A RT-RAA primer combination, probe, kit and application thereof for detecting Chinese soft-shelled turtle adenovirus

Abstract

The present invention discloses an RT-RAA primer combination, a probe, a kit and an application thereof for detecting a Chinese soft-shelled turtle adenovirus, and relates to the field of biological detection technology. The primer combination includes an upstream primer and a downstream primer; the nucleotide sequences of the upstream primer 1, the upstream primer 2 and the upstream primer 3 are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively; the nucleotide sequences of the downstream primer 1 and the downstream primer 2 are shown in SEQ ID NO:4 and SEQ ID NO:5 respectively; the nucleotide sequence of the probe is shown in SEQ ID NO:6 and SEQ ID NO:7; the kit includes the primer combination and the probe, and also provides a method for detecting a Chinese soft-shelled turtle adenovirus using the primer combination and the probe. The beneficial effect of the present invention is that an RT-RAA method for detecting a Chinese soft-shelled turtle adenovirus is established for the first time, which has high specificity and accuracy, and the RT-RAA is suitable for rapid on-site detection and is easy to use.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to an RT-RAA primer combination, a probe, a kit and applications thereof for detecting Chinese soft-shelled turtle adenovirus. Background Art

[0002] The Adenoviridae family is a non-enveloped icosahedral virion containing a linear dsDNA genome of 25-48 kb. Its members infect a variety of vertebrate hosts from fish to humans and are divided into six different genera: Adenine-thymine-rich adenovirus (Atadenovirus), Aviadenovirus, Ichtadenovirus, Mastadenovirus, Siadenovirus and Testadenovirus (Benkő et al., 2022; Harrach et al., 2019). Among them, the strains of the genus Atadenovirus occur in sea turtles, the strains of the genus Ichtadenovirus occur in fish, and the strains of the genus Siadenovirus infect birds, frogs and tortoises (Doszpoly et al., 2013; Doszpoly et al., 2019; Harrach et al., 2019). The severity of adenovirus infection ranges from subclinical to fatal (Benkő et al).

[0003] In 2023, the number of Chinese soft-shelled turtles ( Pelodiscus sinensis ) has a new disease with low egg production, bleeding in the intestine and sternum epithelium, and undigested beige rubbery food residues in the intestine. The results showed that the cause of the disease was caused by a newly discovered adenovirus, tentatively named Chinese soft-shell turtle adenovirus (PsAdV-zg). Tian et al. analyzed the genome sequence of the virus and showed that the virus had a double-stranded DNA genome of 25548 bp, suggesting that it should be classified as a sialidase adenovirus (Siadenovirus) (Tian et al., 2025). Before this evidence was discovered, adenovirus infection had only been reported in three turtles and tortoises: Leopard tortoises (Wilkinson., 2004); Sulawesi tortoises (Rivera et al., 2009) and box turtles (Farkas et al., 2009). Among them, based on phylogenetic analysis of partial DNA polymerase gene sequences, the Sulawesi turtle adenovirus appears to be related to the genus Sialidadenovirus, which causes severe systemic disease with a very high mortality rate (Rivera et al., 2009).

[0004] From the perspective of preventing major aquaculture losses, it is necessary to establish a diagnostic method for the disease as soon as possible to effectively investigate the epidemiology of the disease and meet the requirements of timely prevention and control. Rapid on-site diagnosis of animal diseases is conducive to the timely detection and control of animal diseases.

[0005] Cell culture technology is widely regarded as the gold standard for detecting most viruses, but it is costly, laborious and time-consuming. Therefore, it is not suitable for large-scale sample testing in epidemiological surveys and disease prevention and control. Nucleic acid amplification technology has become the most commonly used pathogen detection method recommended by the 2023 edition of the Manual of Aquatic Animal Diagnostic Tests (WOAH) due to its high accuracy, low cost, fast speed and high throughput.

[0006] Recombinase-mediated isothermal amplification (RAA) is a novel isothermal amplification technology that has attracted widespread attention due to its ability to efficiently and specifically amplify DNA in less than 30 minutes under isothermal conditions at 39°C-42°C (Chen et al., 2018). RAA offers a variety of endpoint detection formats, such as real-time fluorescence (RT), lateral flow test strips, and agarose gel electrophoresis. In recent years, RAA technology has become a promising field tool in molecular biology that can rapidly diagnose pathogens such as H5 subtype avian influenza virus (Wang et al., 2022) and duck circovirus (Li et al., 2022) using simple equipment. Quantitative detection of pathogens in infected animals is one of the most important means to assess disease progression. Summary of the invention

[0007] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art and to provide a RT-RAA primer combination, a probe, a kit and applications thereof for detecting Chinese soft-shelled turtle adenovirus.

[0008] The technical solution of the present invention is as follows: In a first aspect, the present invention provides an RT-RAA primer combination for detecting adenovirus of Chinese soft-shelled turtle, the primer combination comprising an upstream primer and a downstream primer; The upstream primer includes upstream primer 1, upstream primer 2, or upstream primer 3, and the nucleotide sequences of the upstream primer 1, the upstream primer 2, and the upstream primer 3 are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; The downstream primer includes downstream primer 1 or downstream primer 2, and the nucleotide sequences of the downstream primer 1 and the downstream primer 2 are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0009] In a second aspect, the present invention provides an RT-RAA probe for detecting Chinese soft-shell turtle adenovirus, wherein the nucleotide sequence of the probe is: ATGCTAGTGCTTTAACACACCCAATGCCA[FAM-dT][THF][BHQ1-dT]GGCATTCCTATCAG-P; Wherein, the FAM-dT is a thymine nucleotide carrying fluorescein, the THF is a tetrahydrofuran residue, the BHQ1-dT is a thymine nucleotide carrying a quenching group, and the P is a phosphate group. In a third aspect, the present invention provides a kit for detecting Chinese soft-shelled turtle adenovirus, comprising the primer combination and the probe.

[0010] In a preferred embodiment of the present invention, the kit comprises the upstream primer 3, the downstream primer 2 and the probe.

[0011] In a preferred embodiment of the present invention, the kit further comprises A Buffer, ddH2O and B Buffer.

[0012] In a fourth aspect, the present invention provides use of the kit in detecting Chinese soft-shell turtle adenovirus.

[0013] In a fifth aspect, the present invention provides the use of the primer combination and the probe in detecting Chinese soft-shelled turtle adenovirus.

[0014] In a preferred embodiment of the present invention, the method for detecting Chinese soft-shelled turtle adenovirus using the primer combination and the probe comprises: Extracting DNA from the sample to be tested to obtain template DNA; The template DNA is reacted with the primer combination, and the probe is reacted with A Buffer, B Buffer and ddH2O; According to the reaction result, it is determined whether the sample to be tested contains Chinese soft-shelled turtle adenovirus.

[0015] In a preferred embodiment of the present invention, the amount of A Buffer added is 25 μL, the amount of template DNA added is 5 μL, the amount of each primer combination with a concentration of 10 μM is 2 μL, the amount of the probe with a concentration of 10 μM is 0.6 μL, the amount of ddH2O added is 12.9 μL, and the amount of B Buffer added is 2.5 μL; The reaction time was 20 min, and the reaction temperature was 42°C.

[0016] In a fifth aspect, the present invention provides a use of the primer combination, the probe or the kit in detecting Chinese soft-shelled turtle adenovirus. The present invention has at least one of the following beneficial effects: The present invention provides an RT-RAA primer combination and probe and detection method for detecting Chinese soft-shelled turtle adenovirus, which has high specificity. Since the RT-RAA method lacks established primer and probe design principles and experience, the applicant has designed 3 upstream primers, 2 downstream primers and 2 probes after a lot of research and attempts to screen the best combination of primers and probes. Among them, the probe PsAdV-RAA-P2 and the primer pair PsAdV-RAA-F3 / R2 have the highest amplification efficiency and low fluorescence intensity (≤200 mV) during initial amplification, which is suitable for the RT-RAA system. After experiments, the PsAdV real-time recombinase-mediated isothermal amplification (RT-RAA) method completed the amplification reaction at 42°C for 20 minutes, and the sensitivity of detecting pUC57-PsAdV plasmid was 1.0×10 2 copies / μL.

[0017] Comparison of RT-RAA with the reported adenoviral consensus nested PCR detection method showed that RT-RAA has a high accuracy in detecting PsAdV in clinical specimens and provides a simple, sensitive and specific PsAdV identification method for on-site pathogen screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG1 is a real-time recombinase-assisted amplification (RT-RAA) primer and probe screening for detecting Chinese soft-shell turtle adenovirus (PsAdV) according to the present invention. (A) Amplification curve of probe PsAdV-RAA-P1 combined with forward and reverse primers. (B) Amplification curve of probe PsAdV-RAA-P2 combined with forward / reverse primers; wherein, line 1: F1-R1; line 2: F1-R2; line 3: F2-R1; line 4: F2-R2; line 5: F3-R1; line 6: F3-R2; line 7: negative control.

[0019] FIG2 shows the specificity test results of the present invention for PsAdV RT-RAA detection using total DNA extracted from pUC57-PsAdV, PsAdV-zg and other pathogens. Wherein, line 1: pUC57-PsAdV; line 2: PsAdV-zg genomic DNA; line 3: STIV; line 4: TSHSV; line 5: Cf; line 6: Av; line 7: Ah; line 8: Mm; line 9: Vc; line 10: negative control.

[0020] Figure 3The sensitivity of the PsAdV RT-RAA assay for detecting pUC57-PsAdV DNA was evaluated for the present invention. Among them, lines 1-7: the dilution range of pUC57-PsAdV DNA was 1.0×10 6 -1.0 copies / μL; Line 8: negative control.

[0021] FIG4 shows the repeatability of the PsAdV RT-RAA detection method for detecting pUC57-PsAdV DNA of the present invention. Among them, lines 1-3: dilution factor is 1.0×10 6 copies / μL; lines 4-6: dilution factor is 1.0×10 3 Copies / μL; Line 7: blank control. DETAILED DESCRIPTION

[0022] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] Example 1 1.1 Pathogens of Chinese soft-shelled turtle and clinical specimens PsAdV-zg (Tian et al. 2025), Citrobacter freundii (Cf) LCJY-002 (Tian et al. 2013), Aeromonas vermiformis (Av), Aeromonas hydrophila (Ah), and Morganella morganii (Mm) were isolated, identified, and preserved by our laboratory. Chinese soft-shell turtle iridovirus (STIV) and Chinese soft-shell turtle hemorrhagic syndrome virus (TSHSV) were generously provided by Dr. Liu Hong, Shenzhen Customs, China, and Dr. Liu Li, Institute of Hydrobiology, Zhejiang Academy of Sciences, China, respectively. Vibrio cholerae (Vc) was provided by Nanchang Center for Disease Control and Prevention, Jiangxi Province.

[0024] A total of 107 clinical visceral tissue samples (liver, spleen, and kidney) of diseased Chinese soft-shelled turtles were collected from a Chinese soft-shelled turtle farm in Nanfeng County, Fuzhou City, Jiangxi Province, China from April to June 2024. The clinical features of these diseased turtles included skin rot, hepatomegaly, intestinal hemorrhage, intestinal obstruction, and mumps.

[0025] 1.2. DNA / RNA extraction and preparation of DNA standards Prepare 100 μL virus suspension: Take the liver, spleen and kidney tissues of the diseased turtle under sterile conditions, add PBS at a ratio of 1:5 and homogenize. Filter the tissue sample suspension filtrate through a 0.22 μm filter membrane and infect the turtle kidney cell line. After 5 days of infection, the cells show obvious pathological effects. After freezing and thawing, take 100 μL of the supernatant to prepare 100 μL virus suspension.

[0026] Prepare 200 μL of tissue sample suspension: Take the liver, spleen, and kidney tissues of the diseased turtle, add PBS at a ratio of 1:1 to homogenize, and take 200 μL of the supernatant, which is the prepared 200 μL tissue sample suspension.

[0027] TaKaRa MiniBEST Viral RNA / DNA Extraction Kit (Beijing, China) was used to extract total DNA / RNA of all viruses from 100 μL of virus suspension according to the kit instructions. TaKaRa PrimeScript™ First-Strand cDNA Synthesis Kit (Beijing, China) was used to synthesize cDNA of RNA viruses according to the kit instructions. Bacterial genomic DNA was extracted using TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit (Beijing, China). Total DNA of clinical visceral tissues (liver, spleen, and kidney) of diseased Chinese soft-shelled turtles was extracted from 200 μL of tissue sample suspension using Qiagen DNeasy Blood&Tissue Kit (Hilden, NRW, Germany).

[0028] The DNA polymerase gene fragment (3324 bp) of PsAdV-zg (GenBank accession number: PQ083072) was synthesized by Sangon Biotech, Shanghai, China, and cloned into the pUC57 vector, named pUC57-PsAdV plasmid standard. The pUC57-PsAdV standard plasmid DNA was extracted using the TIANGEN TIANprep Mini plasmid Kit (Beijing, China), and then the concentration was determined using the BioPhotometer Plus Nucleic Acid / Protein Analyzer (Eppendorf, Germany). The DNA copy number was calculated as follows: DNA copy number = (M× 6.02 × 10 23 × 10 -9 ) / (n × 660), the result is 1.0×10 9 Then, TE buffer was used to convert the concentration of 1.0×10 9 The pUC57-PsAdV standard plasmid DNA with 10 copies / μL was serially diluted 10 times. The extracted pUC57-PsAdV standard plasmid DNA and the serially diluted pUC57-PsAdV standard plasmid DNA were then stored at -80°C for later use.

[0029] 1.3. Design of RT-RAA primers and probes In order to design primers and probes targeting specific conserved DNA fragments in the PsAdV-zg genome, the present invention selected DNA polymerase genes from the whole genome sequence of PsAdV-zg (GenBank accession number: PQ083072). In order to determine the most effective primer and probe combination for RT-RAA detection, three forward primers, two reverse primers and two probes were designed according to the ZC Bioscience RAA kit guide (Hangzhou Zhongce Bio-Sci&Tech Co. Ltd., China).

[0030] The designed primer and probe sequences are shown in Table 1.

[0031] Table 1 Optimization of RT-RAA reaction conditions Based on the PsAdV RT-RAA test, a 50 μL reaction system was prepared in a constant temperature fluorescence amplification instrument T16-ISO (TwistDx, United Kingdom) using the RAA exo kit (Hangzhou Zhongce Bio-Sci & Technology Co., Ltd.), including: 25 μL A Buffer (rehydration buffer), 5 μL template DNA, 2 μL forward and reverse primers (10 μM), 0.6 μL RAA exo probe (10 μM), 12.9 μL ddH2O and 2.5 μL B Buffer (280 Mm, magnesium acetate), and the reaction time was 20 min. 1.0×10 7 copies / μL pUC57-PsAdV DNA was used as a template, and RT-RAA amplification was performed at different incubation temperatures (35°C, 37°C, 39°C, 40°C, and 42°C) with different primer and probe combinations, which was repeated three times to determine the optimal reaction conditions.

[0032] RT-RAA specificity tests The specificity of the established PsAdV RT-RAA assay was evaluated by testing a variety of pathogens, including PsAdV-zg, STIV, TSHSV, Cf, Av, Ah, Mm, and Vc. 7 copies / μL) as the positive control, and ultrapure water as the negative control, and the results were repeated three times.

[0033] 1.6. RT-RAA sensitivity test To evaluate the sensitivity of RT-RAA in detecting PsAdV, the concentration of 1.0× 10 6The detection limit of RT-RAA assay was determined by using a gradient dilution of standard plasmid pUC57-PsAdV DNA from copies / μL to 1.0 copies / μL as a template. The test was repeated three times, and ultrapure water was used as a negative control template.

[0034] 1.7. RT-RAA repeatability test At a concentration of 1.0×10 6 copies / μL and 1.0×10 3 The pUC57-PsAdV plasmid standard with 100 copies / μL was used as a template, and the PsAdV RT-RAA method established by the present invention was used for intra-group repeatability detection test, with 3 replicates for each standard concentration. Subsequently, 3 independent inter-group repeatability tests were performed under the same conditions every 7 days to evaluate the repeatability of the method.

[0035] 1.8. Practical application of clinical samples In order to evaluate the accuracy of the RT-RAA detection method established by the present invention in detecting clinical samples, the applicant extracted 107 DNA samples from clinical visceral tissues (liver, spleen, and kidney) of diseased Chinese soft-shelled turtles with unknown PsAdV infection status. The extracted DNA was detected using the established RT-RAA detection method and the previously reported adenovirus universal nested PCR (Wellehan et al., 2004). The positive control, negative control, and blank control were pUC57-PsAdV plasmid DNA (1.0×10 7 copies / μL), DNA from healthy Chinese soft-shell turtle and DNA from ultrapure water.

[0036] 2. Results and Analysis 2.1. Optimization results of PsAdV RT-RAA detection method DNA polymerase gene sequences were selected as targets for primer and probe design. The designed RT-RAA primers and probes were arranged and combined for PsAdV RT-RAA detection. The relative performance of candidate primer and probe sets was evaluated and compared. The combination of probe PsAdV-RAA-P1 with forward / reverse primers was excluded due to excessively high fluorescence intensity (≥1 000 mV) observed during initial amplification ( Figure 1 A). Subsequently, an additional probe PsAdV-RAA-P2 was designed using the complementary strand of the targeted DNA polymerase sequence. The RT-RAA test results showed that the combination of probe PsAdV-RAA-P2 and primers PsAdV-RAA-F3 / R2 had the highest amplification efficiency on the fluorescence detection device T16-ISO ( Figure 1B). From the optimization of RT-RAA culture temperature, it was found that the optimal temperature was 42°C. Therefore, the primers and probe PsAdV-RAA-F3 / R2 / P2 were used as the best combination to amplify PsAdV RT-RAA at the optimal temperature (42°C) for subsequent experiments.

[0037] 2.2. Specificity test results When evaluating the specificity of the RT-RAA assay, no cross-reactions were observed with STIV, TSHSV, Cf, Av, Ah, Mm, Vc, and negative controls, and positive signals were only observed with PsAdV-zg genomic DNA and pUC57-PsAdV quality standards ( Figure 2 ). Therefore, the established PsAdV RT-RAA detection method has good specificity.

[0038] 2.3. Sensitivity test results Using 1.0×10 6 -1.0 copies / μL diluted recombinant plasmid was used to evaluate the sensitivity of the newly established RT-RAA detection method. Figure 3 As shown, the real-time fluorescence signal of RT-RAA amplification was positive when the target DNA concentration was 1.0×10 6 copies / μL to 1.0×10 2 The changes in the copies / μL range had a strong response, indicating that the sensitivity was high. In terms of reaction speed, RT-RAA could obtain amplification results within 20 min, indicating that the detection speed was fast and suitable for rapid testing.

[0039] Repeatability analysis The PsAdV RT-RAA method established by the present invention was used to detect the 6 copies / μL and 1.0×10 3 The standard plasmid with 100 copies / μL was used as the template to verify the intra-group repeatability and inter-group repeatability. The results showed that the same concentration of template in the intra-group and inter-group tests of the method of the present invention had consistent results, and the amplification curve changed very little ( Figure 4 ). The results showed that the established PsAdV RT-RAA method had good reproducibility and high reliability.

[0040] 2.5. RT-RAA detection of PsAdV in clinical specimens The utility of the PsAdV RT-RAA method was evaluated using 107 DNA samples extracted from clinical visceral tissue samples of diseased Chinese soft-shelled turtles of unknown PsAdV infection status, and the results were then compared with those of adenovirus universal nested PCR (Wellehan et al., 2004). Of the 107 samples, 44 were positive and 63 were negative by adenovirus universal nested PCR. The established RT-RAA method successfully detected 42 PsAdV-positive samples in clinical samples, with only 2 samples misdiagnosed as negative. Compared with adenovirus universal nested PCR, the DSe of the RT-RAA method was 95.45% and the DSp was 100%. The positive rates of the newly established RT-RAA method for clinical specimens were 39.25% (42 / 107), respectively. The results showed that RT-RAA had high accuracy in detecting clinical samples.

[0041] In summary, in order to achieve on-site rapid diagnosis of PsAdV, the present invention aims to establish a reliable PsAdV RT-RAA detection method. Maximum likelihood analysis based on DNA polymerase amino acid sequences is one of the criteria recommended by the International Committee on Taxonomy of Viruses (ICTV) for distinguishing adenovirus genera / species (Benkő et al., 2022). In order to improve the specificity of the detection method, the DNA polymerase gene was selected to design primers and probes for the detection method. In the RT-RAA experiment, due to the lack of established primer and probe design principles and experience in the RT-RAA method, the applicant designed 3 upstream primers, 2 downstream primers and 2 probes to screen the best combination of primers and probes. The probe PsAdV-RAA-P2 and the primer pair PsAdV-RAA-F3 / R2 had the highest amplification efficiency, and the fluorescence intensity was low (≤200 mV) during the initial amplification, which was suitable for the RT-RAA system. By comparing and analyzing the structural characteristics of probes PsAdV-RAA-P1 and PsAdV-RAA-P2 (Table 1) and the amplification results of their combination with upstream and downstream primers ( Figure 1 A and Figure 1 B), the applicant summarized the experience of RT-RAA probe design as follows: the closer and more symmetrical the distance between the flanking dt fluorophore and the corresponding dt quencher group is, the lower the fluorescence intensity value during initial amplification.

[0042] The RT-RAA reaction can be carried out in a wide temperature range of 37-42°C, and the amplification curve shows a fluorescence peak at 42°C. Therefore, the primers were combined with the probe PsAdV-RAA - F3 / R2 / P2, and PsAdVRT-RAA was amplified at the optimal temperature (42°C) for subsequent experiments.

[0043] The PsAdV RT-RAA detection method developed by the present invention has a high specificity for the detection of PsAdV, because only the standard plasmid pUC57-PsAdV and the DNA extracted from the Chinese soft-shelled turtle infected with PsAdV produced positive results in the amplification curve, which indicates that the developed PsAdV RT-RAA detection method has the potential to become a new differential diagnosis detection tool. The sensitivity test showed that the minimum detection limit of the RT-RAA method can reach 1.0×10 1 copies / μL, but when the standard plasmid DNA concentration is 1.0×10 1 When the real-time fluorescence signal is very weak, the sensitivity of this method is recommended to be 1.0×10 2 The RT-RAA method cannot currently achieve quantitative analysis, but it can amplify targets at a constant temperature and is fast. The RT-RAA detection device is simple, compact, portable, and can be charged by a battery for easy on-site use. These features make RT-RAA suitable for rapid diagnosis in field tests or mobile laboratories with imperfect equipment.

[0044] The present invention establishes for the first time a PsAdV RT-RAA detection method for epidemiological investigation and disease prevention of Chinese soft-shelled turtle adenovirus infection. The detection method is very effective for the detection of PsAdV and can be used for on-site pathogen screening and analysis.

[0045] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. An RT-RAA primer combination for detecting Chinese soft-shelled turtle adenovirus, characterized in that: The primer combination includes an upstream primer and a downstream primer; The upstream primer includes upstream primer 1, upstream primer 2, or upstream primer 3, and the nucleotide sequences of the upstream primer 1, the upstream primer 2, and the upstream primer 3 are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; The downstream primer includes downstream primer 1 or downstream primer 2, and the nucleotide sequences of the downstream primer 1 and the downstream primer 2 are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

2. An RT-RAA probe for detecting Chinese soft-shell turtle adenovirus, characterized in that: The nucleotide sequence of the probe is: ATGCTAGTGCTTTAACACACCCAATGCCA[FAM-dT][THF][BHQ1-dT]GGCATTCCTATCAG-P; Wherein, the FAM-dT is a thymine nucleotide carrying fluorescein, the THF is a tetrahydrofuran residue, the BHQ1-dT is a thymine nucleotide carrying a quenching group, and the P is a phosphate group.

3. A kit for detecting Chinese soft-shelled turtle adenovirus, characterized in that: It comprises the primer combination according to claim 1 and the probe according to claim 2.

4. The kit according to claim 3, characterized in that The kit comprises the upstream primer 3, the downstream primer 2 and the probe.

5. The kit according to claim 3, characterized in that The kit further comprises A Buffer, ddH2O and B Buffer.

6. Use of the kit according to any one of claims 3 to 5 in detecting Chinese soft-shelled turtle adenovirus.

7. Use of the primer combination according to claim 1 and the probe according to claim 2 in detecting Chinese soft-shelled turtle adenovirus.

8. The use according to claim 7, characterized in that: The method for detecting Chinese soft-shell turtle adenovirus using the primer combination of claim 1 and the probe of claim 2 comprises: Extracting DNA from the sample to be tested to obtain template DNA; The template DNA is reacted with the primer combination, and the probe is reacted with A Buffer, B Buffer and ddH2O; According to the reaction result, it is determined whether the sample to be tested contains Chinese soft-shelled turtle adenovirus.

9. The use according to claim 8, characterized in that: The amount of A Buffer added is 25 μL, the amount of template DNA added is 5 μL, the amount of each primer combination with a concentration of 10 μM added is 2 μL, the amount of the probe with a concentration of 10 μM added is 0.6 μL, the amount of ddH2O added is 12.9 μL, and the amount of B Buffer added is 2.5 μL; The reaction time is 20 min, and the reaction temperature is 42°C.

10. Use of the primer combination according to claim 1, the probe according to claim 2 or the kit according to claim 3 in detecting Chinese soft-shelled turtle adenovirus.

Images