Bimodal biosensor and application thereof in detection of OTA

Abstract

The invention discloses a bimodal biosensor and an application of the bimodal biosensor in detection of OTA. The bimodal biosensor comprises an OTA aptamer, an RCA isothermal amplification system and a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a (clustered regularly interspaced short palindromic repeats) system, wherein the RCA isothermal amplification system comprises a padlock template probe, DNA ligase, DNA polymerase, dNTP (deoxyribonucleoside triphosphate) and restriction endonuclease; the CRISPR / Cas12a system comprises a CRISPR buffer solution, a Cas12a protein, a crRNA (Complementary Ribonucleic Acid), a fluorescent probe and a test strip type probe. The detection method provided by the invention has the characteristics of good specificity, high sensitivity and low detection limit, and the bimodal OTA detection is realized by simultaneously adopting test strip visualization and fluorescence.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology detection, and in particular relates to a dual-mode biosensor and an application thereof in detecting OTA. Background Art

[0002] Ochratoxins are usually produced by Aspergillus and Penicillium in fungi, and ochratoxin A (OTA) is the most toxic of the seven ochratoxin structural analogs. It is the most widely distributed in nature and the most serious pollutant to crops. In toxicological studies, OTA often shows harm to organs such as the kidneys, liver, and lungs. It can harm the immune system and its functions of humans and mammals, leading to decreased immunity and even inducing cancer and fetal malformations. In addition, as a type of neurotoxin, OTA can induce apoptosis of nerve cells and prevent the regeneration of nerve tissue to a certain extent, thereby increasing the probability of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease. Since low doses of OTA can also accumulate in the human body, which in turn has a series of negative effects on human health, the International Agency for Research on Cancer has defined OTA as a Class 2B potential carcinogen.

[0003] Traditional detection methods include chromatography, mass spectrometry, etc. These methods are usually regarded as standard detection methods due to their high accuracy, sensitivity and reliability, and are therefore widely used. However, most of these detection methods require relatively expensive precision instruments, relatively cumbersome sample pretreatment methods, and professional detection personnel with relevant professional skills and knowledge, making rapid and high-throughput OTA detection difficult to achieve. Summary of the invention

[0004] The main purpose of the present invention is to provide a dual-modal biosensor and its application in detecting OTA, so as to achieve direct, rapid and sensitive detection of OTA, thereby overcoming the shortcomings of the prior art.

[0005] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention includes:

[0006] The embodiment of the present invention provides a dual-modal biosensor for detecting OTA, which includes: an OTA aptamer, an RCA isothermal amplification system, and a CRISPR / Cas12a system;

[0007] Among them, the RCA isothermal amplification system includes a padlock template probe, DNA ligase, DNA polymerase, dNTP and restriction endonuclease; the CRISPR / Cas12a system includes CRISPR buffer solution, Cas12a protein, crRNA, fluorescent probe, and test strip probe.

[0008] The embodiment of the present invention also provides the application of the aforementioned dual-modal biosensor in detecting OTA.

[0009] The embodiment of the present invention also provides a method for detecting OTA based on aptamer-mediated RCA combined with CRISPR / Cas12a, which comprises:

[0010] The sample to be tested, the OTA aptamer, and the RCA isothermal amplification system are mixed to react to obtain an intermediate product probe;

[0011] And, the intermediate product probe is mixed with the CRISPR / Cas12a system and incubated, and then the obtained product is subjected to fluorescence detection and colloidal gold immunochromatographic test paper detection, thereby realizing dual-modal detection of OTA in the sample to be tested;

[0012] Among them, the RCA isothermal amplification system includes a padlock template probe, DNA ligase, DNA polymerase, dNTP and restriction endonuclease; the CRISPR / Cas12a system includes CRISPR buffer solution, Cas12a protein, crRNA, fluorescent probe, and test strip probe.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] (1) The identification process based on OTA aptamers in the present invention ensures the specificity of the analysis;

[0015] (2) The present invention uses a combination of RCA isothermal amplification and CRISPR technology for dual signal amplification, which enhances sensitivity and has a detection limit as low as 0.17 fg / mL;

[0016] (3) The present invention uses a dual signal output mode of fluorescence and colloidal gold test strip visualization;

[0017] (4) The fluorescence signal output module of the present invention is in the "Signal-off" mode, while the colloidal gold signal output module is in the "Signal-on" mode. The change trend of the fluorescence signal is opposite to that of the colloidal gold signal, thus realizing dual-mode detection;

[0018] (5) The detection method provided by the present invention is not only applicable to the detection of OTA, but can also be used for the detection of other target objects to be detected. It only needs to design corresponding specific binding nucleic acid aptamers according to different target objects to be detected. The application prospect of the dual-modal biosensor of the present invention is relatively broad. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 This is a schematic diagram of detecting OTA based on aptamer-mediated RCA combined with CRISPR / Cas12a in a typical embodiment of the present invention;

[0021] Figure 2A-2C This is a diagram showing the feasibility verification result of using a dual-modal ultra-sensitive method for OTA identification and determination in a typical implementation scheme of the present invention;

[0022] Figure 3A-Figure 3F It is a diagram of the optimization results of the dual-modal reaction conditions of the Cas12a system in a typical embodiment of the present invention;

[0023] Figure 4A-4E This is a diagram showing the optimization results of RCA reaction conditions in a typical embodiment of the present invention;

[0024] Figure 5A-Figure 5B This is a diagram showing the optimization results of various influencing factors of the identification module in a typical implementation scheme of the present invention;

[0025] Figure 6A-6C This is a diagram showing the detection results of OTA sensitivity using a dual-modal method in a typical implementation of the present invention;

[0026] Figure 7A-7B This is a graph showing the results of a specificity study in a typical embodiment of the present invention;

[0027] Figure 8A-B This is a diagram showing the stability and repeatability verification results in a typical embodiment of the present invention;

[0028] Figure 9A-9B This is a diagram of the dual-modal detection results of an actual sample spiked in a typical implementation scheme of the present invention. DETAILED DESCRIPTION

[0029] In view of the defects of the prior art, the inventor of this case has proposed the technical solution of the present invention after long-term research and extensive practice. The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Specifically, as one aspect of the technical solution of the present invention, a dual-modal biosensor is used to detect OTA, which includes: an OTA aptamer, an RCA isothermal amplification system, and a CRISPR / Cas12a system;

[0031] Among them, the RCA isothermal amplification system includes a padlock template probe, DNA ligase, DNA polymerase, dNTP and restriction endonuclease; the CRISPR / Cas12a system includes CRISPR buffer solution, Cas12a protein, crRNA, fluorescent probe, and test strip probe.

[0032] In some preferred embodiments, the OTA aptamer has a sequence as shown in SEQ ID NO.1.

[0033] In some preferred embodiments, the padlock template probe has a sequence as shown in SEQ ID NO.2.

[0034] In some preferred embodiments, the fluorescent probe has a sequence as shown in SEQ ID NO.3.

[0035] In some preferred embodiments, the test strip probe has a sequence as shown in SEQ ID NO.4.

[0036] In some preferred embodiments, the crRNA has a sequence as shown in SEQ ID NO.5.

[0037] In some preferred embodiments, the DNA ligase includes T4 DNA ligase, but is not limited thereto.

[0038] In some preferred embodiments, the DNA polymerase includes Phi29 DNA polymerase and / or Bst DNA polymerase, but is not limited thereto.

[0039] In some preferred embodiments, the restriction endonuclease includes Nb.BbvCI nicking endonuclease and / or BspQI enzyme, but is not limited thereto.

[0040] In some preferred embodiments, the fluorescent probe is used for fluorescent signal output.

[0041] In some preferred embodiments, the test strip probe is used for colloidal gold signal output.

[0042] Another aspect of the embodiments of the present invention further provides the application of the aforementioned dual-modal biosensor in detecting OTA.

[0043] Another aspect of an embodiment of the present invention further provides a method for detecting OTA based on aptamer-mediated RCA combined with CRISPR / Cas12a, comprising:

[0044] The sample to be tested, the OTA aptamer, and the RCA isothermal amplification system are mixed to react to obtain an intermediate product probe;

[0045] And, the intermediate product probe is mixed with the CRISPR / Cas12a system and incubated, and then the obtained product is subjected to fluorescence detection and colloidal gold immunochromatographic test paper detection, thereby realizing dual-modal detection of OTA in the sample to be tested;

[0046] Among them, the RCA isothermal amplification system includes a padlock template probe, DNA ligase, DNA polymerase, dNTP and restriction endonuclease; the CRISPR / Cas12a system includes a CRISPR buffer system, Cas12a protein, crRNA, a fluorescent probe, and a test strip probe.

[0047] The aptamer domain in the present invention is combined with the analyte OTA; the padlock template probe domain is hybridized with the aptamer domain to initiate the RCA reaction; the RCA isothermal amplification product has a large number of enzyme cleavage sites, which are cleaved by restriction endonucleases, thereby generating a large number of intermediate product probes; the intermediate product probe forms a ternary complex with the Cas12a protein and crRNA, stimulating the trans-cleavage ability of the Cas12a protein to cut the ssDNA1 (FAM-BHQ1) fluorescent probe and the ssDNA2 (FITC-Biotin) test strip probe free in the system, thereby realizing a dual-modal signal output method based on nucleic acid chromatography test strips and fluorescent signals.

[0048] In some preferred embodiments, the OTA aptamer has a sequence as shown in SEQ ID NO.1.

[0049] In some preferred embodiments, the padlock template probe has a sequence as shown in SEQ ID NO.2.

[0050] In some preferred embodiments, the fluorescent probe has a sequence as shown in SEQ ID NO.3.

[0051] In some preferred embodiments, the test strip probe has a sequence as shown in SEQ ID NO.4.

[0052] In some preferred embodiments, the crRNA has a sequence as shown in SEQ ID NO.5.

[0053] In some preferred embodiments, the intermediate product probe has a sequence as shown in SEQ ID NO.6.

[0054] In some preferred embodiments, the DNA ligase includes T4 DNA ligase, but is not limited thereto.

[0055] In some preferred embodiments, the DNA polymerase includes Phi29 DNA polymerase and / or Bst DNA polymerase, but is not limited thereto.

[0056] In some preferred embodiments, the restriction endonuclease includes Nb.BbvCI nicking endonuclease and / or BspQI enzyme, but is not limited thereto.

[0057] In some preferred embodiments, the fluorescent probe is used for fluorescent signal output.

[0058] In some preferred embodiments, the test strip probe is used for colloidal gold signal output.

[0059] In some preferred embodiments, the colloidal gold immunochromatography test paper comprises a sample pad, a conjugate pad, a nitrocellulose membrane and a bottom plate; the nitrocellulose membrane is provided with a detection line and a quality control line; the detection line is fixed with streptavidin; and the quality control line is fixed with FITC antibody.

[0060] In some preferred embodiments, the method specifically includes: mixing the sample to be tested, OTA aptamer, padlock template probe, dNTP, DNA ligase, and DNA polymerase and incubating at 35-37°C for 0.5-1h, then heating at 65-80°C for 10-15min to inactivate the enzyme, then adding restriction endonuclease and incubating at 35-37°C for 0.5-1h, and finally heating at 65-80°C for 10-15min to inactivate the enzyme to obtain an intermediate product probe.

[0061] In some preferred embodiments, the method specifically comprises: mixing the intermediate product probe with the CRISPR / Cas 1 2a system and incubating at 35-37°C for 1 hour, then heating at 65-80°C for 10-15 minutes to terminate the reaction, then measuring the fluorescence characteristic peak of the obtained product at 520nm and performing colloidal gold immunochromatographic test paper detection;

[0062] When the fluorescence characteristic peak is detected and the intensity of the peak is higher than the negative fluorescence peak plus 3 times the standard deviation value (that is, the fluorescence characteristic peak is detected and the intensity of the peak is higher than the sum of the negative fluorescence peak and 3 times the standard deviation value), and the T line in the colloidal gold immunochromatographic test paper does not show color, it indicates that the sample to be tested does not contain OTA; when the fluorescence characteristic peak is not detected and the fluorescence characteristic peak is less than the negative fluorescence peak minus 3 times the standard deviation value (that is, when the fluorescence characteristic peak is not detected or the fluorescence characteristic peak is less than the difference between the negative fluorescence peak and 3 times the standard deviation value), and the T line in the colloidal gold immunochromatographic test paper shows color, it indicates that the sample to be tested contains OTA.

[0063] OTA aptamers in the present invention can specifically identify the object to be measured OTA, and when the two are combined, the change of spatial conformation of the aptamer will be caused, so that the OTA aptamer cannot be combined with the padlock template probe, thereby suppressing RCA isothermal amplification, and Cas12a cannot be activated to output signals. On the contrary, if there is no object to be measured OTA, RCA isothermal amplification technology will produce long ssDNA with repetitive sequences, and these repetitive sequences are cut by restriction endonucleases by the restriction sites designed on the padlock template probe, so as to produce a large amount of intermediates. These intermediates are recognized by crRNA, and binary complexes are formed, activating the trans-cutting activity of Cas12a protein, and removing free ssDNA1 (FAM-BHQ1) fluorescent probe and ssDNA2 (FITC-Biotin) test strip type probe in the cutting system.

[0064] When the ssDNA1 (FAM-BHQ1) fluorescent probe is cut, the fluorescent group and the quenching group separate, resulting in the recovery of the fluorescent signal. When the ssDNA2 (FITC-Biotin) test strip probe is cut, the SAV on the test line cannot capture the probe, so the test line will not show color. Regardless of whether the test strip probe is cut, the secondary antibody on the C line can bind to the gold nanoparticles coupled with the FITC antibody, causing the C line to show color.

[0065] The present invention combines the recognition of OTA by OTA aptamers with RCA isothermal amplification technology, and activates Cas 1 2a protein by designed crRNA (5'-3'UAAUUUCUACUAAGUGUAGAU GCG UGC GCA UAG CUC CUCA), so as to achieve accurate detection of OTA. In the presence of target OTA, the recognition of OTA by aptamers inhibits RCA isothermal amplification, and Cas12a cannot be activated for signal output. On the contrary, if there is no OTA, RCA isothermal amplification technology will produce long ssDNA with repetitive sequences. These repetitive sequences are cut by restriction endonucleases to produce a large number of intermediates, and this step is named P-ERCA reaction. These intermediates are recognized by crRNA, activating the trans-cutting activity of Cas12a protein. Free ssDNA1 (FAM-BHQ1) and ssDNA2 (FITC-Biotin) in the cutting system are removed, and the probe is randomly cut into fragments. At the same time, dual-mode OTA detection is carried out using test strip visualization and fluorescence results, which provides effective help for the simultaneous qualitative and quantitative detection of OTA in food samples.

[0066] The schematic diagram of a typical embodiment of the present invention for detecting OTA based on aptamer-mediated RCA combined with CRISPR / Cas12a is shown in FIG. Figure 1 shown.

[0067] The technical solution of the present invention is further described in detail below in conjunction with several preferred embodiments and drawings. This embodiment is implemented on the premise of the technical solution of the invention, and a detailed implementation method and specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0068] Unless otherwise specified, the experimental materials used in the following examples can be purchased from conventional biochemical reagent companies.

[0069] In the following examples, all sequence information used is shown in Table 1.

[0070] Table 1

[0071]

[0072] Example 1 Experimental module design

[0073] RCA isothermal amplification module: 2 μL of 100 nM aptamer solution was added to 7 μL of hybridization binding solution of OAT aptamer and padlock template probe (10 μL of 100 mM Tris-HCl solution (pH 7.4), 10 μL of 1.2 M NaCl, 10 μL of 100 mM KCl, 10 μL of 200 mM MgCl2 and 10 μL of 0.5% PEG 1000, added to ultrapure water to 10 mL), followed by 1 μL of 1 μM padlock template probe solution, 10 mM dNTP mixture, 5 U of T4 DNA ligase, 5 U of Phi29 DNA polymerase and 2 μL of buffer solution required for each enzyme. The obtained RCA amplification system was incubated at 37 ° C for 1 hour, and then heated at 65 ° C for 10 minutes to inactivate the enzyme.

[0074] Formation of intermediate product probes: Based on the above RCA isothermal amplification reaction, 15U Nb.BbvCI nicking endonuclease and 2μL of the buffer solution required by the enzyme were added. The system was incubated at 37°C for 1 hour, and then heated at 65°C for 10 minutes to inactivate the enzyme, thereby obtaining a solution containing a large amount of intermediate product probes.

[0075] Cas12a system dual-mode probe design. Take 10 μL of amplified product solution, add 1 μL 500nM Cas12a protein, 2.5 μL buffer solution, 1 μL 500nM crRNA and 5 μM ssDNA1 (FAM-BHQ1) and ssDNA2 (FITC-Biotin) 2 μL each, add ddH2O to supplement the system to 25 μL. After the obtained Cas system solution was incubated at 37 ° C for 1 hour, 80 ° C was heated for 10 min to inactivate the Cas12a protein and terminate the reaction. The mixed solution after cutting was added to 75 μL of Runningbuffer and mixed evenly, wherein the fluorescence was restored after ssDNA1 was cut off, and the fluorescence was excited at 490nm with a fluorescence spectrophotometer to measure the characteristic peak of FAM at 520nm. 60 μL of the mixed solution after measuring the fluorescence signal is added dropwise to the sample pad of the assembled lateral flow chromatography test strip. If the ssDNA2 contained therein is cut, the SAV on the T line will capture the 3′ end of the ssDNA2 that is only modified by Biotin, and the T line will not show color; if the ssDNA2 is not cut, the SAV on the T line will capture the complete ssDNA2, and the FITC at its 5′ end can specifically recognize and bind to the gold nanoparticles coupled with the FITC antibody, so that the T line will show color. Regardless of whether the ssDNA2 is cut, the secondary antibody on the C line can bind to the gold nanoparticles coupled with the FITC antibody, so that the C line will show color.

[0076] Preparation of gold-antibody conjugate: Add 990 μL of prepared BB buffer solution to 10 μL of gold nanoparticle solution and mix well, then add 8 μL of 1 mg / mL FITC antibody and incubate on a rotating incubator for 1 hour. After incubation, add 100 μL of 10% BSA solution to block the unbound sites of the antibody on the gold nanoparticles to reduce nonspecific binding. After blocking for 1 hour, centrifuge the mixed solution at 8600g for 10 minutes, and discard the supernatant to remove excess unbound antibodies. Add 100 μL of resuspension solution and mix well, pipette 4 μL and drop it onto the gold label pad, and place it in a 37°C oven to dry for 12 hours for use.

[0077] Preparation and assembly of lateral flow chromatography test strips: The lateral flow chromatography test strips used in this method are nucleic acid and immune combined test strips, which are mainly characterized by 1 mg / mL of streptavidin (SAV) sprayed on the T line of the NC membrane to capture the ssDNA2 single strand modified with biotin (Biotin) at one end; 1 mg / mL of secondary antibody is sprayed on the C line to capture colloidal gold particles bound to FITC antibodies. After the NC membrane sprayed with T line and C line is placed in a constant temperature forced air drying oven for 12 hours, it is stacked and assembled on the PVC bottom plate with the sample pad, conjugate pad and absorbent pad in sequence to form a detection platform with capillary action. After the assembled test strip is evenly cut to 3 mm wide with a strip cutter, it is placed in a sealed bag and stored at room temperature for later use.

[0078] Example 2 Experimental Feasibility Analysis

[0079] Add 10μL of 1μM aptamer to lane 1 of the agarose gel, 10μL of 1μM padlock template probe to lane 2, and 10μL of 1μM aptamer and 10μL of 1μM padlock template probe to lane 3. Add 10μL of RCA product to lane 4, which includes 2μL of 100nM aptamer, 1μL of 1μM padlock template probe, 5U T4DNA ligase, 10mMdNTPs, 5U Phi29 DNA polymerase, and 2μL of buffer solution required for various enzymes. Add 10μL of product containing 15UNb.BbvCI restriction endonuclease to lane 5. The remaining components, except Nb.BbvCI, are the same as the RCA system. In addition, the RCA product and restriction endonuclease product were combined with the Cas12a signal amplification system for fluorescence and test strip colorimetric signal detection to form a negative control group; at the same time, OTA was added to the entire RCA+Cas12a system to form a positive control.

[0080] Figure 2AThe gel electrophoresis results for the feasibility of the amplification reaction. Lanes 1, 2, and 3 are the bands of the aptamer, padlock template probe, and aptamer + padlock template probe, respectively. Lane 4 is the product of the RCA reaction. Since the product of RCA is a long single-stranded product, it shows a blocking result. After the restriction endonuclease reaction is added, the long single-stranded product is converted into an intermediate product, so the blocking phenomenon disappears (lane 5). Figure 2B and Figure 2C This is a dual-mode feasibility verification of the aptamer-mediated RCA combined with the CRISPR-Cas12a system. The fluorescence signal of the RCA+Cas system is the strongest, and the fluorescence signal of the OTA+RCA+Cas system is the lowest. The fluorescence signal of the intermediate product+Cas system is higher, and the fluorescence signal of the OTA+intermediate product+Cas system is similar to that of the OTA+RCA+Cas system. The color intensity of the T line of the test strip is opposite to the fluorescence signal value, showing two dual-mode signal expression patterns.

[0081] Example 3 Optimization of dual-mode reaction conditions of Cas12a system

[0082] Optimize the bimodal reaction conditions of the Cas12a system, such as optimization of ssDNA1 and ssDNA2 concentrations, Cas12a protein concentration, Cas system buffer type, crRNA concentration, Cas system reaction temperature, Cas system reaction time, etc., to enhance the bimodal reaction performance of the Cas12a system. Figure 3A-Figure 3F Optimization of the dual-mode reaction conditions of the Cas12a system: Among them, different concentrations (such as Figure 3A )ssDNA1 and ssDNA2 and (such as Figure 3B )Cas12a protein; (e.g. Figure 3C ) The types of different buffers required by the Cas12a system; (e.g. Figure 3D ) Different concentrations of crRNA; (e.g. Figure 3E ) The temperature of the Cas12a system reaction; (e.g. Figure 3F ) Cas12a system reaction time; Figure 3A-Figure 3F The results show that the best reaction conditions are when the concentrations of ssDNA1 and ssDNA2 are both 5000nM. At the same time, when the concentration of Cas12a protein is 500nM, the buffer is NEB.4, the concentration of crRNA is 500nM, and the reaction temperature and reaction time are 37°C and 1h respectively, which are the best reaction conditions.

[0083] Example 4 RCA module optimization

[0084] Optimize the RCA module conditions, such as T4 DNA ligase concentration, dNTP concentration, Phi29 DNA polymerase concentration, RCA reaction temperature, and RCA reaction time. Figure 4A-4ETo optimize the RCA reaction conditions: different concentrations (such as Figure 4A )T4 DNA ligase; (such as Figure 4B )Phi 29 DNA polymerase; (e.g. Figure 4C )dNTPs; and (such as Figure 4D ) RCA reaction temperature; (e.g. Figure 4E ) RCA reaction time; Figure 4A-4E The results showed that the optimal concentration of T4 enzyme was 5U, the optimal concentration of Phi29 DNA polymerase was 5U, the concentration of dNTPs was 10000μM, the optimal reaction temperature of RCA was 37℃, and the optimal reaction time was 1h.

[0085] Example 5 Optimization of the binding conditions between aptamer and OTA

[0086] The addition amount of OTA and binding solution and the recognition time between OTA and aptamer were optimized respectively. Figure 5A-Figure 5B To optimize the influencing factors of the identification module: Figure 5A is the ratio of OTA to binding solution, Figure 5B It is the identification time of OTA in the identification module; Figure 5A It was shown that 5 μL of binding solution and 4 μL of OTA addition were selected as the optimal recognition system. Figure 5B The display selects 1h as the optimal recognition time.

[0087] Example 6 Sensitivity Detection

[0088] Figure 6A-6C The dual-mode method is used to detect the sensitivity of OTA: the concentration of OTA standard solution is 0.1fg / mL-1ng / mL ( Fig. 6A )Test strip test results: ( Figure 6B ) Fluorescence signal detection results; (such as Figure 6C )Linear analysis results. From the color development results of the test strip, when the addition amount of OTA reaches 1fg / mL, the T line slightly emerges, and as the concentration increases, the color development degree of the T line remains basically unchanged after 10fg / mL. Therefore, the visual detection sensitivity of the test strip immunochromatography is set to 1fg / mL. The fluorescence detection signal gradually decreases with the increase in the amount of OTA added, and the downward trend is not obvious after 10pg / mL. The F0-F value is linearly correlated with the OTA concentration in the range of 0.1fg / mL-1pg / mL. The quantitative analysis LOD obtained by calculation is 0.17fg / mL.

[0089] Example 7 Specificity Study Results

[0090] 1 ng / mL standard solutions of OTB, OTC, AFM1, DON and ZEN and 1 pg / mL standard solution of OTA were tested. Figure 7A-7B The specificity study results are: Fig. 7A ) Test paper items depend on the test results; Figure 7B ) Fluorescence signal intensity of OTA and other mycotoxins (other mycotoxins concentration was 1 ng / mL, OTA concentration was 1 pg / mL); Figure 7A-7B It can be seen that the T line of the test strip will only show color when OTA is present. At the same time, the fluorescence signal value of OTA is significantly lower than that of other mycotoxins.

[0091] Example 8 Repeatability and stability testing

[0092] The concentration of OTA standard solution for repeatability and stability testing was set to 1pg / mL. The results are as follows Figure 8A-B As shown, Fig. 8A The visual stability of the test strips was tested for the test strips stored at room temperature for one month; Figure 8B It is the average T line intensity of the test strips stored at room temperature for one month; it can be seen that the LFS test results obtained on different days are basically consistent, showing its good stability. Among them, the relative standard deviation (RSD) obtained by four parallel experiments is between 5.77% and 9.71%, showing its good repeatability.

[0093] Example 9 Actual sample detection

[0094] In order to evaluate the applicability of this method to complex biological samples, a series of treatment methods were used to add 1 pg / mL OTA standard solution to actual samples purchased from corn and coffee to form spiked samples, and the dual-modal signals were detected. Figure 9A-9B As shown, Fig.9A Test strip test results, Fig. 9B The colloidal gold signal and the fluorescence signal are significantly different when the actual sample is contaminated or not.

[0095] In addition, the inventors of this case also referred to the aforementioned embodiments and conducted experiments with other raw materials, process operations, and process conditions described in this specification, and obtained relatively ideal results.

[0096] It should be understood that the technical solution of the present invention is not limited to the above-mentioned specific implementation cases. Any technical deformation made according to the technical solution of the present invention without departing from the scope of protection of the purpose of the present invention and the claims shall fall within the protection scope of the present invention.

Claims

1. A dual-modal biosensor for detecting OTA, characterized in that: include: OTA aptamers, RCA isothermal amplification system, CRISPR / Cas12a system; Among them, the RCA isothermal amplification system includes a padlock template probe, DNA ligase, DNA polymerase, dNTP and restriction endonuclease; the CRISPR / Cas12a system includes CRISPR buffer solution, Cas12a protein, crRNA, fluorescent probe, and test strip probe.

2. The dual-modal biosensor according to claim 1, characterized in that: The OTA aptamer has a sequence as shown in SEQ ID NO.1; And / or, the padlock template probe has the sequence shown in SEQ ID NO.2; And / or, the fluorescent probe has a sequence as shown in SEQ ID NO.3; And / or, the test strip probe has the sequence shown in SEQ ID NO.4; And / or, the crRNA has a sequence as shown in SEQ ID NO.

5.

3. The dual-modal biosensor according to claim 1, characterized in that: The DNA ligase comprises T4 DNA ligase; And / or, the DNA polymerase comprises Phi29 DNA polymerase and / or Bst DNA polymerase; and / or, the restriction endonuclease comprises Nb.BbvCI nicking endonuclease and / or BspQI enzyme; And / or, the fluorescent probe is used for outputting fluorescent signals; And / or, the test strip type probe is used for colloidal gold signal output.

4. Use of the dual-modal biosensor according to any one of claims 1 to 3 in detecting OTA.

5. A method for detecting OTA based on aptamer-mediated RCA combined with CRISPR / Cas12a, characterized in that: include: The sample to be tested, the OTA aptamer, and the RCA isothermal amplification system are mixed to react to obtain an intermediate product probe; And, the intermediate product probe is mixed with the CRISPR / Cas12a system and incubated, and then the obtained product is subjected to fluorescence detection and colloidal gold immunochromatographic test paper detection, thereby realizing dual-modal detection of OTA in the sample to be tested; Among them, the RCA isothermal amplification system includes a padlock template probe, DNA ligase, DNA polymerase, dNTP and restriction endonuclease; the CRISPR / Cas12a system includes a CRISPR buffer system, Cas12a protein, crRNA, a fluorescent probe, and a test strip probe.

6. The method according to claim 5, characterized in that: The OTA aptamer has a sequence as shown in SEQ ID NO.1; And / or, the padlock template probe has the sequence shown in SEQ ID NO.2; And / or, the fluorescent probe has a sequence as shown in SEQ ID NO.3; And / or, the test strip probe has the sequence shown in SEQ ID NO.4; And / or, the crRNA has the sequence shown in SEQ ID NO.5; And / or, the intermediate product probe has the sequence shown in SEQ ID NO.

6.

7. The method according to claim 5, characterized in that: The DNA ligase comprises T4 DNA ligase; And / or, the DNA polymerase comprises Phi29 DNA polymerase and / or Bst DNA polymerase; and / or, the restriction endonuclease comprises Nb.BbvCI nicking endonuclease and / or BspQI enzyme; And / or, the fluorescent probe is used for outputting fluorescent signals; And / or, the test strip type probe is used for colloidal gold signal output.

8. The method according to claim 5, characterized in that: The colloidal gold immunochromatographic test paper comprises a sample pad, a binding pad, a nitrocellulose membrane and a bottom plate; the nitrocellulose membrane is provided with a detection line and a quality control line; the detection line is fixed with streptavidin; and the quality control line is fixed with FITC antibody.

9. The method according to claim 5, characterized in that Specifically include: The sample to be tested, OTA aptamer, padlock template probe, dNTP, DNA ligase, and DNA polymerase are mixed and incubated at 35-37°C for 0.5-1h, then heated at 65-80°C for 10-15min to inactivate the enzyme, and then restriction endonuclease is added and incubated at 35-37°C for 0.5-1h, and finally heated at 65-80°C for 10-15min to inactivate the enzyme to obtain an intermediate product probe.

10. The method according to claim 5, characterized in that Specifically include: The intermediate product was mixed with the CRISPR / Cas12a system and incubated at 35-37°C for 1 hour, and then heated at 65-80°C for 10-15 minutes to terminate the reaction, and then the fluorescence characteristic peak of the obtained product at 520nm was measured and colloidal gold immunochromatography test paper was performed; When the fluorescence characteristic peak is detected and the intensity of the peak is higher than the sum of the negative fluorescence peak and 3 times the standard deviation value, and the T line in the colloidal gold immunochromatographic test paper does not show color, it indicates that the sample to be tested does not contain OTA; when the fluorescence characteristic peak is not detected or the fluorescence characteristic peak is less than the difference between the negative fluorescence peak and 3 times the standard deviation value, and the T line in the colloidal gold immunochromatographic test paper shows color, it indicates that the sample to be tested contains OTA.

Images