LAMP-LFD primer probe combination for detecting clostridium perfringens, kit and application

Abstract

The invention provides an LAMP-LFD (loop-mediated isothermal amplification-lateral flow dipstick) primer probe combination for detecting clostridium perfringens, a kit and application, and belongs to the technical field of pathogenic bacterium detection. The primer probe combination comprises an inner primer, an outer primer and a probe, the nucleotide sequences of FIP and BIP of the inner primer are shown as SEQ ID NO.9-10, the nucleotide sequences of F3 and B3 of the outer primer are shown as SEQ ID NO.11-12, and the nucleotide sequence of the probe is shown as SEQ ID NO.13. The invention further discloses a kit for detecting the content of the F3 and B3 in the kit. The LAMP-LFD primer probe combination disclosed by the invention can be used for rapidly identifying whether a sample to be detected contains the clostridium perfringens or not by detecting the specific cpa virulence gene of the clostridium perfringens. The LAMP-LFD primer probe combination established by the invention can be used for quickly and efficiently detecting the clostridium perfringens and the cpa virulence gene thereof without depending on complex instruments, and has high sensitivity and strong specificity.

Description

Technical Field

[0001] The invention belongs to the technical field of pathogenic bacteria detection, and in particular relates to a LAMP-LFD primer probe combination, a kit and an application thereof for detecting Clostridium perfringens. Background Art

[0002] Clostridium perfringens is widely distributed in nature and is an opportunistic pathogen. Due to stress factors such as sudden temperature changes, feed changes, and herd transfers, it often proliferates in large numbers in a short period of time, produces a variety of lethal toxins, and bursts and produces gas, causing animal illness, causing huge economic losses to animal husbandry and posing a serious threat to public health and safety. Clostridium perfringens can produce a variety of pathogenic toxins, among which CPA, CPB, ETX, and IOTA are the main lethal toxins. Toxin typing divides the bacteria into seven toxin types, among which all known types of Clostridium perfringens produce CPA toxin. CPA toxin has been shown to hydrolyze cell membrane phospholipids, ultimately leading to cell necrosis and causing gas gangrene in animals. Among them, CPB and ETX toxins are both perforating toxins. CPB acts on nerve cells through gangliosides, so it is a neurotoxin. When the pathogenic bacterial reproductive bodies invade the animal intestine, ETX toxins are absorbed into the blood circulation, pass through the barrier, and act on the brain, lungs, kidneys and vascular endothelial cells, as well as the central nervous system and peripheral sheathed nerve fibers, causing sudden death of the host animal, seriously threatening animal public health safety and the development of modern breeding industry. Therefore, the development of diagnostic technology that can be used for clinical instant detection is of great significance for the prevention and control of Clostridium perfringens disease.

[0003] Loop-mediated isothermal amplification (LAMP) is a new type of nucleic acid isothermal amplification technology. This technology designs 4 to 6 specific primers for the 6 regions of the target gene. Under the action of strand displacement DNA polymerase (Bst DNA polymerase), amplification can be performed at a constant temperature of 60 to 65°C, and 10 9 ~10 10 times gene amplification. Compared with the traditional PCR which requires variable temperature cycles and relies on professional instruments, it is fast, efficient and highly specific. The lateral flow dipstick (LFD) has significant advantages in on-site detection, such as intuitive results and convenient operation. Therefore, the establishment of a LAMP-LFD detection method that can quickly detect Clostridium perfringens is of great significance for the diagnosis, epidemiological investigation and prevention and control of Clostridium perfringens disease in humans and animals. However, so far, there have been no reports on the LAMP-LFD primer probe combination and LAMP-LFD detection method for detecting Clostridium perfringens. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a LAMP-LFD primer-probe combination, a kit and an application for detecting Clostridium perfringens.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a LAMP-LFD primer-probe combination for detecting Clostridium perfringens. The LAMP-LFD primer-probe combination comprises an inner primer, an outer primer and a probe. The nucleotide sequences of FIP and BIP of the inner primers are shown in SEQ ID NOs.9 to 10, the nucleotide sequences of F3 and B3 of the outer primers are shown in SEQ ID NOs.11 to 12, and the nucleotide sequence of the probe is shown in SEQ ID NO.13.

[0007] Preferably, the 5' end of the FIP of the inner primer is modified with Digoxin, and the 5' end of the probe is modified with Biotin.

[0008] The present invention provides a kit for detecting Clostridium perfringens, comprising the above-mentioned LAMP-LFD primer-probe combination.

[0009] Preferably, the kit includes 3 μL of 13.33 μM FIP, 3 μL of 13.33 μM BIP, 0.25 μL of 20 μM F3, 0.25 μL of 20 μM B3, 0.25 μL of 20 μM probe, 4 μL of 10 mM dNTPs, 2 μL of 8000 U / mL Bst2.0 DNA Polymerase, 2.5 μL of 10×Isothermal Amplification buffer, 1.5 μL of 100 mM MgSO4 and 1.5 μL of 10×SYBR GreenⅠ fluorescent dye.

[0010] Preferably, the kit includes 3 μL of 20 μM FIP, 3 μL of 20 μM BIP, 0.25 μL of 20 μM F3, 0.25 μL of 20 μM B3, 0.25 μL of 20 μM probe, 4 μL of 10 mM dNTPs, 2 μL of 8000 U / mL Bst2.0 DNA Polymerase, 2.5 μL of 10×Isothermal Amplification buffer and 1.5 μL of 100 mM MgSO4.

[0011] Preferably, the kit further comprises a lateral flow chromatography test strip, the lateral flow chromatography test strip comprises a nitrocellulose membrane, a detection line and a quality control line are arranged on the nitrocellulose membrane, the detection line is coated with Digoxin monoclonal antibody, and the quality control line is coated with anti-mouse antibody. Further, the lateral flow chromatography test strip comprises a colloidal gold immunochromatography test strip; the colloidal gold immunochromatography test strip comprises a bottom plate and a sample pad, a conjugation pad, a detection pad and an absorption pad connected to the bottom plate in sequence from bottom to top. The conjugation pad is loaded with anti-biotin antibody labeled with colloidal gold; the detection pad is provided with a detection line and a quality control line; the detection line is coated with a detection line of anti-Digoxin antibody; the quality control line is coated with anti-mouse antibody. The bottom plate is a PVC bottom plate, and the material of the detection pad is preferably a nitrocellulose membrane (NC membrane). When there is a Biotin-Digoxin conjugate in the sample to be tested, a colloidal gold marker-target detection object-antibody complex will be formed and enriched on the corresponding detection line to form a red precipitation line.

[0012] The present invention provides an application of the above-mentioned LAMP primer pair or LAMP-LFD primer probe combination in preparing a product for detecting Clostridium perfringens or Clostridium perfringens cpa virulence gene.

[0013] The present invention provides a method for detecting Clostridium perfringens or its cpa virulence gene for non-diagnostic purposes, comprising the following steps: amplifying a sample to be tested using the above-mentioned LAMP-LFD primer probe combination or kit.

[0014] Preferably, the amplification temperature is 60-65° C., and the amplification time is 10-70 min.

[0015] When the above-mentioned LAMP-LFD primer-probe combination or kit is used to detect the sample to be tested, the amplification product is detected using the lateral flow chromatography test paper, and the test result is judged according to the quality control line and the test line. The result is judged in the following manner:

[0016] S1, positive: red stripes appear on the quality control line and the test line. The positive result indicates that the sample to be tested contains the cpa virulence gene and the sample to be tested contains Clostridium perfringens;

[0017] S2, negative: red bands appear on the quality control line and no bands appear on the test line. The negative result indicates that the sample to be tested does not contain the cpa virulence gene, and the sample to be tested does not contain Clostridium perfringens;

[0018] S3, invalid: No colored bands appear on the quality control line, indicating improper operation or invalid test card.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a LAMP-LFD primer-probe combination, a kit and an application for detecting Clostridium perfringens. The present invention establishes a LAMP-LFD primer-probe combination for detecting Clostridium perfringens and its cpa virulence gene, and can realize rapid identification of whether a sample to be tested contains Clostridium perfringens by detecting the cpa virulence gene unique to Clostridium perfringens. Since the LAMP reaction can be carried out under constant temperature conditions, amplification can also be completed in a simple water bath, reducing the dependence on professional instruments, and is more suitable for clinical testing. The LAMP-LFD primer-probe combination established by the present invention can detect Clostridium perfringens and its cpa virulence gene quickly and efficiently, with high sensitivity and strong specificity, and does not rely on complex instruments, providing a new method for on-site instant rapid identification and detection of Clostridium perfringens disease in humans and animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a graph showing the screening results of agarose gel electrophoresis of the LAMP amplification primers for the cpa virulence gene. Lanes 1 to 5 in the graph represent 1: Marker, 2: CPA1, 3: CPA2, 4: CPA3, and 5: negative control, respectively;

[0022] Figure 2 To construct the PCR amplification result diagram of CPA positive standard plasmid, lane M in the figure: Marker, lane 1: CPA positive plasmid, lane 2: negative control;

[0023] Figure 3 This is the result diagram of SYBR GreenⅠ fluorescent dye concentration optimization;

[0024] Figure 4 This is the result diagram of primer amplification temperature optimization;

[0025] Figure 5 This is the result graph of magnesium ion concentration optimization;

[0026] Figure 6 This is the result graph of enzyme concentration optimization;

[0027] Figure 7 This is the result diagram of optimizing the ratio of internal and external primer concentrations;

[0028] Figure 8 This is the result graph of dNTP concentration optimization;

[0029] Fig. 9 This is a sensitivity test result diagram of the real-time fluorescence detection LAMP system;

[0030] Fig.10 This is a graph of CPA specific test results;

[0031] Fig.11This is the validation result of LAMP combined with LFD, where M: DNA molecular standard mass, lane 1: negative control, lane 2: positive quality control, A: negative control, B: positive quality control, Control line: quality control line, Test line: test line;

[0032] Fig.12 This is the result of the LAMP-LFD amplification time detection experiment, where 1 represents 10 min, 2 represents 20 min, 3 represents 30 min, 4 represents 40 min, 5 represents 50 min, 6 represents 60 min, and 7 represents the negative control;

[0033] Fig.13 The sensitivity detection experiment results of LAMP-LFD are shown in Figure 1. The plasmid concentration is 1×10 0 ; 2. Plasmid concentration 1×10 1 ; 3. Plasmid concentration 1×10 2 ; 4. Plasmid concentration 1×10 3 ; 5. Plasmid concentration 1×10 4 ; 6. Plasmid concentration 1×10 5 ;7. Negative control;

[0034] Fig.14 The specific detection experiment result of LAMP-LFD is shown in the figure, where 1 represents the cpa positive standard plasmid, 2 represents Clostridium perfringens (ATCC13124), 3 represents Escherichia coli, 4, Klebsiella pneumoniae; 5, Clostridium putrefaciens; 6, Bacillus cereus; 7, DEPC H2O;

[0035] Figure 11 to Figure 14 The Control line is the quality control line, and the Test line is the cpa virulence gene detection line. DETAILED DESCRIPTION

[0036] The present invention provides a LAMP-LFD primer-probe combination for detecting Clostridium perfringens. The LAMP-LFD primer-probe combination comprises an inner primer, an outer primer and a probe. The nucleotide sequences of FIP and BIP of the inner primers are shown in SEQ ID NOs.9 to 10, the nucleotide sequences of F3 and B3 of the outer primers are shown in SEQ ID NOs.11 to 12, and the nucleotide sequence of the probe is shown in SEQ ID NO.13.

[0037] The present invention uses LAMP technology to design 5 specific primers for 7 regions of the target gene. Compared with the two primers of the traditional PCR technology, the recognition region is increased, the sensitivity is high, the specificity is strong, and the amplification efficiency is high. The target gene is the CPA gene, and the accession number of the target sequence of the CPA gene can be found in NCBI:MW665544.1.

[0038] In the present invention, the 5' end of the FIP of the inner primer is modified with Digoxin, and the 5' end of the probe is modified with Biotin.

[0039] In the present invention, the probe can be used as a primer for amplification, and by modifying the 5' end of the probe with Biotin, it can also be used to specifically identify Clostridium perfringens, thereby achieving the purpose of detecting Clostridium perfringens.

[0040] The present invention provides a kit for detecting Clostridium perfringens, comprising the above-mentioned LAMP-LFD primer-probe combination.

[0041] In the present invention, the kit includes 3 μL of the above-mentioned FIP of 13.33 μM, 3 μL of the above-mentioned BIP of 13.33 μM, 0.25 μL of the above-mentioned F3 of 20 μM, 0.25 μL of the above-mentioned B3 of 20 μM, 0.25 μL of the above-mentioned probe of 20 μM, 4 μL of 10 mM dNTPs, 2 μL of 8000 U / mL Bst2.0 DNA Polymerase, 2.5 μL of 10×Isothermal Amplification buffer, 1.5 μL of 100 mM MgSO4 and 1.5 μL of 10×SYBR GreenⅠ fluorescent dye. The total volume of the kit is 25 μL, and the remainder is supplemented to 25 μL with DEPC water. The present invention adopts the above-mentioned SYBR GreenⅠ fluorescent dye concentration to minimize the inhibitory effect of the LAMP reaction. The present invention judges the LAMP amplification result by fluorescence curve, does not need to open the cover for electrophoresis, avoids the generation of aerosol pollution, and has the advantages of high sensitivity and strong specificity.

[0042] In the embodiment of the present invention, the DNA strand displacement enzyme is Bst 2.0 DNA Polymerase, and the buffer is Isothermal Amplification buffer, both of which are purchased from New England Biolabs, USA, and the product numbers of the DNA strand displacement enzyme and the buffer are both M0537S.

[0043] In the present invention, the kit includes 20 μM of the above-mentioned FIP 3 μL, 20 μM of the above-mentioned BIP 3 μL, 20 μM of the above-mentioned F3 0.25 μL, 20 μM of the above-mentioned B3 0.25 μL, 20 μM of the above-mentioned probe 0.25 μL, 10 mM dNTPs 4 μL, 8000 U / mL Bst2.0 DNA Polymerase 2 μL, 10×Isothermal Amplification buffer 2.5 μL and 100 mM MgSO4 1.5 μL. The total volume of the kit is 25 μL, and the remainder is supplemented to 25 μL with DEPC water. The amplification effect of the present invention using the above-mentioned kit is the best.

[0044] In the present invention, the kit further comprises a lateral flow chromatography test strip, the lateral flow chromatography test strip comprises a nitrocellulose membrane, a detection line and a quality control line are arranged on the nitrocellulose membrane, the detection line is coated with Digoxin monoclonal antibody, and the quality control line is coated with anti-biotin antibody.

[0045] The present invention provides an application of the LAMP-LFD primer-probe combination in preparing a product for detecting Clostridium perfringens or a cpa virulence gene of Clostridium perfringens.

[0046] The present invention provides a method for detecting Clostridium perfringens or its cpa virulence gene for non-diagnostic purposes, comprising the following steps, including amplifying the sample to be tested by the above-mentioned LAMP-LFD primer probe combination or kit. The method for detecting Clostridium perfringens or its cpa virulence gene of the present invention is fast, efficient and simple to operate.

[0047] In the present invention, the amplification temperature is preferably 60-65°C, more preferably 62-64.5°C, more preferably 64°C, and the amplification time is preferably 10-70 min, more preferably 20-40 min, more preferably 30 min; when the above-mentioned LAMP-LFD primer probe combination or kit is used to detect the sample to be tested, the lateral flow chromatography test paper is used to detect the amplification product, and then the test result is judged according to the quality control line (C) and the test line (T), and the result is judged as follows:

[0048] S1, Positive: Red stripes appear on the control line (C) and the test line (T). A positive result indicates that the sample to be tested contains the cpa virulence gene and that the sample to be tested contains Clostridium perfringens;

[0049] S2, negative: red bands appear on the quality control line (C) and no bands appear on the test line (T). The negative result indicates that the sample to be tested does not contain the cpa virulence gene and does not contain Clostridium perfringens.

[0050] S3, invalid: No red stripe appears on the quality control line (C), indicating improper operation or failure of the test card.

[0051] The present invention uses the above LAMP-LFD primer-probe combination to complete the detection of as low as 1×10 1 The detection of cpa virulence genes in the test samples with a concentration of 100 copies / μL can be realized, and the detection results can be visually displayed by lateral flow chromatography test strips.

[0052] The present invention establishes a loop-mediated isothermal amplification (LAMP) technology based on a lateral flow dipstick (LFD), and can quickly detect Clostridium perfringens in a sample to be tested by detecting the cpa virulence gene of Clostridium perfringens. By designing specific LAMP primers for the highly conserved cpa gene, labeling a fluorescent group at the 5' end of the probe primer, and finally combining the lateral flow chromatography test strip technology, the purpose of LAMP detection is achieved. The optimized LAMP-LFD detection system can use a water bath to react at a constant temperature of 64°C for 30 minutes to complete amplification, and the amplified product presents a visual result within 15 minutes through the lateral flow chromatography test strip. The optimized LAMP-LFD detection system has good specificity and can only detect the cpa target gene, and there is no cross reaction with other pathogens. At the same time, the detection system shows high sensitivity, and the detection limit of the cpa gene can reach 1×10 1 When used for actual sample detection, the detection results of the LAMP-LFD method established by the present invention are highly consistent with the PCR detection results, indicating that the detection and identification method is reliable and can meet the detection needs of actual samples.

[0053] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0054] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] The present invention does not specifically limit the source of the colloidal gold immunochromatographic test paper, and conventional commercial products in the field can be used. In the embodiment of the present invention, the colloidal gold immunochromatographic test paper is purchased from Nanjing Zhongding Biotechnology Co., Ltd., item number: AJP12-50T.

[0056] Example 1

[0057] The CPA gene sequence of Clostridium perfringens published in GenBank was selected for homology comparison and cluster analysis, and the target sequence of CPA (NCBI: MW665544.1) was determined. Then three sets of LAMP primer pairs were designed for the target sequence of the CPA gene. The sequence information is shown in Table 1. The three primer pairs were screened for LAMP amplification using Bst 2.0 DNA Polymerase (Cat. No.: M0537S) from New England Biolabs, USA, according to the operating instructions. The genomic DNA of type A Clostridium perfringens ATCC13124 was used as the amplification template. The amplification system for each primer pair was: 10×Isothermal Amplification buffer 2.5 μL, 100 mM magnesium sulfate solution 1.5 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, FIP / BIP final concentration of 1.6 μM, F3 / B3 final concentration of 0.2 μM, 10 mM dNTPs 3.5 μL, DNA template 1 μL, and DEPC H2O supplemented to 25 μL. The amplification program for each primer set was 65°C for 60 min and 85°C for 15 min to terminate the reaction.

[0058] The amplified product was detected by 2% agarose gel electrophoresis. Figure 1 shown.

[0059] according to Figure 1 The electrophoresis results show that the electrophoresis bands of primer set CPA3 are bright and clear, and the band distribution is the most typical, and the amplification results are the best, so primer set CPA3 is selected as the detection primer pair of the present invention.

[0060] Table 1 Sequences to be screened by LAMP primers of CPA gene

[0061]

[0062] Example 2

[0063] Construction of cpa standard plasmid

[0064] According to the primer screening results, F3 / B3 of the preferred primer set CPA3 in Example 1 was selected as a PCR amplification primer, and the genomic DNA of type A Clostridium perfringens ATCC13124 was used as a template to perform a PCR amplification reaction ( Figure 2 ). The target fragments were cloned into pMD18-T Vector (TaKaRa) to obtain recombinant plasmids. The recombinant plasmids were transformed into Escherichia coli for culture, and the plasmids were extracted and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing verification to obtain CPA positive standard plasmids. The concentration of the recombinant plasmid was detected and converted to 1×10 10 copies / μL.

[0065] The plasmid copy number calculation formula is:

[0066] Plasmid copy number (copies / μL) = plasmid concentration ((ng / μL) × 10 -9 ×6.02×10 23 ) / (gene length×660(g / mol))

[0067] The nucleotide sequence of the CPA positive standard plasmid inserted obtained by sequencing is: TTGATGGAACAGGAACTCATGCTATGATTGTAACTCAAGGGGTTTCAATCTTAGAAAATGATCTGTCCAAAAATGAACCAGAAAGTGTAAGAAAAAACTTAGAGATTTTAAAAGAGAACATGCATGAGCTTCAATTAGGTTCTACTTATCCAGATTATGATAAGAACGCCTATGATCTATATCAAGATCATTTCTGGGATCCTGATACAGATAATAA (SEQ ID NO.14).

[0068] Example 3

[0069] A method for detecting Clostridium perfringens or Clostridium perfringens cpa virulence gene loop-mediated isothermal amplification (LAMP), the steps of which are as follows:

[0070] The DNA of the CPA positive standard plasmid prepared in Example 2 was used as a template, and the LAMP amplification system (total volume 25 μL) was prepared according to Table 2, and the primer probe combination in Table 3 was used for LAMP amplification. The amplification reaction program was 64° C., 30 min.

[0071] Table 2 LAMP amplification system (total volume 25 μL)

[0072]

[0073] Table 3 LAMP-LFD primer pairs, probes and fluorescent group information

[0074]

[0075] Example 4

[0076] SYBR GreenⅠ fluorescent dye optimization experiment

[0077] SYBR GreenⅠ fluorescent dye was added to the LAMP reaction system, and the entire reaction process was monitored by a real-time fluorescence quantitative PCR instrument to achieve real-time fluorescence detection of LAMP. The LAMP amplification results were judged by the fluorescence curve. There was no need to open the electrophoresis cover, which avoided the generation of aerosol pollution and had the advantages of high sensitivity and strong specificity. However, the dye had an inhibitory effect on nucleic acid amplification at high concentrations, so the dye concentration was optimized.

[0078] The primer set CPA3 real-time fluorescence LAMP reaction system in Example 3 is: 10×IsothermalAmplification buffer 2.5 μL, 100 mM magnesium sulfate solution 1.5 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, 13.33 μM FIP 3 μL (final concentration of 1.6 μM), 13.33 μM BIP 3 μL (final concentration of 1.6 μM), 20 μM F3 0.25 μL (final concentration of 0.2 μM), 20 μM B3 0.25 μL (final concentration of 0.2 μM), 20 μM probe (LB) 0.25 μL (final concentration of 0.2 μM), 10 mM dNTPs 3.5 μL, the positive CPA plasmid template of Example 2 1 μL, set SYBR The final concentration of GreenⅠ fluorescent dye was: 0.2×, 0.4×, 0.6×, 0.8×, 1.0×, 1.2×, 1.4×, and DEPC H2O was added to 25 μL. The reaction procedure was: preheating at 60℃ for 30s, reacting at 65℃ for 70min, collecting fluorescence signals every minute, and terminating the reaction at 85℃ for 15min.

[0079] The results are as follows Figure 3 As shown, when the final concentration of SYBR GreenⅠ fluorescent dye is 0.6×, the inhibitory effect on the LAMP reaction is small, and the fluorescence value changes significantly, so the final concentration of 0.6×SYBR GreenⅠ fluorescent dye is selected as the subsequent detection concentration of the present invention. The present invention judges the LAMP amplification results by fluorescence curve, does not need to open the cover for electrophoresis, avoids the generation of aerosol pollution, and has the advantages of high sensitivity and strong specificity.

[0080] Example 5

[0081] This example is a LAMP system optimization experiment. In order to determine the optimal LAMP reaction system, the LAMP reaction system was optimized using a single variable method. The cpa positive standard plasmid prepared in Example 2 was used as a template. The LAMP reaction temperature, the ratio of the internal and external primer concentrations, the enzyme concentration, and the dNTPs concentration were gradient optimized by referring to the fluorescent quantitative SYBR Green I dye method in Example 4. DEPC H2O was detected as a negative control (NC).

[0082] (1) Based on the screening results of Example 1, a temperature gradient of 60, 61, 62, 63, 64, and 65°C was set for a single LAMP reaction, the fluorescence signal was monitored by a real-time fluorescence quantitative PCR instrument, the amplification curve was analyzed, and the temperature with the earliest peak was selected as the temperature for the subsequent reaction. The reaction procedure was: preheating at 60°C for 30s, reacting at 60, 61, 62, 63, 64, and 65°C for 70min, collecting the fluorescence signal once every minute, and terminating the reaction at 85°C for 15min.

[0083] The results are as follows Figure 4 As shown, when the amplification reaction temperature is 64°C, the amplification effect is optimal.

[0084] (2) Based on the above results of LAMP reaction temperature optimization, the MgSO4 concentration in the single LAMP system was optimized, and the final concentration gradient of MgSO4 in the LAMP reaction system was set to 2mM, 4mM, 6mM, 8mM, 10mM, 12mM, and 14mM. The fluorescence signal was monitored by real-time fluorescence quantitative PCR instrument, the amplification curve was analyzed, and the MgSO4 concentration with the earliest peak was selected as the MgSO4 concentration for subsequent reactions. The reaction procedure was: preheating at 60℃ for 30s, reacting at 64℃ for 70min, collecting fluorescence signals once per minute, and terminating the reaction at 85℃ for 15min.

[0085] The results are as follows Figure 5 As shown, when the final concentration of MgSO4 in the LAMP amplification system is 6 mM, the LAMP amplification effect is optimal.

[0086] (3) Based on the optimization results of MgSO4 concentration in a single LAMP reaction system, the single LAMP enzyme concentration was optimized. The final concentration gradient of BstDNA polymerase (Bst 2.0DNA Polymerase) in the LAMP reaction system was set to 160U / mL, 320U / mL, 480U / mL, and 640U / mL. The fluorescence signal was monitored by a real-time fluorescence quantitative PCR instrument, and the results of the amplification curve were analyzed. The enzyme concentration with the earliest peak was selected as the enzyme concentration for subsequent reactions. The reaction procedure was: preheating at 60℃ for 30s, reacting at 64℃ for 70min, collecting fluorescence signals every minute, and terminating the reaction at 85℃ for 15min.

[0087] The results are as follows Figure 6 As shown in the figure, when the final enzyme concentration in the LAMP amplification system is 640U / mL, the LAMP amplification effect is optimal.

[0088] (4) Based on the optimization results of the single LAMPBst DNA polymerase concentration, the ratio of the concentration of internal and external primers was optimized for the single LAMP reaction system. The final concentration of the external primers B3 / F3 was set to 0.2 μM, and the concentration ratio of the internal and external primers was set to 1:1, 2:1, 4:1, 6:1, 8:1, 10:1, and 12:1. The fluorescence signal was monitored by a real-time fluorescence quantitative PCR instrument, and the results of the amplification curve were analyzed. The internal and external primer concentration ratio with the earliest peak was selected as the internal and external primer concentration ratio for subsequent reactions. The reaction procedure was: preheating at 60°C for 30 seconds, reacting at 64°C for 70 minutes, collecting fluorescence signals every minute, and terminating the reaction at 85°C for 15 minutes.

[0089] The results are as follows Figure 7 As shown in the figure, when the concentration ratio of inner and outer primers in the LAMP amplification system is 12:1, the LAMP amplification effect is optimal.

[0090] (5) Based on the optimization results of the ratio of the concentration of the inner and outer primers in a single LAMP, the final concentration of dNTPs in the single LAMP system was optimized, and the final concentration gradient of dNTPs in the LAMP amplification system was set to 1.0mM, 1.2mM, 1.4mM, 1.6mM, 1.8mM, and 2.0mM. The fluorescence signal was monitored by a real-time fluorescence quantitative PCR instrument, and the amplification curve was analyzed. The dNTPs concentration with the earliest peak was selected as the dNTPs concentration ratio for the subsequent reaction. The reaction procedure was: preheating at 60℃ for 30s, reacting at 64℃ for 70min, collecting fluorescence signals every minute, and terminating the reaction at 85℃ for 15min.

[0091] The results are as follows Figure 8 As shown in the figure, when the final concentration of dNTPs in the LAMP amplification system is 1.6 mM, the LAMP amplification effect is optimal.

[0092] Example 6

[0093] Real-time fluorescence detection of the sensitivity of the LAMP system

[0094] The reaction system of primer set CPA3 used the CPA positive standard plasmid prepared in Example 2 as a template, and the amounts of other components in the reaction system were added according to the reaction system optimized in Example 5. The reaction procedure was: preheating at 60°C for 1 min, reacting at 64°C for 70 min, and terminating the reaction at 85°C for 15 min. The sensitivity of the LAMP system was evaluated.

[0095] The standard plasmid was diluted 10 times in TE buffer and 1×10 10 copies / μL, 1×10 9 copies / μL, 1×10 8 copies / μL, 1×10 7copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1×10 0 The sensitivity test was performed with a standard plasmid containing 1000 copies / μL of 1000 μ ...

[0096] Sensitivity test results are as follows Fig. 9 As shown. Fig. 9 The results showed that the detection limit of the real-time fluorescence detection LAMP system for CPA gene was 1×10 2 copies / μL.

[0097] Example 7

[0098] Real-time fluorescence detection of specific detection of LAMP system

[0099] This example is a real-time fluorescence LAMP specificity experiment, with CPA positive standard plasmid, Clostridium perfringens (ATCC13124), Escherichia coli (E. coli), Staphylococcus aureus (STA), Klebsiella pneumoniae (KP), Clostridium putrificum (C. putrificum), Bacillus cereus (Bacillus cereus) DNA as template, DEPC H2O as negative control (NC), the amount of other components in the reaction system is added according to the reaction system optimized in Example 5 (see Table 2). The reaction procedure is: preheating at 60°C for 1min, reacting at 64°C for 70min, and terminating the reaction at 85°C for 15min. The primer specificity evaluation and methodological specificity evaluation of the real-time fluorescence LAMP system were carried out.

[0100] The results are as follows Fig.10 As shown, when the CPA positive plasmid and Clostridium perfringens are used as amplification templates, the amplification curve is S-shaped, and the detected fluorescence value changes significantly. When the genomic DNA of Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, Clostridium putrefaciens, and Bacillus cereus and DEPC H2O are used as templates, the amplification curve has no peak, and the detected fluorescence value does not change, indicating that the specificity of the present invention is good. The method has good specificity, and no cross reaction occurs between pathogens.

[0101] Example 8

[0102] Verification Experiment Results of LAMP-LFD

[0103] Based on the screened optimal CPALAMP amplification system, a feasibility verification experiment of LAMP-LFD combined with lateral flow chromatography test strips was carried out.

[0104] 1. LAMP amplification reaction

[0105] Amplification was performed using the CPA3 primer-probe combination described in Example 3. The reaction system for CPA-LAMP amplification was: 2.5 μL of 10×IsothermalAmplificationbuffer, 1.5 μL of 100 mM magnesium sulfate solution, 2 μL of 8000 U / mL Bst2.0 DNA Polymerase, 2.4 μM final concentration of FIP / BIP, 0.2 μM final concentration of F3 / B3, 0.2 μM final concentration of CPA-Prob, 4 μL of 10 mM dNTPs, 1 μL of the CPA positive standard plasmid prepared in Example 2, and DEPC H2O supplemented to 25 μL (see Table 2);

[0106] The nucleotide sequence of the probe is shown in SEQ ID NO. 13. The 5' end of the probe is modified with biotin, and the 5' end of the FIP is modified with digoxin.

[0107] The reaction procedure of CPALAMP amplification was as follows: 60 min at 64°C and 15 min at 85°C to terminate the reaction.

[0108] 2. The kit also includes a colloidal gold immunochromatographic test strip: the colloidal gold immunochromatographic test strip is a base plate and a sample pad, a conjugation pad, a detection pad and an absorption pad connected to the base plate in sequence from bottom to top. The conjugation pad is loaded with anti-biotin antibodies labeled with colloidal gold; the detection pad is provided with a detection line and a quality control line; the detection line is coated with a detection line of anti-Digoxin antibodies; the quality control line is coated with anti-mouse antibodies. The base plate is a PVC base plate, and the material of the detection pad is preferably a nitrocellulose membrane (NC membrane). When there is a Biotin-Digoxin conjugate in the sample to be tested, a colloidal gold marker-target detection substance-antibody complex will be formed and enriched on the corresponding detection line to form a red precipitation line.

[0109] The quality control area (C) is the standard for judging whether the sample is sufficient and whether the chromatography is normal. Regardless of whether the nucleic acid amplification product with markers exists in the sample, the quality control line (C) will show a red strip. If no red strip appears on the quality control line (C), it indicates that the test result is invalid.

[0110] 3. After the LAMP amplification reaction is completed, take 2 μL of LAMP amplification product and dilute it 50 times with amplification product diluent. After mixing, take 50 μL and drop it on the sample well (i.e. the sample pad of the test strip). Interpret the test results according to the quality control line (C) and the test line (T) within 15 minutes.

[0111] Result judgment:

[0112] S1, Positive: Colored bands appear on the control line (C) and the test line (T). The positive result indicates that the sample to be tested contains the cpa virulence gene and the sample to be tested contains Clostridium perfringens;

[0113] S2, negative: The quality control line (C) has a colored band, and the test line (T) has no band. The negative result indicates that the sample to be tested does not contain the cpa virulence gene, and the sample to be tested does not contain Clostridium perfringens, or its number is less than the minimum detection limit of the test strip.

[0114] S3, invalid: No colored band appears on the quality control line (C), indicating improper operation or invalid test card.

[0115] The results are as follows Fig.11 As shown, the LAMP system combined with the single-lateral flow chromatography test strip has a good effect and can be used for the next experiment.

[0116] Example 9

[0117] This example is to detect the amplification time of LAMP-LFD. Referring to the method of Example 6, the reaction time of the LAMP system is set to 10min, 20min, 30min, 40min, 50min, and 60min. After the amplification reaction is completed, the optimal reaction time of LAMP is determined by observing the lateral flow chromatography test paper.

[0118] Lateral flow chromatography test strip results Fig.12 As shown, when the reaction time is 20 minutes, a light-colored band appears in the T region, and when the reaction time is 30 minutes, a bright and clear red band appears in the T region. The results show that the LAMP LFD system of the present invention can complete constant temperature amplification within 20 minutes at the fastest.

[0119] Example 10

[0120] This example is a LAMP-LFD sensitivity experiment. The CPA positive standard plasmid prepared in Example 2 was used as a template and the method in Example 6 was used to evaluate the sensitivity of the LAMP-LFD system. The CPA standard plasmid was diluted 10 times in TE buffer and 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1×10 0 The sensitivity experiment was performed with CPA positive standard plasmid at 1000 copies / μL. DEPC H2O was used as a negative control. After the amplification reaction was completed, the detection limit of the LAMP-LFD system was determined by observing the lateral flow chromatography test paper.

[0121] Lateral flow chromatography test strip results Fig.13 As shown, select 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 When the sensitivity test was performed on the standard plasmid with a concentration of 1×10 0 No bands were produced in the negative control area C. Therefore, the detection limit of the present invention is 1×10 1 copies / μL.

[0122] Embodiment 11

[0123] This example is a LAMP-LFD specificity experiment. The CPA positive standard plasmid prepared in Example 2, Clostridium perfringens (ATCC13124), Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, Clostridium putrefaciens, and Bacillus cereus DNA were used as templates. Under the optimal system and optimal reaction conditions, the primer specificity evaluation and methodological specificity evaluation of the LAMP-LFD system were performed with reference to the method of Example 3.

[0124] The results are as follows Fig.14 As shown, when CPA positive standard plasmid and Clostridium perfringens DNA were used as templates, bright and clear red bands appeared in the test line T. When Escherichia coli, Klebsiella pneumoniae, Clostridium putrefaciens, Bacillus cereus DNA and DEPC H2O were used as amplification templates, no red bands appeared in the test line T, and red bands appeared in the control line C. The results show that the present invention has good specificity for detecting Clostridium perfringens. The methodology has good specificity, and no cross reaction occurs between pathogens.

[0125] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A LAMP-LFD primer-probe combination for detecting Clostridium perfringens, characterized in that the LAMP-LFD primer-probe combination comprises an inner primer, an outer primer and a probe, the nucleotide sequences of the inner primers FIP and BIP are shown in SEQ ID NOs.9 to 10, the nucleotide sequences of the outer primers F3 and B3 are shown in SEQ ID NOs.11 to 12, and the nucleotide sequence of the probe is shown in SEQ ID NO.

13. 2 . The LAMP-LFD primer-probe combination according to claim 1 , wherein the 5′ end of the FIP of the inner primer is modified with Digoxin, and the 5′ end of the probe is modified with Biotin.

3. A kit for detecting Clostridium perfringens, characterized in that it comprises the LAMP-LFD primer-probe combination according to claim 1 or 2.

4. The kit according to claim 3 is characterized in that the kit comprises 3 μL of 13.33 μM FIP described in claim 1, 3 μL of 13.33 μM BIP described in claim 1, 0.25 μL of 20 μM F3 described in claim 1, 0.25 μL of 20 μM B3 described in claim 1, 0.25 μL of 20 μM probe described in claim 1, 4 μL of 10 mM dNTPs, 2 μL of 8000 U / mL Bst 2.0 DNA Polymerase, 2.5 μL of 10×Isothermal Amplification buffer, 1.5 μL of 100 mM MgSO4 and 1.5 μL of 10×SYBR GreenⅠ fluorescent dye.

5. The kit according to claim 3 is characterized in that the kit comprises 3 μL of 20 μM FIP described in claim 2, 3 μL of 20 μM BIP described in claim 2, 0.25 μL of 20 μM F3 described in claim 2, 0.25 μL of 20 μM B3 described in claim 2, 0.25 μL of 20 μM probe described in claim 2, 4 μL of 10 mM dNTPs, 2 μL of 8000 U / mL Bst 2.0 DNA Polymerase, 2.5 μL of 10×Isothermal Amplification buffer and 1.5 μL of 100 mM MgSO4.

6. The kit according to claim 5 is characterized in that the kit also includes a lateral flow chromatography test strip, the lateral flow chromatography test strip includes a nitrocellulose membrane, a detection line and a quality control line are provided on the nitrocellulose membrane, the detection line is coated with Digoxin monoclonal antibody, and the quality control line is coated with anti-mouse antibody.

7. Use of the LAMP-LFD primer-probe combination according to claim 1 or 2 in the preparation of a product for detecting Clostridium perfringens or the cpa virulence gene of Clostridium perfringens.

8. A method for detecting Clostridium perfringens or its cpa virulence gene for non-diagnostic purposes, characterized in that it comprises the following steps, including amplifying the sample to be tested using the LAMP-LFD primer-probe combination described in claim 1 or 2 or the kit described in any one of claims 3 to 6.

9. The method according to claim 8, characterized in that the amplification temperature is 60-65°C and the amplification time is 10-70 minutes.

10. The method according to claim 8 or 9, characterized in that when the LAMP-LFD primer-probe combination according to claim 2 or the kit according to claim 5 or 6 is used to detect the sample to be tested, the amplification product is detected using the lateral flow chromatography test paper, and the test result is interpreted according to the quality control line and the test line, and the result is determined in the following manner: S1, positive: red stripes appear on the quality control line and the test line. The positive result indicates that the sample to be tested contains the cpa virulence gene and the sample to be tested contains Clostridium perfringens; S2, negative: red bands appear on the quality control line and no bands appear on the test line. The negative result indicates that the sample to be tested does not contain the cpa virulence gene, and the sample to be tested does not contain Clostridium perfringens; S3, invalid: No colored bands appear on the quality control line, indicating improper operation or invalid test card.

Images