Method and device for realizing high-sensitivity plant transgenic component and integration site identification by using LAM-PCR (LAMP-Polymerase Chain Reaction) technology

Abstract

The invention discloses a method and a device for realizing high-sensitivity plant transgenic component and integration site identification by using an LAM-PCR (LAMP-Polymerase Chain Reaction) technology. The method comprises the following steps: reading sequencing data of a plant to be identified; integrating the reference genome of the source plant and the reference sequence of the transgenic universal element to obtain a mixed sequence; comparing the sequencing data with the mixed sequence; and determining whether transgenic components exist in the to-be-identified plant or not during comparison. According to the invention, the same experimental scheme is combined with a set of complete information analysis scheme, transgenic component and integration site identification can be respectively carried out based on different transgenic elements, and the detection accuracy and sensitivity are improved; the method can be suitable for high-throughput sequencing analysis of different integration site detection technologies; the analysis process is simple to deploy and convenient to use, and can be quickly applied to related data detection after being deployed on a computing server.

Description

Technical Field

[0001] The invention belongs to the technical field of plant transgenic technology and relates to a method and a device for realizing high-sensitivity identification of plant transgenic components and integration sites by utilizing LAM-PCR technology. Background Art

[0002] As the core of modern biotechnology, transgenic technology refers to the method of transferring one or more exogenous genes or sequences to target species by using molecular biology and genetic engineering technology in order to obtain new traits and new varieties. In recent years, this technology has played a significant role in promoting gene function research, variety improvement and cultivation, reducing the use of pesticides to achieve green agricultural development, etc. In Agrobacterium-mediated plant transgenic, Agrobacterium randomly transfers the exogenous genes carried by T-DNA into the genome. Since the insertion site of T-DNA in the plant genome and the number of T-DNA inserted into the genome are random, the safety assessment of transgenic plants is becoming increasingly important. Among them, the "Administrative Measures for Safety Assessment of Agricultural Transgenic Organisms" clearly states that the safety assessment of transgenics includes the size, structure and function of the inserted / deleted sequence, the location of the inserted sequence in the plant cell (whether it is integrated into the chromosome, chloroplast, mitochondria, or exists in a non-integrated form) and its determination method.

[0003] The transgenic detection scheme mainly screens for common elements in transgenic products, including promoters, terminators, and resistance screening genes. At present, the screening agents used in genetic transformation are mainly antibiotics and herbicides. The main antibiotics are kanamycin and hygromycin B. Among them, hygromycin B has been widely used in genetic transformation due to its short screening time, significant effect, low false positive, and small gene difference. The HPT gene encodes hygromycin B phosphotransferase (HPT), which is the most commonly used type of selection marker gene in genetic transformation. HPT can phosphorylate and inactivate hygromycin B. Hygromycin is an aminoglycoside antibiotic that can destroy the function of ribosomes in cells, leading to cell death due to blocked gene translation. Under selection pressure, non-transformed cells and tissues that do not contain marker genes and their products die, and transformed cells can continue to survive, divide, and differentiate into plants due to resistance. In addition, the strong promoter sequence pCaMV35S, its corresponding terminator sequence t35S, terminator tNOS and ubiquitin gene promoter pUbi are common transgenic elements in rice transgenes and can be used for transgenic plant screening. By batch testing the above elements, if any of them is detected as positive, it indicates that the sample may contain transgenic components. If the results of each element tested are negative, it means that no transgenic components of known elements have been detected in the sample.

[0004] At present, the technologies for DNA detection of transgenics include PCR amplification, Southern hybridization, gene chips and whole genome sequencing (WGS). The above methods have different characteristics. Among them, Southern hybridization can evaluate the copy number of transgenic elements, but the resolution of this method is low and it is impossible to determine the specific insertion site. Gene chips hybridize through probes on microarrays to determine whether there are transgenic components. However, the chip design cost of this method is high and the operation is complicated. Whole genome sequencing directly breaks the DNA in the test sample, performs NGS library construction and sequencing, and obtains the sequence information of the whole genome. Although this method can identify transgenic components and analyze insertion sites, the proportion of transgenic data captured is very low, and the amount of sequencing data is significantly affected by the size of the plant genome. In addition, the WGS method greatly increases the sequencing cost and computing requirements, and has obvious detection limitations for samples with low template amount and low transgenic ratio. According to the needs of transgenic detection, PCR amplification technology has also derived a series of methods for identifying transgenic insertion sites, such as inverse PCR (iPCR), thermal asymmetric staggered PCR (Tail-PCR), linear amplification PCR, PCR-Walking and other methods, which are amplified and sequenced by Sanger. However, the above PCR method is relatively complicated to operate and is generally used for insertion site identification. In view of the limitations of the above technology, it is necessary to develop a new Summary of the invention

[0005] An object of the present invention is to solve at least the above problems and / or disadvantages and to provide at least the advantages which will be described hereinafter.

[0006] Another object of the present invention is to provide a method and device for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology.

[0007] To this end, the technical solution provided by the present invention is:

[0008] In the first aspect, a method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology comprises the following steps:

[0009] 1) Reading the sequencing data of the plant to be identified;

[0010] 2) Integrate the reference genome of the source plant with the reference sequence of the universal transgenic element to obtain a hybrid sequence;

[0011] 3) Comparing the sequencing data with the mixed sequence, and determining whether the transgenic component exists in the plant to be identified.

[0012] Preferably, in the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, the integration site information of the transgenic components is also obtained during the comparison.

[0013] Preferably, in the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, reading the sequencing data of the plant to be identified comprises the following steps:

[0014] Several unidirectional primers are designed for multiple transgenic universal elements, and the gene library of the plant to be identified is obtained through three rounds of PCR based on LAM-PCR technology.

[0015] The gene library is sequenced based on the NGS sequencing method to obtain sequencing data.

[0016] Preferably, in the method for achieving high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, in step 3), during the comparison, if reads that are simultaneously aligned with the reference genome and the reference sequence of the transgenic universal element can be extracted, it is considered that the transgenic component is present in the plant to be identified.

[0017] Preferably, in the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, the reads extracted and aligned with the reference genome and the reference sequence of the universal transgenic element are analyzed for integration status, including integration site, integration mode, etc.; then, the integration ratio statistics are performed for the identified integration site, and the site is filtered according to the set analysis threshold to finally obtain the integration site information.

[0018] Preferably, in the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, Target_ratio (%)>5e-04 is set.

[0019] Preferably, in the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, the filtering thresholds are set as follows: HPT Effective ratio (%)>0.1, pCaMV35S Effective ratio (%)>5e-03.

[0020] Preferably, in the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, site filtering is performed according to single site integration Ratio (Support_reads / Split_reads)>1%, integration site sequencing depth DP>10, and Support reads>=5.

[0021] Preferably, the method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology further comprises the following steps:

[0022] Compare and evaluate the results.

[0023] Second, a device for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, including:

[0024] A wet experiment process module, which is used to read the sequencing data of the plants to be identified;

[0025] The dry experimental process module is used to integrate the reference genome of the source plant with the reference sequence of the universal transgenic element to obtain a mixed sequence; it is also used to compare the sequencing data with the mixed sequence, and determine whether the transgenic component exists in the plant to be identified during the comparison.

[0026] Preferably, the device for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology further comprises:

[0027] The sample test result module is used to analyze the test sample information, transgenic component identification results and transgenic insertion sites.

[0028] Preferably, the device for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology further comprises:

[0029] The performance evaluation result module is used to evaluate the results.

[0030] The present invention has at least the following beneficial effects:

[0031] The present invention utilizes LAM-PCR combined with NGS sequencing technology to simultaneously realize transgenic screening and insertion site identification;

[0032] The method of the present invention has a high detection sensitivity, and the proportion of transgenics can be as low as 0.1%;

[0033] According to the test case results of the present invention, the proportion of transgenic sequences can be accurately calculated based on the proportion of transgenic sequences;

[0034] The present invention provides a complete set of transgenic identification schemes, including experimental schemes, analysis schemes, etc. The method is also widely applicable to the identification of other transgenic plants and elements.

[0035] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 4 is a flow chart of bioinformatics analysis in an embodiment of the present invention.

[0037] Figure 2 Graph showing the linear relationship between the analysis parameters and the dilution gradient in an embodiment of the present invention.

[0038] Figure 3 This is a diagram of the verification results of the chr03:33372778 site in an embodiment of the present invention, wherein blue represents the transgenic vector sequence and yellow represents the host genome sequence.

[0039] Figure 4 This is a diagram of the verification results of the chr07:17668081 site in an embodiment of the present invention, wherein blue represents the transgenic vector sequence and yellow represents the host genome sequence. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0041] It should be understood that terms such as “having”, “including” and “comprising” used herein do not specify the existence or addition of one or more other elements or combinations thereof.

[0042] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0043] The present invention has developed a transgenic component identification scheme based on LAM-PCR (Linear amplification mediated PCR) technology combined with NGS sequencing. The scheme can perform batch detection of multiple transgenic elements with extremely high accuracy, sensitivity, and linear relationship, and can also perform high-resolution identification of insertion sites.

[0044] The present invention has:

[0045] 1. Comprehensiveness

[0046] The present invention adopts the same experimental scheme combined with a complete set of bioinformatics analysis schemes, which can identify transgenic components and integration sites based on different transgenic elements, thereby improving detection accuracy and sensitivity.

[0047] 2. Universality

[0048] The bioinformatics analysis process of the present invention can be applied to high-throughput sequencing analysis of different integration site detection technologies, such as WGS sequencing.

[0049] 3. Ease of analysis

[0050] The analysis process in the present invention is simple to deploy and easy to use, and can be quickly applied to relevant data detection after being deployed on a computing server.

[0051] In order to enable those skilled in the art to better understand the technical solution of the present invention, the following embodiments are provided for illustration:

[0052] A method for highly sensitive identification of plant transgenic components and integration sites using LAM-PCR technology.

[0053] The present invention comprises 4 main modules, namely a wet experiment process module, a dry experiment process module, a sample test result module, and a performance evaluation result module.

[0054] 1Wet experiment process module

[0055] (1) Primer design for universal vector sequences in rice

[0056] Three unidirectional primers were designed for each universal element sequence (e.g., HPT, pCaMV35S, t35S_LB) for target sequence amplification and enrichment. The primer sequences are shown in the following table:

[0057] Table 1 Primer sequence information

[0058]

[0059]

[0060] (2) Experimental process

[0061] 200 ng gDNA was captured by linear PCR using the first round primer 01R (SEQ ID NO: 1, 4, 7), followed by TDT to add C to the end of the product, and then the primer containing oligoG at the 3' end was used for dsDNA synthesis; then the second round primer 02R was used for (SEQ ID NO: 2, 5, 8) the first round of PCR amplification; the amplified product was cut by Tn5 transposase and the Adapter was added to the end; the cut product with the Adapter sequence was further enriched by the second round of PCR amplification using the 03R (SEQ ID NO: 3, 6, 9) primer. Finally, the third round of PCR amplification was performed using Illumina universal primers to obtain the final library. After the purified library was qualified by quality control such as concentration and fragment size, it was pooled according to 0.5G data volume and then sequenced on the machine (PE150).

[0062] 2. Experimental process module

[0063] The dry experiment analysis module mainly includes the following parts: according to the host source (rice), the corresponding reference genome is downloaded from NCBI, and the commonly used vector element sequences (for example, HPT, pCaMV35S, t35S_LB) are integrated to build a comparison index; quality assessment and low-quality sequence removal are performed based on the original sequencing data after downloading the machine to obtain high-quality sequencing sequences, which are then aligned to the host and vector; reads (i.e. softclip reads) that can be aligned to both the vector and host genomes are extracted to analyze the integration status, including integration sites, integration methods, etc.; then the integration ratio statistics are performed for the identified integration sites, and filtering is performed according to the set analysis threshold to finally obtain the integration site information. The analysis flow chart is as follows: Figure 1 shown.

[0064] 3 Sample test result module

[0065] 3.1 Test sample information

[0066] The positive samples were diluted to 0.05, 0.01, 0.002, and 0.001 using the transgenic negative samples, and a non-plant sample (CK) was added as a control sample for different hosts to identify the transgenic components. The t35S_LB element is located in the vector integration boundary region, so the transgenic insertion site analysis was performed based on this element.

[0067] Table 2 Test samples

[0068]

[0069]

[0070] 3.2 Test Results

[0071] (1) Data quality control

[0072] After performing basic quality control on the data from the machine and removing sequences with low sequencing quality, the statistical sample quality control results are as follows

[0073] Table 3 Test sample quality control results

[0074]

[0075]

[0076] Note: Sample: sample number; Raw Bases (G): number of raw sequencing bases; Q20 (%): number of bases with sequencing quality values ​​greater than 20; Q30 (%): number of bases with sequencing quality values ​​greater than 30; GC (%): GC content; Clean Bases: number of bases after quality control (percentage of bases after quality control); MapRatio (%): alignment ratio; DupRatio (%): duplication rate; Softcliped_tot_ratio (%): ratio of softclip reads to reads after quality control.

[0077] (2) Identification results of transgenic components

[0078] The following are the statistics of transgenic components based on the HPT and pCaMV35S elements for reads coverage, average depth, target reads ratio and other parameters. Since there may be trace positive sample contamination or index splitting contamination during the transgenic detection process, it is necessary to set appropriate filtering thresholds for negative and positive samples for transgenic component identification to avoid false positive detection results. According to the effective reads coverage on each target transgenic element, the Target_ratio(%)>5e-04 threshold can be used to distinguish between negative and positive samples. According to the effective reads ratio of all transgenic sequences, the filtering threshold can be set to HPT Effective ratio(%)>0.1, pCaMV35SEffective ratio(%)>5e-03.

[0079] Table 4 Statistics of genetically modified ingredient identification results

[0080]

[0081]

[0082] Note: Sample: sample number; TotalBases: sequence length of target sample detection element; CovBases: reads coverage length of target sample detection element; CovRatio(%): reads ratio of target sample detection element; Ave_Depth: average sequencing depth of target element; Mapped Reads: number of mapped reads of target element; Target_ratio(%): effective reads coverage on a single transgenic element; Effective_ratio(%): effective reads ratio on transgenic sequence.

[0083] (3) Analysis of transgene insertion sites

[0084] Vector insertion site analysis was performed based on the t35S_LB element, and site filtering was performed based on single site integration Ratio (Support_reads / Split_reads)>1%, integration site sequencing depth DP>10, and Support reads>=5. The transgenic insertion sites finally identified are shown in Table 5. A total of two transgenic integration sites, chr03:33372778 and chr07:17668081, were identified, of which chr03:33372778 could be detected in a lower positive sample gradient (0.001), which is related to the capture efficiency, integration efficiency and ratio of the two insertion sites at the integration position in the sample.

[0085] 4Performance Evaluation Result Module

[0086] 4.1 Sensitivity

[0087] HPT and pCaMV35S single-end amplification primers were combined to identify transgenic positive samples. The filtering threshold was: target element reads efficiency > 0.05%, or based on the total transgenic elements, target reads efficiency: HPT > 0.001 or pCaMV35S > 5e-05. The sensitivity of transgenic component identification could be as low as 0.1% (Table 4).

[0088] 4.2 Linear Relationship

[0089] Based on the linear relationship, the transgenic ratio in the test sample can be determined according to the HPT and pCaMV35S target element reads efficiency (Target_ratio(%)) values, and the calculation formula is: transgenic ratio = Target_ratio(%) / 0.15.

[0090] 4.3 Accuracy of integration site identification

[0091] The target insertion site was verified using Sanger with 100% accuracy. Figure 3 and Figure 4 These are the Sanger verification results for the two loci chr03: 33372778 and chr07: 17668081.

[0092] Table 5 Identification of transgenic insertion sites

[0093]

[0094] Note: Sample: sample number; Chr: host insertion site chromosome; Pos: host insertion position; Vector_pos: vector integration position; Support_reads: the number of reads supporting the integration of this site; Split_reads: the number of reads of host and vector integration in this sample; DP: the total number of reads covering this integration site; Ratio: integration ratio of this site (Support_reads / Split_reads); AF: allele frequency (Support_reads / DP).

[0095] Universal element sequences for primer design:

[0096] >pCaMV35S (SEQ ID NO: 10)

[0097] CCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGC TTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTACTGTCACTTTATTGTGAAGAT AGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGA CGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCATTTGGAGAGGACA

[0098] >t35S_LB (SEQ ID NO: 11)

[0099] TGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAA TTAGAATTTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGGAACTACTCACACATTATTATGGAGAAA

[0100] >HPT(SEQ ID NO:12)

[0101]

[0102] The innovation of the present invention is:

[0103] 1. Provides a scheme for identifying transgenic components based on LAM_PCR technology, with a sensitivity of up to 1%;

[0104] 2. An innovative method was proposed to identify transgenic components and transgenic insertion sites by combining different transgenic elements;

[0105] 3. A scheme for calculating the transgenic ratio based on the transgenic sequence capture efficiency was proposed.

[0106] The present invention also provides a device for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, comprising:

[0107] A wet experiment process module, which is used to read the sequencing data of the plants to be identified;

[0108] The dry experimental process module is used to integrate the reference genome of the source plant with the reference sequence of the universal transgenic element to obtain a mixed sequence; it is also used to compare the sequencing data with the mixed sequence, and determine whether the transgenic component exists in the plant to be identified during the comparison.

[0109] The sample test result module is used to analyze the test sample information, transgenic component identification results and transgenic insertion sites.

[0110] The performance evaluation result module is used to evaluate the results.

[0111] The present invention also provides an electronic device, which includes: at least one processor, and a memory connected to the at least one processor in communication, wherein the memory stores instructions that can be executed by the at least one processor, and the instructions are executed by the at least one processor to enable the at least one processor to execute a method. For example, the above-mentioned memory and processor are connected together via a bus, and can be a general memory and processor, which is not specifically limited here. When the processor runs the computer program stored in the memory, it can execute the training method, device and various operations and functions of the recommendation model of the contrast learning sequence based on the self-guided mechanism of the present invention. The electronic device may include but is not limited to: a personal computer, a server computer, a workstation, a desktop computer, a laptop computer, a notebook computer, a mobile computing device, a smart phone, a tablet computer, a personal digital assistant (PDA), a handheld device, a messaging device, a wearable computing device, and the like.

[0112] The present invention also provides a storage medium on which a computer program is stored, and when the program is executed by a processor, a method is implemented. For specific implementation, please refer to the method embodiment, which will not be repeated here. Specifically, a system or device equipped with a storage medium can be provided, on which a software program code for the function of any embodiment of the training method, device and recommendation method and device of the recommendation model of the contrast learning sequence of the above-mentioned self-booting mechanism is stored, and the computer or processor of the system or device reads and executes the instructions stored in the storage medium. The program code read from the storage medium itself can implement the function of any one of the embodiments in the above-mentioned embodiments, so the machine-readable code and the storage medium storing the machine-readable code constitute a part of the present invention. The storage medium includes but is not limited to a floppy disk, a hard disk, a magneto-optical disk, an optical disk, a magnetic tape, a non-volatile memory card and a ROM. The program code can also be downloaded from a server computer or a cloud via a communication network.

[0113] It should be noted that, in the above-mentioned processes and system structures, not all steps and modules are necessary, and some steps and units can be ignored according to actual needs. The execution order of each step is not fixed and can be determined as needed. The device structure described in the above-mentioned embodiments can be a physical structure or a logical structure. A module or unit may be implemented by the same physical entity, a module or unit may be implemented by multiple physical entities respectively, and a module or unit may also be implemented by multiple components in multiple independent devices.

[0114] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A method for highly sensitive identification of transgenic components and integration sites of plants using LAM-PCR technology, characterized in that: The steps include: 1) Reading the sequencing data of the plant to be identified; 2) Integrate the reference genome of the source plant with the reference sequence of the universal transgenic element to obtain a hybrid sequence; 3) aligning the sequencing data with the mixed sequence; 4) Determine during the comparison whether there is a transgenic component in the plant to be identified.

2. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology according to claim 1, characterized in that: The integration site information of the transgenic component is also obtained during the comparison.

3. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: Reading the sequencing data of the plant to be identified includes the following steps: Several unidirectional primers are designed for multiple transgenic universal elements, and the gene library of the plant to be identified is obtained through three rounds of PCR based on LAM-PCR technology. The gene library is sequenced based on the NGS sequencing method to obtain sequencing data.

4. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: In step 3), during the comparison, if reads that are simultaneously aligned to the reference genome and the reference sequence of the transgenic universal element can be extracted, it is considered that the transgenic component is present in the plant to be identified.

5. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: Analyze the integration of the extracted reads that are aligned to the reference genome and the reference sequence of the universal transgenic element; Subsequently, the integration ratio statistics were performed for the identified integration sites, and they were filtered according to the set analysis threshold to finally obtain the integration site information.

6. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: Set Target_ratio(%)>5e-04.

7. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: Filtering threshold settings: HPT Effective ratio (%)>0.1, pCaMV35SE effective ratio (%)>5e-03.

8. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: Site filtering was performed based on single site integration Ratio (Support_reads / Split_reads)>1%, integration site sequencing depth DP>10, and Support reads>=5.

9. The method for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology as claimed in claim 1, characterized in that: The following steps are also included: Compare and evaluate the results.

10. A device for realizing high-sensitivity identification of plant transgenic components and integration sites using LAM-PCR technology, characterized in that: include: A wet experiment process module, which is used to read the sequencing data of the plants to be identified; The dry experimental process module is used to integrate the reference genome of the source plant with the reference sequence of the universal transgenic element to obtain a mixed sequence; it is also used to compare the sequencing data with the mixed sequence, and determine whether the transgenic component exists in the plant to be identified during the comparison.

Images