGGATTACGAGCAAAAGAAGGTTCTGCGCCTGACGTATCTCACGCAGTACTACCCGCAGGAGGCACACAAGGCCATAGTCG ACTACTGGTTCATGC (SEQ ID NO. 41).

[0146] Example 2

[0147] Clinical sample testing

[0148] According to the quadruple fluorescence quantitative PCR detection method established in this experiment, nasal swab samples collected from cattle farms in Shandong were tested at 2×10 6 The quadruple standard plasmid with 10 copies / μL was used as the positive template, and enzyme-free water was used as the negative control to detect clinical samples and calculate the positive rate.

[0149] 224 samples of bovine nasal swabs showing respiratory diseases were collected and analyzed by the established quadruple fluorescence quantitative PCR detection method. When the Ct value was ≤37 and a specific amplification curve appeared, it was judged to be positive. The results are shown in Table 21. The positive rate of Pasteurella multocida was 19.64%, the positive rate of Mycoplasma bovis was 21.42%, the positive rate of Mannheimia hemolytica was 16.07%, and the positive rate of IBRV was 8.93%. The mixed infection situation was: the mixed infection rate of Mycoplasma bovis and IBRV was 1.79%; the mixed infection rate of Mycoplasma bovis and Pasteurella multocida was 6.25%; the mixed infection rate of Mycoplasma bovis and Mannheimia hemolytica was 6.25%; the mixed infection rate of Mannheimia hemolytica and Pasteurella multocida was 7.14%; the mixed infection rate of Mycoplasma bovis, Mannheimia hemolytica and Pasteurella multocida was 3.57%.

[0150] Table 21 Clinical sample quadruple fluorescence quantitative PCR test results

[0151] pathogen Total number of clinical samples Positive rate (%) Pasteurella multocida 224 19.64％(44 / 224) Mannheimia haemolytica 224 16.07％(36 / 224) Mycoplasma bovis 224 21.42％(48 / 224) IBRV 224 8.93％(20 / 224) Mixed infection of Mycoplasma bovis and IBRV 224 1.79％(4 / 224) Mixed infection of Mannheimia haemolytica and Pasteurella multocida 224 7.14％(16 / 224) Mixed infection of Mycoplasma bovis and Pasteurella 224 6.25％(14 / 224) Mixed infection of Mycoplasma bovis and Mannheimia hemolytica 224 6.25％(14 / 224) Mixed infection with Mycoplasma bovis, Mannheimia haemolytica and Pasteurella multocida 224 3.57％(8 / 224)

[0152] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting bovine respiratory syndrome pathogens, characterized in that: The bovine respiratory syndrome pathogen is a combination of Mycoplasma bovis (M. bovis), Pasteurella multocida (P. multocida), Mannheimia haemolytica (M. haemolytica) and IBRV, and the primer-probe combination consists of the upstream and downstream primers and probes shown in (1)-(4): (1) The upstream and downstream primers for detecting Mycoplasma bovis are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown in SEQ ID NO.3; (2) The upstream and downstream primers for detecting Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe is shown in SEQ ID NO.6; (3) The upstream and downstream primers for detecting Mannheimia hemolytica are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown in SEQ ID NO.9; (4) The upstream and downstream primers for detecting IBRV are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe is shown in SEQ ID NO.

12.

2. The primer-probe combination according to claim 1, characterized in that: The Mycoplasma bovis probe was modified to MGB.

3. The primer-probe combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group, and the fluorescent reporter groups of the probes do not interfere with each other; the 3' end of the probe is labeled with a fluorescent quencher group.

4. The primer-probe combination according to claim 1, characterized in that: The fluorescent reporter groups labeled at the 5' end of the probe for detecting the four pathogens of bovine respiratory syndrome are selected from FAM, ROX, VIC and CY5 respectively.

5. A qPCR detection method for bovine respiratory syndrome pathogens, characterized in that: The method uses RNA or DNA of a sample to be detected as a template, selects the P59 gene of Mycoplasma bovis, the omph gene of Pasteurella multocida, the Lkt gene of Mannheimia hemolytica, and the gD gene of IBRV as detection target genes, then compares the target gene sequences, determines the candidate regions of the gene sequences to be amplified, then designs quantitative PCR amplification primers according to the determined gene sequences, designs probes in the middle of the designed amplification primers, performs fluorescence quantitative PCR detection, and finally analyzes the fluorescence quantitative PCR amplification curve and Ct value to obtain the detection result; The primer-probe combination consists of the upstream and downstream primers and probes shown in (1)-(4): (1) The upstream and downstream primers for detecting Mycoplasma bovis are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown in SEQ ID NO.3; (2) The upstream and downstream primers for detecting Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe is shown in SEQ ID NO.6; (3) The upstream and downstream primers for detecting Mannheimia hemolytica are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown in SEQ ID NO.9; (4) The upstream and downstream primers for detecting IBRV are shown in SEQ ID NO.10 and SEQ ID NO.11, and the probe is shown in SEQ ID NO.

12.

6. The qPCR detection method according to claim 5, characterized in that In the qPCR reaction system, the concentrations of P59-F and P59-R were 0.5 pmol / μL, the concentration of P59-probe was 0.2 pmol / μL, the concentration of Lkt-F and Lkt-R was 0.6 pmol / μL, the concentration of Lkt-probe was 0.8 pmol / μL, the concentration of omph-F and omph-R was 0.2 pmol / μL, the concentration of omph-probe was 0.8 pmol / μL, the concentration of gD-10-F and gD-R was 0.4 pmol / μL, and the concentration of gD-probe was 0.8 pmol / μL.

7. The qPCR detection method according to claim 5, characterized in that: The qPCR reaction procedure is: Step 1: 25°C, incubate with UDG enzyme for 10 min; Step 2: 95°C, 2 min; Step3: 95℃, 10s; 60℃, 30s; Step 3 executes 45 cycles.

8. Use of the primer-probe combination according to any one of claims 1 to 4 in the preparation of a product for detecting bovine respiratory syndrome pathogens.

9. A kit for detecting bovine respiratory syndrome pathogens, comprising the primer-probe combination according to any one of claims 1 to 4.

10. The kit according to claim 9, characterized in that The kit also includes an enzyme mixture, a negative quality control product, a positive quality control product, and a PCR buffer; the enzyme mixture contains at least one of a high-fidelity Taq enzyme, an UDG enzyme, a magnesium ion, and a dNTP.

Images