Specific primer group, kit, application and method for detecting infectious hematopoietic necrosis virus

Abstract

The invention provides a specific primer group for detecting infectious hematopoietic necrosis virus, which comprises specific primers and probes, and the specific primers comprise: an upstream primer: IHNV-RPA-F3 with a sequence as shown in SEQ ID NO: 1, an downstream primer: IHNV-RPA-F3 with a sequence as shown in SEQ ID NO: 2, and an upstream primer: IHNV-RPA-F3 with a sequence as shown in SEQ ID NO: 3; the sequence of the downstream primer is IHNV-RPA-R3, and the sequence of the downstream primer is as shown in SEQ ID NO: 2; the probe has a THF site, the 5'end of the probe is at least spaced from the THF site by 31 basic groups, and the 3 'end of the probe is at least spaced from the THF site by 16 basic groups. The invention also provides a corresponding kit, a method and application. The normal-temperature isothermal reaction greatly reduces the requirements on instruments and does not need complex instruments; the nucleic acid amplification reaction in a living body is simulated to the maximum extent, the time required by the amplification process is greatly shortened, and the amplification efficiency is obviously improved; the sensitivity and the specificity are high.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, relates to a detection method for marine aquaculture, and specifically relates to a specific primer set, a kit, an application and a method for detecting infectious hematopoietic necrosis virus. Background Art

[0002] Infectious Hematopoietic Necrosis (IHN) is a severe acute viral disease that mainly affects salmon and trout, and can cause extremely high mortality. The disease was first discovered in France and Italy in 1987. Symptoms of sick fish include linear or V-shaped hemorrhages on the sides of the body, white gill filaments due to anemia, and linear hemorrhages. When dissecting sick fish, renal anemia and necrosis of hematopoietic tissues in the kidneys and spleen can be seen. In the early stages of the disease, the fish may be lethargic, with a dark body color, protruding eyes, swollen abdomen, red and swollen anus, and dragging long, opaque white feces. There are hemorrhagic ecchymoses in the mouth, gills, muscles, fat, meninges, and internal organs. In severe cases, the fish is anemic, the gill filaments are pale, the liver, spleen, pancreas, kidneys, etc. are degenerated and necrotic, and the hematopoietic organs are severely necrotic and disintegrated. Infectious Hematopoietic Necrosis Virus (IHNV) can proliferate in many fish cell lines, with a growth temperature of 4 to 20°C and an optimum temperature of 15°C. The water temperature for the disease is 4-13°C, with the highest incidence at 8-10°C and the disease stops at above 15°C. The disease mainly affects young fish about 2 months after the start of feeding, and the disease course is rapid, posing a serious threat to the aquaculture industry.

[0003] Detection methods for IHNV virus include loop-mediated isothermal amplification (LAMP), which is a rapid detection system that can detect the presence of the virus in a short time by designing specific primers for LAMP reaction. It has high sensitivity, simple operation and low cost. Serological diagnostic methods such as agar diffusion test (AGP), fluorescent antibody test (FAT) and enzyme-linked immunosorbent assay (ELISA) are also widely used. These methods diagnose IHNV by detecting antigen or antibody reactions of the virus. Among them, ELISA is particularly popular because of its rapid and accurate characteristics. Among molecular biological diagnostic methods, the conventional reverse transcription polymerase chain reaction (RT-PCR) technology designs primers based on the N protein gene of IHNV to establish the RT-PCR detection method, which has high specificity and sensitivity.

[0004] These diagnostic technologies each have their own advantages and scope of application, but they have high requirements for detection conditions and operators, which is not conducive to large-scale promotion and application. Therefore, it is very necessary to develop a specific, sensitive, rapid, convenient and easy-to-promote diagnostic technology.

[0005] Recombinase polymerase amplification (RPA) is a technology that relies on recombinase, single strand binding protein (SSB) and DNA polymerase to achieve isothermal amplification of nucleic acids. Using a pair of upstream and downstream primers with an interval of usually no more than 500 bp, the exponential amplification of the target sequence can be achieved within 10 to 20 minutes. The designed oligonucleotide probe can recognize the complementary region in any strand of the RPA amplicon, thereby completing the highly specific detection of the RPA product. Using lateral flow strips (LFS) to detect the amplified product can visualize the results. Combining RPA and LFS has the advantages of simple operation, low equipment requirements, low cost, and high speed, and is suitable for on-site or production-line detection. Summary of the invention

[0006] In view of the deficiencies in the prior art, the present invention provides a specific primer set, a kit, an application and a method for detecting infectious hematopoietic necrosis virus.

[0007] In order to solve the above technical problems, the first aspect of the present invention provides a specific primer set for detecting infectious hematopoietic necrosis virus, which mainly comprises a specific primer and a probe, wherein the specific primer comprises:

[0008] Upstream primer: IHNV-RPA-F3: sequence: AGGACAAGACGATGGGGATGAGGGGAAACTTG (as shown in SEQ ID NO: 1);

[0009] Downstream primer: IHNV-RPA-R3: sequence Biotin-TGTACGTCGTCCTGTCCTTGGATACCTCGTCC (as shown in SEQ ID NO: 2)

[0010] The probe has a THF site, the 5' end of the probe is at least 31 bases away from the THF site, and the 3' end of the probe is at least 16 bases away from the THF site.

[0011] Specifically, the probe: IHNV-RPA-Probe is:

[0012] FAM-CGCCGAGATAATATCAACAAACAGTGTGACT (as shown in SEQ ID NO: 3) / idSp / CATACCTCCT ATCCAA (as shown in SEQ ID NO: 4)-C3 Spacer, wherein FAM is a fluorescent group, idSp is tetrahydrofuran, and the 3' end is labeled with a C3 Spacer spacer arm.

[0013] The specific primers and probes of the present invention are oligonucleotides designed for fish infectious hematopoietic necrosis (IHNV), which specifically recognize the upstream and downstream fragments of a nucleic acid target respectively; the length is 30 to 33 bp, and there is no palindromic sequence or continuous single repeated base. The specific probe sequence is a 47 bp oligonucleotide sequence, the 5' end is marked with a FAM group, the 3' end is marked with a C3spacer spacer group, and the position 16 bp away from the 3' segment replaces a base with a THF (tetrafluoroethylene) site as an NFO exonuclease binding site. There is no non-specific binding with the upstream primer and the downstream primer.

[0014] The second aspect of the present invention provides the use of the specific primer set for detecting infectious hematopoietic necrosis virus in preparing a reagent or a kit for detecting infectious hematopoietic necrosis virus.

[0015] The third aspect of the present invention provides a kit for detecting infectious hematopoietic necrosis virus, the main feature of which is that it includes the specific primer set.

[0016] Preferably, the method further comprises at least one of A Buffer, B Buffer, RPA dry powder reagent, infectious hematopoietic necrosis virus standard and DEPC treated water.

[0017] Preferably, the A Buffer is 5.46% PEG, 100mM KAc, 25mM Tris; and the B Buffer is 280mM MgAc.

[0018] Preferably, the ingredients of the RPA dry powder reagent are as follows: 150-240 μM dNTP, 200-300 ng / μL Gp32 protein, 150-260 ng / μL UvsX recombinase protein, 90 ng / μL Bsu DNA polymerase, 2% PEG, 5.7% trehalose, 200 μM dNTPs, 3 mM ATP, 2 mM DTT, 50 mM creatine phosphate, 25 mM Tris-HCl, 100 ng / μL creatine kinase, and 300 ng / μL nfo exonuclease.

[0019] The fourth aspect of the present invention also provides an RPA-LFS constant temperature detection method for infectious hematopoietic necrosis virus, the main feature of which is that the method comprises: extracting RNA from the sample to be tested, reverse transcribing to obtain cDNA, using the cDNA of the sample to be tested as a template, using the kit to perform RPA-LFS reaction, and analyzing the sample to be tested according to the colorimetric analysis of the colloidal gold test strip.

[0020] The present invention also provides a method for preparing a reagent for detecting fish infectious hematopoietic necrosis virus (IHNV), comprising:

[0021] (1) pre-freezing the reaction solution at 80° C. for 12 hours to obtain a pre-frozen reagent;

[0022] (2) Dry the pre-frozen reagent at 50°C for 12 hours to obtain a lyophilized powder;

[0023] (3) adding the sample to be tested, double distilled water and buffer solution into the reaction tube containing the reagent;

[0024] (4) Place the reagent reaction tube in a temperature-controlled device and incubate for 15 to 25 minutes, and test the activity of the lyophilized powder using a colloidal gold test strip (LFS).

[0025] The specific primer set, kit, application and method for detecting infectious hematopoietic necrosis virus of the present invention have the following advantages:

[0026] 1. Room temperature isothermal reaction: Compared with several major nucleic acid amplification technologies, room temperature isothermal reaction greatly reduces the requirements for instruments and can react quickly without complex instruments such as PCR instruments, qPCR instruments, etc.

[0027] 2. Rapid reaction: Normal temperature isothermal nucleic acid amplification technology uses a variety of engineered enzymes in a specific solution environment to simulate the nucleic acid amplification reaction in vivo to the maximum extent, greatly shortening the time required for the amplification process. Compared with fluorescent quantitative PCR, the amplification reaction time is shortened from 1.5 to 2 hours to 15 minutes, which significantly improves the amplification efficiency.

[0028] 3. High sensitivity and strong specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the electrophoresis result of the specific primer screening of Example 1 of the present invention.

[0030] Figure 2 This is the specific analysis result of Example 4 of the present invention.

[0031] Figure 3 This is the sensitivity analysis result of Example 5 of the present invention. DETAILED DESCRIPTION

[0032] In order to make the technical problem solved by the present invention clearer, the present invention is further described below in conjunction with embodiments and drawings. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0033] The present invention provides a method for detecting a target object. Under normal temperature and isothermal conditions, the method ensures closed-tube detection through the combined action of specific primers, specific probes, engineered enzymes, and other chemical components in combination with LFS (colloidal gold test strips) and strict experimental operation steps, and effectively prevents aerosol contamination.

[0034] The present invention achieves the purpose of rapid detection without any instrumentation through the joint action of specific primers (forward primers and reverse primers), specific probes, enzymes, and other chemical components, and has high specificity and sensitivity, providing a new solution for rapid detection of IHNV.

[0035] Example 1

[0036] Primer screening

[0037] The invention selects a gene sequence (M16023.1) of a fish infectious hematopoietic necrosis virus (IHNV) published in GenBank and designs 5 upstream primers, 5 downstream primers and 1 probe by primer blast with reference to the primer design requirements of the recombinase polymerase amplification technology, and the primer and probe combination for screening the specific amplification of the fish infectious hematopoietic necrosis virus M16023.1 gene sequence. The probe sequence is shown in Table 1, and the primers and the probe are synthesized by GENEWIZ (Suzhou) Co., Ltd.

[0038] Table 1 Primer and probe sequences

[0039]

[0040]

[0041] Amplification was performed using IHNV-F1 and candidate downstream primers, such as Figure 1 As shown, all combinations amplified the target bands, the band size amplified by the F1+R1 combination was 200bp, the band size amplified by the F1+R2 combination was 178bp, the band size amplified by the F1+R3 combination was 158bp, the band size amplified by the F1+R4 combination was 232bp, and the band size amplified by the F1+R5 combination was 139bp. Among the five combinations, in the F1+R3 combination, this primer combination had no non-specific primer binding bands in the figure, and the primer performance was better than that of the other groups, with strong specificity, so the optimal downstream primer was IHNV-R3.

[0042] IHNV-R3 was fixed and PCR amplification was performed with the candidate upstream primers. The band size amplified by the F1+R3 combination was 158bp, the band size amplified by the F2+R3 combination was 177bp, the band size amplified by the F3+R3 combination was 193bp, the band size amplified by the F4+R3 combination was 211bp, and the band size amplified by the F5+R3 combination was 231bp. The bottom of the lane of the F3+R3 combination in the group was relatively clean, and the target band was brighter. This primer combination has good performance and strong specificity.

[0043] In summary, the best combination of RPA primers for infectious hematopoietic necrosis virus is F3+R3.

[0044] Example 2

[0045] Fish infectious hematopoietic necrosis virus test kit

[0046] The nucleic acid detection kit of the present invention comprises a primer mixture, a specific probe, A Buffer, B Buffer, RPA dry powder reagent, a fish infectious hematopoietic necrosis virus standard and ultrapure water provided by the laboratory. The A Buffer is 5.46% PEG, 100mM potassium acetate, 25mM Tris; the B Buffer is 280mM MgAc. The ingredients of the RPA dry powder reagent are as follows: 150-200μM dNTP, 700-900ng / μL Gp32 protein, 110-120ng / μLUvsX recombinase protein, 90ng / μL Bsu DNA polymerase, 2% PEG, 5.7% trehalose, 200μM dNTPs, 3mM ATP, 2mM DTT, 20mM creatine phosphate, 25mM Tris-HCl, 100ng / μL creatine kinase, and 300ng / μL nfo exonuclease.

[0047] Example 3

[0048] In Example 2, the fish infectious hematopoietic necrosis virus standard product uses the traditional Trizol-RNA reagent or an equivalent RNA extraction kit. The cDNA template is synthesized using a laboratory RNA reverse transcription kit.

[0049] The specific steps are as follows: Trizol reagent is a ready-to-use total RNA extraction reagent suitable for extracting high-quality total RNA from cell and tissue samples. The reagent contains ingredients such as phenol and guanidine isothiocyanate, which can quickly destroy cell structure, inhibit nuclease activity, and maintain RNA integrity. When using, first absorb the culture medium of adherent cells, add 1ml Trizol for every 10 square centimeters of cells, gently shake and blow with a gun to ensure complete cell lysis; after centrifugation of suspended cells, add 1ml Trizol for every 5 million to 10 million cells, blow with a gun or vortex appropriately; tissues need to be cut into small pieces and placed in a homogenizer, and 1ml Trizol is added for every 50mg-80mg tissue for homogenization. Next, add 0.2ml chloroform per milliliter of Trizol, vortex to mix, and place at room temperature, then centrifuge at 12,000g for 15 minutes at 4°C, and aspirate the upper colorless aqueous phase into a new centrifuge tube. After that, add 0.5 ml of isopropanol per ml of the original Trizol, mix by inversion, and precipitate at room temperature for 10 minutes, then centrifuge at 12,000g for 10 minutes at 4°C, and discard the supernatant. Then, add 1 ml of 75% ethanol prepared with DEPC water, vortex mix, centrifuge at 7500g for 5 minutes at 4°C, and discard the supernatant. Finally, after the RNA is slightly dry, add 20 μL of DEPC water to dissolve it, and freeze the extracted RNA at -80°C for later use.

[0050] The obtained RNA was subjected to a reverse transcription experiment. The operation steps are as follows: First, melt all the reagents in the kit on ice and mix gently. In an RNase-free centrifuge tube, add 2μL of 5× reverse transcription buffer, 0.5μL of reverse transcriptase mixture, 0.5μL of Oligo dT primer, 0.5μL of random primer, RNA sample (10pg-5μg) and RNase-free water to make up to 10μL. Put the prepared reaction system into the PCR instrument and set the program to 42℃ for 15 minutes and 70℃ for 5 minutes. After the synthesized cDNA is packaged, store it at -20℃.

[0051] The infectious hematopoietic necrosis virus RNA sequence is as follows:

[0052] AUGGACACCAUGAUCACCACUCCGCUCAUUCUCAUUCUAAUCACCUGCGGAGAAAC

[0053] AGCCAAACCGUCAAACCCGACACCGCAAGCGAAUCAGACCACCCACCUGGUCAAAC

[0054] CCGCUCUUCACCUAUCCCGAGGGAUGCACUCUGGACAAGCUCUCUAAGGUCAAUGCC

[0055] UCUCAACUGAGAUGCCCAAGGAUCUUCGAUGAUGAGAACAGGGGGCUAAUUGCCUA

[0056] UCCCACAUCCAUCCGGUCUCUGUCAGUCGGAAACGACCUCGGGGAGAUCACACCCA

[0057] AGGGAACCACAUCCACAAAGUCCUGUACCGCACCAUCUGCUCAACAGGGUUUCGG

[0058] GGGUCAGACGAUAGAGAAGGCGCUUGUAGAAAUGAACUCUCUACGAAAGAAGCAG

[0059] GGGCGUAUGACACCACAACGCAGCGCCUCUGUACUUCCCAGCUCCCCGAUGCCAAU

[0060] GGUACACUGACAACGUACAAAAAUGAUCUCAUCUUCUCUACACAACCCAAAAGAGU

[0061] GUUCUGAGAGAUCCCUACACCAGAGACUUUCUGGACUCAGAUUUUAUUGGAGGAA

[0062] AUGCACCAAAUCACCCUGCCAGACUCAUUGGUCCAACGUAUGGAAUGGGUGAUG

[0063] CAGGGAUACCAGCCUGUGAUUCCAGCCAAGAGUAAAAAGCUCACCUCUUUGUUGAU

[0064] AAAAUCUCCCAAUCGGGUCGUGAAGGCAACGAGCUACGGACACCACCCUUGGGGACU

[0065] GCAUCGGGCCUGUAUAUUGAUUCUGUGGGGAACAGGGAUACGGACAGAUCUCG

[0066] GUGACCUGAUAUCUGUCGAAUACAAAUUCUGGAGCAGAAAUCCUCUCGUUCCCGAAG

[0067] UGUGAGGACAAGACGAUGGGGAUGAGGGGAAACUUGGAUGACUUUGCCUAUCUAGA

[0068] CGAUCUGGUGAAGGCCUCUGAGAGCAGAGAGGAAUGUCUUGAGGCGCACGCCGAGA

[0069] UAAUAUCAACAAACAGUGUGACUCCAUACCUCCUAUCCAAGUUCCGAUCUCCACAUC

[0070] CCGGAAUAAAUGACGUCUACGCUAUGCACAAAGGCUCCAUCUAUCACGGGAUGUGC

[0071] AUGACGGUCGCUGUGGACGAGGUAUCCAAGGACAGGACGACGUACAGGGCCCAUCG

[0072] CGCUACCAGCUUCACGAAAUGGGAACGACCCUUUGGGGAUGAGUGGGAGGGCUUUC

[0073] ACGGAUUGCACGGAAACAACACCACCAUUAUUCCAGACCUGGAGAAAUACGUCGCC

[0074] CAGUACAAGACGAGCAUGAUGGAACCGAUGAGCAUCAAAUCCGUACCCCAUCCAAG

[0075] CAUCCUGGCCUUCUACAAUGAGACAGACUUAUCAGGGAUCUCCAUCAGGAAAUUGG

[0076] ACUCAUUCGACCUUCAAUCACUCCACUGGAGUUUCUGGCCCACAAUCUCCGCACUGG

[0077] GUGGGAUUCCCCUUGUUCUCCUCCUUGCUGUUGCCGCGUGCUGCUGCUGGUCAGGG

[0078] AGACCUCCCACUCCCUCCGCGCCGCAGAGUAUCCCCAUGUAUCACCUGGCAAACCGG

[0079] UCCUAA

[0080] Example 4

[0081] Kit specificity test

[0082] In order to detect the specificity of the RPA kit detection method obtained in Example 2, the reagent components in Table 2 were used to detect virus IHNV, IPNV, VHSV, EHNV, and SVCV samples, respectively, and the detection of IHNV and other common shrimp viruses by this method was analyzed.

[0083] The specific operation is as follows: take 29.4μL of A buffer and add it to the RPA reaction powder, shake it thoroughly and mix it, centrifuge it, continue to add 4μL of primer mixture, 0.6μL of specific probe, 1μL of DNA template, and 12.5μL of ultrapure water, shake it thoroughly and mix it, centrifuge it, add 2.5μL of B buffer to the PCR tube cap, cover the tube cap, and immediately place it in a 37℃ metal bath for reaction for 15 minutes after centrifugation, then take 20μL of the reaction solution and add it to 180μL PBS to dilute it 10 times, take 60μL and spot it on the sample plate of the colloidal gold test strip, and wait for 5 minutes to read the result.

[0084] Table 2 RPA kit components

[0085]

[0086]

[0087] The test results show that: Figure 2 As shown, only the IHNV sample showed normal amplification, while the negative control (DEPC-treated water) and IHNV, IPNV, VHSV, EHNV, and SVCV samples all showed amplification.

[0088] The above results show that the method and primer probe of the present invention have good specificity and no false positive occurs.

[0089] Example 5

[0090] Sensitivity test of the kit

[0091] According to the operating steps provided in Example 2 and the standard preparation of fish infectious hematopoietic necrosis virus cDNA, it was diluted to 6 gradients of 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, and 1fg / μL for sensitivity test.

[0092] Test results such as Figure 3As shown, from left to right are the amplification results of 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, and 1fg / μL, from which it can be seen that the RPA constant temperature amplification kit detection method of the present invention has a high sensitivity for the diagnosis of IHNV, and the minimum detection limit is 1pg / μL, 0.9 copies / μL.

[0093] Determination result: If the quality control line (C) has a band and the test line (T) has no band, it is determined to be negative. If the quality control line (C) has a band and the test line (T) has a band, it is determined to be positive. If the quality control line (C) has no band and the test line (T) has a band, the result is determined to be invalid.

[0094] The above description is a specific embodiment of the present invention and does not constitute a limitation on the protection scope of the present invention. Any modification and variation made to the technical concept of the present invention should be included in the protection scope of the present invention.

Claims

1. A specific primer set for detecting infectious hematopoietic necrosis virus, characterized in that: It comprises specific primers and probes, wherein the specific primers include: Upstream primer: IHNV-RPA-F3: sequence as shown in SEQ ID NO: 1; Downstream primer: IHNV-RPA-R3: sequence as shown in SEQ ID NO: 2; The probe has a THF site, the 5' end of the probe is at least 31 bases away from the THF site, and the 3' end of the probe is at least 16 bases away from the THF site.

2. The specific primer set for detecting infectious hematopoietic necrosis virus according to claim 1, characterized in that: The sequence of the 5' end of the probe from the THF site is shown in SEQ ID NO:3, and the sequence of the 3' end of the probe from the THF site is shown in SEQ ID NO:

4.

3. The specific primer set for detecting infectious hematopoietic necrosis virus according to claim 2, characterized in that: The 5' end of the probe is labeled with a FAM group, and the 3' end is labeled with a C3spacer spacer group.

4. Use of the specific primer set for detecting infectious hematopoietic necrosis virus according to any one of claims 1 to 3 in the preparation of a reagent or kit for detecting infectious hematopoietic necrosis virus.

5. A kit for detecting infectious hematopoietic necrosis virus, characterized in that: The specific primer set comprises any one of claims 1 to 3.

6. The kit according to claim 5, characterized in that It also includes at least one of A Buffer, B Buffer, RPA dry powder reagent, infectious hematopoietic necrosis virus standard and DEPC treated water.

7. The kit according to claim 6, characterized in that The A Buffer contains 5.46% PEG, 100mM KAc, and 25mM Tris; and the B Buffer contains 280mM MgAc.

8. The kit according to claim 6, characterized in that The ingredients of the RPA dry powder reagent are as follows: 150-240 μM dNTP, 200-300 ng / μL Gp32 protein, 150-260 ng / μL UvsX recombinase protein, 90 ng / μL Bsu DNA polymerase, 2% PEG, 5.7% trehalose, 200 μM dNTPs, 3 mM ATP, 2 mM DTT, 50 mM creatine phosphate, 25 mM Tris-HCl, 100 ng / μL creatine kinase, and 300 ng / μL nfo exonuclease.

9. A RPA-LFS constant temperature detection method for infectious hematopoietic necrosis virus, characterized in that: The method comprises: extracting RNA of the sample to be tested, reverse transcribing to obtain cDNA, using the cDNA of the sample to be tested as a template, using the kit described in any one of claims 5 to 8, performing RPA-LFS reaction, and analyzing the sample to be tested according to the color development of the colloidal gold test strip.

Images