A detection kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses and its use method

Abstract

The present invention relates to the field of biomedical detection technology, and in particular to a detection kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses based on recombinase polymerase amplification technology (RPA) and a method for using the same. First, the present invention provides a primer-probe combination for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, which has the advantages of high accuracy and fast detection speed compared to the existing fluorescent quantitative PCR detection method. On this basis, the present invention provides a rapid isothermal amplification kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, the kit containing the above-mentioned primer probes and a microfluidic nucleic acid detection chip, and the kit also includes a buffer, an RPA amplification reaction system and an RNA extraction kit. The kit can be used to detect H5, H7 and H10 subtype avian influenza viruses, with high accuracy and fast speed, and the results can be obtained in about 30 minutes.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to a synchronous rapid detection kit for H5, H7 and H10 subtype avian influenza viruses based on recombinase polymerase amplification (RPA) technology and a method for using the kit. Background Art

[0002] Avian influenza (especially highly pathogenic avian influenza) is a respiratory infectious disease with great harm. Among them, highly pathogenic avian influenza is an acute infectious disease common to humans, poultry and livestock caused by H5 and H7 subtype virus strains. Highly pathogenic avian influenza spreads quickly among poultry, causing great harm and high mortality. Highly pathogenic avian influenza virus can directly infect humans. Once it occurs, it is often very serious, especially for people with low immunity, including pregnant women, children, patients with more underlying diseases and the elderly. Severe pneumonia may occur, and poisoning-like symptoms such as fever, nasal congestion, runny nose, sputum, muscle and joint pain may occur. Some severe patients may also experience pneumonia or respiratory distress, accompanied by failure and lesions of multiple other organ systems, leading to death.

[0003] The diversity of avian influenza virus strains hinders its specific detection, so it is necessary to develop a rapid, selective and sensitive diagnostic method to quickly and synchronously detect different subtypes of avian influenza virus. In particular, in recent years, there have been reports of human cases of H10N3, H10N5 and H5N6 subtype influenza virus infection at home and abroad, which should be taken seriously. There are currently many methods for detecting influenza. The traditional method for identifying influenza virus is to routinely isolate the virus according to the "National Clinical Laboratory Operation Procedures". These detection methods not only require professional technicians and complex equipment and instruments, but also the identification process is time-consuming (more than 2 days), complicated to operate, and low in sensitivity. Among the many clinical detection methods for avian influenza virus that have been developed, virus culture is the most conventional. However, it takes up to 14 days to detect the target virus using cell culture. Direct fluorescent immunoassay based on viral surface antigen detection has been used to quickly identify influenza viruses. However, due to the cross-reactivity and low detection sensitivity of the antibodies used in the immunoassay, it cannot effectively type influenza viruses at the same time. In order to accurately identify the type of influenza virus, molecular real-time diagnostic methods including RT-PCR (Reverse Transcription-Polymerase Chain Reaction) are usually used. However, fluorescent quantitative PCR is the preferred solution for virus detection at this stage, but it has the following limitations: (1) It is easy to produce aerosol contamination, resulting in false positive results. It requires professionally trained technicians with PCR job certificates, professional PCR certification laboratories, and expensive temperature change control analysis instruments; (2) Traditional fluorescent quantitative PCR sample nucleic acid extraction and amplification detection are carried out in two steps, and it takes at least 2-3 hours from sampling to issuing test results. Although multiplex PCR real-time amplification technology for a single target gene has been developed recently, its amplification detection process of up to 90 to 120 minutes and the strict requirements on experimental equipment and experimental personnel are obviously not suitable for rapid detection.

[0004] In order to further improve the level of nucleic acid detection and achieve more convenient and rapid nucleic acid detection, various isothermal amplification technologies are increasingly attracting attention, and their application scope is constantly expanding. On the one hand, isothermal amplification generally uses a constant temperature reaction mode to achieve nucleic acid amplification, thereby significantly reducing the complexity of the device; on the other hand, isothermal amplification guides nucleic acid amplification through the interaction of multiple reaction enzymes, omitting the repeated heating and cooling process of PCR, thereby significantly shortening the nucleic acid detection time. Therefore, compared with PCR, isothermal amplification has several significant advantages in terms of device simplicity, rapid detection, convenient operation and low cost, and is particularly suitable for on-site instant nucleic acid detection.

[0005] As a new technology platform, microfluidic chips can automatically complete multiple reaction steps such as reaction and detection of detection samples by means of the microfluidic network composed of various functional units such as micro-reaction holes and micro-channels integrated inside. On the one hand, it is conducive to the realization of closed-type automated detection of "sample in-result out", significantly improving the detection efficiency; on the other hand, it is conducive to the realization of high-throughput, parallel, and even multi-target multiple detection, significantly improving the overall detection level. With the centrifugal force generated by the circular motion of the chip driven by the micromotor as the driving force of the fluid, the flow direction and flow rate of the fluid can be adjusted and controlled by changing the rotation speed of the chip and adjusting the channel configuration. Traditional lab-on-chip chip platforms are often easily limited by their own structures in terms of detection flux, system flexibility and active fluid drive. The centrifugal isothermal amplification microfluidic chip platform uses convenient centrifugal force to realize active fluid drive, and due to the symmetry of the disk structure and centrifugal force, it is often easy to achieve high-throughput and parallel detection, and the system flexibility is significantly improved, all of which lay a solid foundation for the realization of an integrated microfluidic system with high integration and multi-index parallel detection.

[0006] This shows that there is an urgent need to develop a method that can quickly and effectively detect different subtypes of avian influenza viruses simultaneously in clinical practice. Summary of the invention

[0007] The purpose of the present invention is to provide a rapid isothermal amplification kit and a method for using the kit for synchronously detecting H5, H7 and H10 subtype influenza viruses in view of the deficiencies in the prior art. The kit has the characteristics of high accuracy and fast detection speed, and can specifically and synchronously rapidly detect H5, H7 and H10 subtype avian influenza viruses.

[0008] In order to achieve the above-mentioned object of the present invention, the present invention adopts the following technical solutions or combinations:

[0009] Firstly, the present invention provides a primer-probe combination for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, which has the advantages of high accuracy and fast detection speed compared with the existing fluorescent quantitative PCR detection method.

[0010] A primer-probe combination for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, comprising the following primer-probes:

[0011] The nucleotide sequence of the upstream primer for detecting H5 subtype avian influenza virus is shown in SEQ ID No. 1,

[0012] SEQ ID No.1:TTTTAGTTCTCATGGAAAATGAGAGAACTCT;

[0013] The nucleotide sequence of the downstream primer for detecting H5 subtype avian influenza virus is shown in SEQ ID No. 2.

[0014] SEQ ID No.2: AATCTTGCTTCTTCTGAATATTGCGGGTAGT;

[0015] The probe for detecting H5 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown in SEQ ID No. 3.

[0016] SEQ ID No.3: GCAAAGGAGCTGGGTAATGGTTGTTTTGAGT / i6 fluorescent group dT / i tetrahydrofuran modification site / i quenching group dT / ATCACAAATGTGATAAT (3' end spacer modification);

[0017] The nucleotide sequence of the upstream primer for detecting H7 subtype avian influenza virus is shown in SEQ ID No.4.

[0018] SEQ ID No.4: AATAACACCTATGATCACAGAAAATACAGAG;

[0019] The nucleotide sequence of the downstream primer for detecting H7 subtype avian influenza virus is shown in SEQ ID No.5.

[0020] SEQ ID No.5:ATGCCCCGAAGCTAAACCAAAGTATCACATC;

[0021] The probe for detecting H7 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown in SEQ ID No.6.

[0022] SEQ ID No.6:

[0023] GTCAAACTAAGCAGCGGCTACAAAGATGTGA / i6 Fluorescent group dT / A / i Tetrahydrofuran modification site / i Quenching group

[0024] dT / TTGGTTTAGCTTCGG (3' end steric modification);

[0025] The nucleotide sequence of the upstream primer for detecting H10 subtype avian influenza virus is shown in SEQ ID No.7.

[0026] SEQ ID No.7: TGGACTTATCAGGCTGAGCTATTGGTAGCAA;

[0027] The nucleotide sequence of the downstream primer for detecting H10 subtype avian influenza virus is shown in SEQ ID No.8.

[0028] SEQ ID No.8: GCATTCTGCCTGAGTTGTTCCTCACTCTTT;

[0029] The probe for detecting H10 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown in SEQ ID No.9.

[0030] SEQ ID No.9: GTAGCAATGGAGAACCAGCATACAATCGATA / i6 fluorescent group dT / GG / i tetrahydrofuran modification site / i quenching group dT / GATTCAGAGATGTTG (3' end steric submodification).

[0031] The fluorescent group used in the probe is any one of FAM, Cy3, Cy5, Texas Red, Alexa Flour, ROX, JOE, and Hex; the quenching group used in the probe is any one of NFQ, BHQ1, BHQ2, BHQ3, and TAMRA.

[0032] Preferably,

[0033] The probe for detecting H5 subtype avian influenza virus is a modified fluorescent probe, and its sequence is as follows:

[0034] GCAAAGGAGCTGGGTAATGGTTGTTTTGAGT / i6Cy5dT / idSp / iBHQ1dT / ATCACAAATGTGATAAT

[0035] (C3 Spacer)

[0036] The probe for detecting H7 subtype avian influenza virus is a modified fluorescent probe, and its sequence is as follows:

[0037] GTCAAACTAAGCAGCGGCTACAAAGATGTGA / i6FAMdT / A / idSp / iBHQ1dT / TTGGTTTAGCTTCGG(C3 Spacer).

[0038] The probe for detecting H10 subtype avian influenza virus is a modified fluorescent probe, and its sequence is as follows:

[0039] GTAGCAATGGAGAACCAGCATACAATCGATA / i6HexdT / GG / idSp / iBHQ1dT / GATTCAGAGATGTTG(C3

[0040] Spacer).

[0041] In addition, the present application also provides the use of the primer-probe combination in the preparation of a detection kit for the simultaneous detection of H5, H7 and H10 subtype avian influenza viruses.

[0042] The primers and probes are used for detecting the HA gene of H5, H7 and H10 subtype avian influenza viruses.

[0043] On this basis, the present invention provides a rapid isothermal amplification kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, the kit containing the above primer probe combination and microfluidic nucleic acid detection chip, the kit also includes a buffer, an RPA amplification reaction system and an RNA extraction kit. The kit can be used to detect H5, H7 and H10 subtype avian influenza viruses with high accuracy and fast speed, and the results can be obtained in about 30 minutes.

[0044] The microfluidic detection chip is a multi-channel, centrifugally driven polymethyl methacrylate chip.

[0045] The RPA amplification reaction system includes, in 50 μl, 1.0 to 10 μl of H5, H7 and H10 subtype avian influenza virus template RNA; 1.0 to 5.0 μl of upstream primer; 1.0 to 5.0 μl of downstream primer; 0.5 to 5 μl of probe primer; 9.5 μl of rehydration buffer; 0.5 to 2.5 μl of magnesium acetate; dry powder enzyme; RNase-free water sterilized deionized water to 20 μl;

[0046] In the present invention, the finished kit is generally stored at -20°C. When used, Mg is added. 2+ (Magnesium acetate).

[0047] The initial concentrations of the upstream primer and the downstream primer are both 1 to 10 mmol / L, and the initial concentration of magnesium acetate is 50 to 280 mmol / L.

[0048] The present invention also provides a method for using the above kit, comprising the following steps:

[0049] (1) RNA template extraction: extract RNA from the sample to be tested; (2) RPA amplification reaction: use the RNA extracted in step (1) as a template, and use the RPA primers and probes in the kit, and drop the mixed solution into the reaction well of the microfluidic chip (independently developed and approved for related patents CN 308592766S) for RPA amplification reaction; (3) perform fluorescence detection and analysis of the RPA amplification product on a constant temperature amplification instrument (independently developed and approved for related patents CN219730944U).

[0050] Furthermore, the sample to be tested includes at least one of H5, H7 and H10 subtype avian influenza virus nucleic acid liquid indoor quality control products.

[0051] Furthermore, the sample to be tested includes at least one of nasopharyngeal swab preservation fluid, oropharyngeal swab preservation fluid and sputum.

[0052] Furthermore, the PRA amplification is a multi-enzyme constant temperature amplification, the amplification reaction temperature is 25° C. to 42° C., the amplification time is 1 to 60 minutes, preferably 39° C., and the amplification time is 3 to 15 minutes.

[0053] In the present invention, fluorescence detection analysis can utilize any instrument that can identify and collect fluorescence signals, and its luminescent genes include but are not limited to FAM channels, and also include all series of fluorescence detection groups such as Cy3, Cy5, Texas Red, Alexa Flour, ROX, JOE, Hex, etc.

[0054] More preferably, any device capable of controlling temperature can be used for the constant temperature reaction, including but not limited to a water bath, a constant temperature box, a constant temperature amplification instrument, a PCR instrument, etc.

[0055] The present invention provides a rapid isothermal amplification kit and a method of use that can simultaneously detect H5, H7 and H10 subtype influenza viruses, which can be widely used in the detection of H5, H7 and H10 subtype avian influenza viruses in clinical practice. Multiple real-time RT-RPA (Reverse Transcription-Recombinase Polymerase Amplification) detection technology is based on RPA rapid detection, and quantitatively detects multiple samples to be tested in a single system, with the advantages of high accuracy and fast detection speed. The present invention integrates the primer probe group into the single amplification system of the microfluidic chip to achieve the micro-quantification of the real-time rapid amplification detection system, provide technical support for the identification of unknown influenza viruses, and achieve early typing, early detection, and early treatment.

[0056] Compared with the prior art, the present invention has the following beneficial effects:

[0057] (1) The present invention uses the hemagglutinin gene (HA) of H5, H7 and H10 subtype avian influenza viruses as detection targets, designs RPA detection primers and probes, and then establishes a synchronous combined rapid detection method based on isothermal amplification.

[0058] (2) The RPA primers and probes for detecting multiple respiratory viruses of the present invention can be used to complete the detection of multiple nosocomial respiratory viruses in clinical patients or outpatient screening; the kit of the present invention has the characteristics of specificity, low price, sensitivity, and portability; the kit of the present invention can effectively and specifically detect multiple nosocomial H5, H7 and H10 subtype avian influenza viruses with single reaction single copy or more.

[0059] (3) Using the RPA primers and probes of the present invention for detection, three different fluorescent signals can be detected in one reaction, and multiple samples can be detected simultaneously, which effectively simplifies the system design and avoids problems such as inaccuracy caused by different sample optical inspection times.

[0060] (4) Compared with real-time fluorescence quantitative PCR, the kit of the present invention is used to perform detection by the RPA method, and the primers and probes are highly sensitive, and the detection accuracy and sensitivity are high, and the detection can be completed within 10 minutes.

[0061] (5) The present invention uses the hemagglutinin gene of H5, H7 and H10 subtype avian influenza virus as the detection target to design RPA detection primers and probes for detection with high accuracy.

[0062] (6) The present invention uses multiple enzymes in an optimized ratio and freeze-drying to form dry enzyme powder and amplification tubes, eliminating the reverse transcription process, optimizing the detection time and operation steps, and making the method simpler.

[0063] (7) The RPA primers and probes of the present invention have been tested and verified by throat swab samples of real clinical patients, with a compliance rate of 100%, very high accuracy and specificity, and more convincing clinical application test results.

[0064] In summary, the rapid isothermal amplification kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses provided by the present invention can be widely used in the detection of H5, H7 and H10 subtype avian influenza viruses in clinical practice. The multiple real-time RT-RPA (Reverse Transcription-Recombinase Polymerase Amplification) detection technology is based on RPA rapid detection, and quantitatively detects multiple samples to be tested in a single system, which has the advantages of high accuracy and fast detection speed. In addition, the present invention integrates the primer probe group into the single amplification system of the microfluidic chip to achieve the micro-quantification of the real-time rapid amplification detection system, providing technical support for the identification of unknown influenza viruses, and achieving early typing, early detection, and early treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0066] Figure 1 This is a sensitivity measurement curve of real-time RT-RPA of H5, H7 and H10 subtype avian influenza viruses in Example 3

[0067] Figure 2 This is the ROC analysis diagram for distinguishing infected people from healthy controls in clinical sample testing.

[0068] Figure 3 This is a specific amplification determination curve of the real-time RT-RPA of H5 subtype avian influenza virus in Example 4 (example)

[0069] Figure 4 This is a specific amplification determination curve of the real-time RT-RPA of H7 subtype avian influenza virus in Example 4 (example)

[0070] Figure 5 This is a specific amplification determination curve of the real-time RT-RPA of the H10 subtype avian influenza virus in Example 4 (example) DETAILED DESCRIPTION

[0071] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0072] In the embodiments of the present invention, unless otherwise clearly defined, the term target gene should be understood as the entire gene fragment. The gene is not limited to the fragment involved in the primer probe, but can also be other regions of the gene for which primers can be designed.

[0073] In the present invention, the fluorescent probe is not limited to FAM, and can also be other fluorescent excitation groups such as GFP, Texas Red, DAPI, AlexaFluor@488, FITC, Hex, Cy3, Cy5, Cy7, ROX, JOE and Alexa Fluor@750;

[0074] In the present invention, the test sample can be at least one of a viral nucleic acid template, a throat swab, a viral culture fluid, sputum containing H5, H7 and H10 subtype avian influenza viruses, and a bronchoalveolar lavage fluid. For ordinary technicians in the field or relevant testing personnel, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0075] In the present invention, the dry powder enzyme components: reverse transcriptase, Bsu DNA polymerase, single-stranded DNA binding protein SSB, recombinase Cre capable of binding to single-stranded nucleic acid (oligonucleotide primer) and reverse transcriptase are all commercially available products.

[0076] In the following examples, the reagents, instruments, etc. used can all be purchased through commercial channels.

[0077] Example 1 Primer and probe design

[0078] According to the H5, H7 and H10 subtype avian influenza virus base sequences published on the Internet, the HA gene base sequences were searched and compared, and RPA isothermal amplification primers were creatively designed according to the primer design principles, and the GC content and other parameters of the designed primers were verified to ensure that they reached the optimal range. At the same time, the corresponding probes were designed according to the design principles of RPA probe primers.

[0079] For the present invention, the core point in designing the probe is to find the site of the fluorescent group. When designing the probe, it is necessary to explore and determine the site of tetrahydrofuran (dSp / THF). In the present invention, the probe primer should screen the base sequence of 48-53bp in length, and 3-5 nucleotides, preferably cytosine, at the 5' end can promote the recombination of the gene sequence. The designed THF site is not less than 30bp from the 5' end and not less than 15bp from the 3' end. The THF site cannot contain any more THF sites.

[0080] Among them, the three nucleotides at the 3' end are G or C, which is helpful for the stability of the polymerase. No polypurine or pyrimidine should appear. The content of G and C is between 30-70% to avoid the formation of secondary structure or hairpin structure, etc. The target area should avoid repetitive elements. The following primers and probes for the HA gene of H5, H7 and H10 subtype avian influenza virus were obtained:

[0081]

[0082]

[0083] The primers and probes described above can be used to detect the HA gene of H5, H7 and H10 subtype avian influenza viruses.

[0084] The designed primers were sent to Shanghai Jierui Biotechnology Co., Ltd. for synthesis. After the primers were obtained, RNase-free water was added to dilute them to 10 mmol / μl for use.

[0085] Example 2 RPA amplification system

[0086] A rapid isothermal amplification kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, the kit comprising the primers and probes of Example 1;

[0087] The kit also includes rehydration buffer, magnesium acetate, RNase-free water, sterile deionized water, a nucleic acid extraction kit (Liferiver), and dry powder enzymes; the dry powder enzymes are freeze-dried powders of reverse transcriptase, BSu DNA polymerase, single-stranded DNA binding protein SSB, and recombinase Cre that can bind to single-stranded nucleic acid (oligonucleotide primer), and reverse transcriptase in a certain proportion.

[0088] It should be noted that the RNA extraction kit is used to extract RNA from the sample to be tested as a template; the RNA extraction kit can adopt a conventional commercially available RNA extraction kit. In this embodiment, the RNA extraction kit used is the RNA extraction kit of Liferiver.

[0089] The kit of this embodiment includes the following RPA amplification reaction system:

[0090] An RPA amplification reaction system for detecting H5, H7 and H10 subtype avian influenza viruses, the reaction system comprising the primer probe set for detecting H5, H7 and H10 subtype avian influenza viruses in Example 1;

[0091] The RPA amplification system for detecting H5, H7 and H10 subtype avian influenza viruses includes, in 20 μl, 1.0 to 10 μl of template RNA; 1.0 to 5.0 μl of upstream primers; 1.0 to 5.0 μl of downstream primers; 0.5 to 5 μl of probe primers; 9.5 μl of rehydration buffer; 0.5 to 2.5 μl of magnesium acetate; dry powder enzyme; and RNase-free water sterilized deionized water to 20 μl.

[0092] The method for using the kit comprises the following steps: (1) RNA template extraction: extracting RNA from a sample to be tested; (2) RPA amplification reaction: using the RNA extracted in step (1) as a template and using the RPA primers and probes in the kit, dripping the mixed solution into a reaction well of a microfluidic chip to perform an RPA amplification reaction; and (3) performing fluorescence detection and analysis of the RPA amplification product on a constant temperature amplification instrument.

[0093] Example 3 Sensitivity Detection of RPA Primers

[0094] (1) Provide the kit of Example 2, and add each reagent according to the following reaction system, specifically including:

[0095] Add 2.1 μl of upstream primer, 2.1 μl of downstream primer, 0.6 μl of probe, and 9.5 μl of rehydration buffer to the RPA dry powder enzyme tube respectively. After the dry powder in the amplification tube is completely dissolved, add 2 μl of template, centrifuge at 2,000 rpm, add 2.5 μl of activator magnesium acetate, and make up to 10 μl with RNase-free sterile deionized water, which is then added to the reaction well of the microfluidic chip in time.

[0096] (2) Immediately place the reaction tube in a pre-set constant temperature amplification instrument that can collect fluorescence signals. The RPA reaction conditions are 39°C, the reaction time is 10 minutes, and the fluorescence signal is collected every 30 seconds.

[0097] The specific sensitivity of fluorescence signal detection is shown in the figure Figure 1 As shown, the amplified fluorescent signals of H5, H7 and H10 subtype avian influenza viruses can be detected within 2 to 3 minutes, and the detection sensitivity can reach 2 copies / reaction within 10 minutes.

[0098] Example 4 Specificity detection of RPA primers

[0099] H5, H7 and H10 subtype avian influenza viruses and other viral RNAs were selected as templates to verify the specificity of RPA primers.

[0100] A kit of Example 2 is provided, and each reagent of the sample is added according to the following reaction system, specifically including: adding 2.1 μl of upstream primer, 2.1 μl of downstream primer, 0.6 μl of probe, and 9.5 μl of rehydration buffer to the RPA dry powder enzyme tube, adding 2 μl of template after the dry powder in the amplification tube is completely dissolved, centrifuging at 2,000 rpm, adding 2.5 μl of activator magnesium acetate, and filling up to 10 μl with RNase-free water and sterilized deionized water, and adding it to the reaction well of the microfluidic chip in time.

[0101] Immediately place the reaction tube in a pre-set constant temperature amplification instrument that can collect fluorescence signals. The RPA reaction conditions are 39°C, the reaction time is 10 minutes, and the fluorescence signal is collected every 30 seconds.

[0102] The results of specific specificity tests are shown in Table 1. Common viruses that have been identified and isolated from oral sputum and respiratory tract, including H1N1, H3N2, rhinovirus, respiratory syncytial virus, etc. (see Appendix 1 for details) were selected for routine culture and finally concentration determination. Nucleic acid was extracted and converted into copy number to make the concentration reach 10 4 The DNA template was extracted using the genome extraction kit produced by Qiagen. After the nucleic acid template was extracted, the concentration of the nucleic acid template was measured using Nanodrop and uniformly adjusted to 10 4 Copies / μl, non-specific amplification detection was performed using the kit and RPA amplification method described in Example 2. As shown in Table 1, influenza virus primer amplification detection only detected H5, H7 and H10 subtype influenza viruses, and the others were negative, and no non-specific amplification occurred.

[0103] Table 1: Results of specificity tests

[0104]

[0105]

[0106]

[0107] a represents the results of identification using commercial fluorescent quantitative PCR detection reagents. In the table, "+" represents amplification, and "-" represents no amplification. Example 5 Comparative verification of RPA method and fluorescent quantitative PCR method

[0108] Select H5, H7 and H10 subtype avian influenza viruses (10 4 Copies / μl) were used as templates for RPA amplification and fluorescence quantitative PCR method was used for correlation verification.

[0109] The RPA reaction was performed according to the following reaction system, wherein the primers and probes for gene detection were not mixed and added, but amplified separately, including: 2.1 μl of upstream primer, 2.1 μl of downstream primer, 0.6 μl of probe, and 9.5 μl of rehydration buffer were added to the RPA dry powder enzyme tube, and 2 μl of template was added after the dry powder in the amplification tube was completely dissolved, and the tube was centrifuged instantly at 2000 rpm, and 2.5 μl of activator magnesium acetate was added, and the RNase-free water was made up to 10 μl with sterile deionized water, and then added to the reaction well of the microfluidic chip in time.

[0110] Immediately place the reaction tube in a pre-set constant temperature amplification instrument that can collect fluorescence signals. The RPA reaction conditions are 39°C, the reaction time is 10 minutes, and the fluorescence signal is collected every 30 seconds.

[0111] Fluorescence quantitative PCR was performed using a commercial kit for detecting influenza virus produced by Liferiver Biotechnology (Shanghai, China), and the amplification was performed strictly according to the kit instructions. The specific reaction conditions were as follows: 45°C for 10 minutes, 95°C for 15 minutes, 95°C for 15 seconds, 60°C for 1 minute, and 45 cycles. The test results are shown in Table 2

[0112] Table 2. Comparison of quantitative PCR and chip RPA test results

[0113]

[0114] "+" indicates amplification, and "-" indicates no amplification.

[0115] Application Example 1: RPA method clinical sample test analysis

[0116] 220 clinical samples were selected for nucleic acid extraction (including 120 human samples and 100 poultry samples); the kit of Example 2 was used to test and analyze the clinical samples. The specific results are shown in Table 3 (example). For all positive sample test results, the positive detection rates of quantitative PCR and RPA methods were 100% consistent, confirming that the detection technology developed by the present invention can be well applied to H5, H7 and H10 influenza detection.

[0117] Table 3. Comparison of RPA and quantitative PCR detection results of H5, H7 and H10 subtype avian influenza viruses in clinical samples.

[0118]

[0119] Figure 1 For the sensitivity analysis of RPA method for detecting avian influenza virus in this embodiment, Figure 1 It can be seen that the method can detect the presence of H5, H7 and H10 subtype avian influenza viruses within 2 to 3 minutes, and the virus gene detection can be completed in 10 minutes; the analysis of the accuracy fitting results with the quantitative PCR amplification results shows that there is no significant difference between the RPA method detection results of this embodiment and the fluorescence quantitative PCR detection results, and the fitting rate is 100%. At present, the gold standard for nucleic acid detection is still fluorescence quantitative PCR, which indicates that the detection efficiency of the method we established is the same as the detection accuracy of fluorescence quantitative PCR, but the detection time is greatly shortened.

[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer-probe combination for simultaneous detection of H5, H7 and H10 subtype avian influenza viruses, characterized in that: The primer probe is composed of the following, and the nucleotide sequence of the upstream primer for detecting H5 subtype avian influenza virus is shown in SEQ ID No. 1, SEQ ID No.1:TTTTAGTTCTCATGGAAAATGAGAGAACTCT; The nucleotide sequence of the downstream primer for detecting H5 subtype avian influenza virus is shown in SEQ ID No.

2. SEQ ID No.2: AATCTTGCTTCTTCTGAATATTGCGGGTAGT; The probe for detecting H5 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown in SEQ ID No.

3. SEQ ID No.3: GCAAAGGAGCTGGGTAATGGTTGTTTTGAGT / i6 fluorescent group dT / i tetrahydrofuran modification site / i quenching group dT / ATCACAAATGTGATAAT (3' end spacer modification); The nucleotide sequence of the upstream primer for detecting H7 subtype avian influenza virus is shown in SEQ ID No.

4. SEQ ID No.4: AATAACACCTATGATCACAGAAAATACAGAG; The nucleotide sequence of the downstream primer for detecting H7 subtype avian influenza virus is shown in SEQ ID No.

5. SEQ ID No.5: ATGCCCCGAAGCTAAACCAAAGTATCACATC; The probe for detecting H7 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown in SEQ ID No.

6. SEQ ID No.6: GTCAAACTAAGCAGCGGCTACAAAGATGTGA / i6 fluorescent group dT / A / i tetrahydrofuran modification site / i quenching group dT / TTGGTTTAGCTTCGG (3' end steric submodification); The nucleotide sequence of the upstream primer for detecting H10 subtype avian influenza virus is shown in SEQ ID No.

7. SEQ ID No.7: TGGACTTATCAGGCTGAGCTATTGGTAGCAA; The nucleotide sequence of the downstream primer for detecting H10 subtype avian influenza virus is shown in SEQ ID No.

8. SEQ ID No.8: GCATTCTGCCTGAGTTGTTCCTCACTCTTT; The probe for detecting H10 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown in SEQ ID No.

9. SEQ ID No.9: GTAGCAATGGAGAACCAGCATACAATCGATA / i6 Fluorescent group dT / GG / i Tetrahydrofuran modification site / i Quenching group dT / GATTCAGAGATGTTG (3' end steric sub-modification).

2. The primer-probe combination according to claim 1, characterized in that: The fluorescent group used in the probe is any one of FAM, Cy3, Cy5, Texas Red, Alexa Flour, ROX, JOE, and Hex; the quenching group used in the probe is any one of NFQ, BHQ1, BHQ2, BHQ3, and TAMRA.

3. The primer-probe combination according to claim 1, characterized in that: The probe for detecting H5 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown below: GCAAAGGAGCTGGGTAATGGTTGTTTTGAGT / i6Cy5dT / idSp / iBHQ1dT / ATCACAAATGTGATAAT(C3 Spacer); The probe for detecting H7 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown below: GTCAAACTAAGCAGCGGCTACAAAGATGTGA / i6FAMdT / A / idSp / iBHQ1dT / TTGGTTTAGCTTCGG(C3Spacer); The probe for detecting H10 subtype avian influenza virus is a modified fluorescent probe, and its sequence is shown below: GTAGCAATGGAGAACCAGCATACAATCGATA / i6HexdT / GG / idSp / iBHQ1dT / GATTCAGAGATGTTG(C3Spacer).

4. Use of the primer-probe combination according to any one of claims 1 to 3 in the preparation of a detection kit for the simultaneous detection of H5, H7 and H10 subtype avian influenza viruses.

5. The use according to claim 4, characterized in that: The primer-probe combination is used to detect the HA gene of influenza A virus H5, H7 and H10 subtypes.

6. A rapid isothermal amplification kit for synchronously detecting H5, H7 and H10 subtype avian influenza viruses, comprising the primer-probe combination according to any one of claims 1 to 3.

7. The rapid isothermal amplification kit according to claim 6, characterized in that: It also includes a microfluidic nucleic acid detection chip.

8. The rapid isothermal amplification kit according to claim 7, characterized in that: The microfluidic detection chip is a multi-channel, centrifugally driven polymethyl methacrylate chip.

9. The rapid isothermal amplification kit according to claim 6, characterized in that: The kit also includes a buffer, an RPA constant temperature amplification reaction system and an RNA extraction kit; the RPA constant temperature amplification reaction system includes, in 20 microliters, 1.0 to 10 microliters of template RNA of influenza virus H5, H7 and H7 subtypes; 1.0 to 5.0 microliters of upstream primers; 1.0 to 5.0 microliters of downstream primers; 0.5 to 5 microliters of probe primers; 10 microliters of rehydration buffer; 0.5 to 2.5 microliters of magnesium acetate; dry powder enzyme; RNase-free water sterilized deionized water supplemented to 20 microliters; wherein the initial concentrations of the upstream primer and the downstream primer are both 1 to 10 mmol / L, and the initial concentration of the magnesium acetate is 50 to 280 mmol / L.

10. The method for using the rapid isothermal amplification kit according to any one of claims 6 to 9, comprising the following steps: (1) RNA template extraction: extracting RNA from the sample to be tested; (2) RPA amplification reaction: using the RNA extracted in step (1) as a template and using the RPA primers and probes in the kit, the mixed solution is added dropwise to the reaction wells of the microfluidic chip for RPA amplification reaction; (3) performing fluorescence detection and analysis of the RPA amplification product on a constant temperature amplification instrument.

Images