Application of PTPN14 or coding gene thereof in colon cancer diagnosis and / or prognosis

Abstract

The invention belongs to the technical field of molecular biology and biological medicine, and particularly relates to application of protein tyrosine phosphatase non-receptor 14 (PTPN14) or a coding gene thereof in colon cancer diagnosis and / or prognosis. In-vivo and in-vitro experiments show that the expression level of PTPN14 is related to staging progress and prognosis of colon cancer patients. The over-expression of the PTPN14 promotes the proliferation, migration and invasion ability of the colon cancer cell line, and the knock-down of the PTPN14 inhibits the proliferation, migration and invasion ability of the colon cancer cell line. Overexpression of the PTPN14 promotes tumor formation of the colon cancer cell line in the subcutaneous part of a nude mouse, and knock-down of the PTPN14 inhibits tumor formation of the colon cancer cell line in the subcutaneous part of the nude mouse. The PTPN14 or the coding gene thereof can be used as a marker for diagnosing the colon cancer, evaluating the prognosis of the colon cancer and monitoring the progression of the colon cancer.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and biomedicine technology, and specifically relates to the application of PTPN14 or its encoding gene in the diagnosis and / or prognosis of colon cancer. Background Art

[0002] Colon cancer is a common malignant tumor of the digestive system, with a high incidence and mortality rate, posing a major threat to the lives and health of the people. Traditional biomarkers such as carcinoembryonic antigen have low specificity and cannot meet clinical needs. Therefore, it is necessary to develop new colon cancer-related markers.

[0003] Protein tyrosine phosphatase non-receptor type 14 (PTPN14) is a member of the non-transmembrane tyrosine phosphatases and belongs to the classic phosphotyrosine (pY)-specific phosphatases. It was first discovered in normal human breast tissue in 1995 and is widely expressed in skeletal muscle, kidney, lung, placenta and other tissues. PTPN14 has an N-terminal FERM domain associated with the cytoskeleton (Band4.1, ezrin, radixin, moesin), an intermediate linker region containing an acidic region PPxY domain that can interact with other proteins containing a putative SH3 domain, and a C-terminal conserved PTP domain involved in catalytic phosphorylation. However, the function of PTPN14 in colon cancer cells and its role in colon cancer tumor formation and development are still unclear. Summary of the invention

[0004] The purpose of the present invention is to provide the application of PTPN14 or its encoding gene in the diagnosis and / or prognosis of colon cancer, to use PTPN14 or its encoding gene as a marker to diagnose colon cancer, to evaluate the prognosis of colon cancer, to monitor the progression of colon cancer, and to enrich the application of PTPN14 or its encoding gene.

[0005] The present invention provides the use of a substance for detecting protein tyrosine phosphatase non-receptor type 14 or its coding gene in the preparation of a colon cancer diagnosis and / or prognosis product.

[0006] Preferably, the diagnosis includes colon cancer staging diagnosis;

[0007] The prognosis includes one or more of prognosticating the clinical outcome of the subject, prognosticating the treatment effect of the subject, and prognosticating the survival of the subject.

[0008] Preferably, the protein tyrosine phosphatase non-receptor type 14 is significantly upregulated in patients with colon cancer.

[0009] The present invention also provides the use of a substance for detecting protein tyrosine phosphatase non-receptor type 14 or its coding gene in the preparation of a colon cancer disease progression monitoring product.

[0010] Preferably, the expression level of protein tyrosine phosphatase non-receptor type 14 increases with the progression of colon cancer stages.

[0011] Preferably, the product includes a diagnostic agent, a test kit, a chip, a test paper or a well plate;

[0012] The substance for detecting protein tyrosine phosphatase non-receptor type 14 includes an antibody for detecting anti-protein tyrosine phosphatase non-receptor type 14;

[0013] The material for detecting the protein tyrosine phosphatase non-receptor type 14 encoding gene includes primers.

[0014] The present invention also provides a kit for diagnosing colon cancer, evaluating the prognosis of colon cancer patients or monitoring the progression of colon cancer, wherein the kit comprises a reagent for detecting protein tyrosine phosphatase non-receptor type 14 or a gene encoding the protein tyrosine phosphatase.

[0015] The present invention also provides the use of an agent for knocking down protein tyrosine phosphatase non-receptor type 14 or its encoding gene in one or more of preventing and treating colon cancer, improving colon cancer progression and improving the prognosis of colon cancer patients.

[0016] Preferably, the prevention and treatment of colon cancer, improvement of colon cancer progression and improvement of prognosis of colon cancer patients include one or more of inhibiting the proliferation of colon cancer cell lines, inhibiting the migration of colon cancer cell lines, inhibiting the invasion of colon cancer cell lines and inhibiting the tumorigenesis of colon cancer.

[0017] The present invention also provides a shRNA for preventing and treating colon cancer, improving the progression of colon cancer or improving the prognosis of colon cancer patients, wherein the shRNA comprises one or more of sh-PTPN14-1, sh-PTPN14-2 and sh-PTPN14-3;

[0018] The target sequence of the sh-PTPN14-1 is shown in SEQ ID NO: 1;

[0019] The target sequence of the sh-PTPN14-2 is shown in SEQ ID NO: 2;

[0020] The target sequence of sh-PTPN14-3 is shown in SEQ ID NO:3.

[0021] Beneficial effects:

[0022] The present invention provides the use of a substance for detecting protein tyrosine phosphatase non-receptor type 14 or its encoding gene in the preparation of a colon cancer diagnosis and / or prognosis product. The present invention found through in vivo and in vitro experiments that the expression level of PTPN14 is related to colon cancer. Overexpression of PTPN14 promotes the proliferation, migration and invasion ability of colon cancer cell lines, and knocking down PTPN14 inhibits the proliferation, migration and invasion ability of colon cancer cell lines. Overexpression of PTPN14 promotes subcutaneous tumor formation of colon cancer cell lines in nude mice, and knocking down PTPN14 inhibits subcutaneous tumor formation of colon cancer cell lines in nude mice. PTPN14 or its encoding gene can be used as a marker to diagnose colon cancer, evaluate the prognosis of colon cancer, and monitor the progression of colon cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0024] Figure 1 Scoring results for typical colon cancer patients;

[0025] Figure 2 The statistical results of cancer tissue and adjacent tissue under different staining intensities;

[0026] Figure 3 The statistical results of immunohistochemical scoring for different tumor TNM stages;

[0027] Figure 4 These are the survival curves of colon cancer patients in the PTPN14 high expression group and the PTPN14 low expression group;

[0028] Figure 5 ROC curve for immunohistochemical score and survival status of patients with colon cancer;

[0029] Figure 6 ROC curve for immunohistochemical score and tumor TNM stage of patients with colon cancer;

[0030] Figure 7 The PTPN14 mRNA levels of cells in different treatment groups in Example 3;

[0031] Figure 8 The results of immunoblotting experiments on cells in different treatment groups in Example 3;

[0032] Fig. 9 The results of MTT experiment in Example 3 to detect the cell proliferation ability of different treatment groups;

[0033] Fig.10 The results of the colony formation experiment in Example 3 to detect the cell proliferation ability of different treatment groups;

[0034] Fig.11 This is a physical picture of the cell scratch experiment in different treatment groups in Example 3;

[0035] Fig.12 The scratch experiment in Example 3 detected the blank area of ​​cells in different treatment groups (A) and the scratch repair ratio (B);

[0036] Fig.13 The staining images (A) and the statistical results of the number of invasive cells (B) of cells in different treatment groups detected by Transwell assay in Example 3;

[0037] Fig.14 The actual image (A), weight (B) and volume (C) of tumors in different treatment groups in Example 3;

[0038] Fig.15 Example 4 PTPN14 mRNA levels in cells of different treatment groups;

[0039] Fig.16 The results of immunoblotting experiments on cells in different treatment groups in Example 4;

[0040] Fig.17 The results of MTT experiment in Example 4 to detect the cell proliferation ability of different treatment groups;

[0041] Fig.18 The results of the colony formation experiment in Example 4 to detect the cell proliferation ability of different treatment groups;

[0042] Fig.19 This is a physical picture of the cell scratch experiment in different treatment groups in Example 4;

[0043] Fig. 20 The scratch experiment in Example 4 detected the blank area of ​​cells (A) and the scratch repair ratio (B) in different treatment groups;

[0044] Fig.21 The staining images (A) and the statistical results of the number of invasive cells (B) of cells in different treatment groups detected by Transwell assay in Example 4;

[0045] Fig. 22 The actual image (A), weight (B) and volume (C) of tumors in different treatment groups in Example 4;

[0046] Figures 7 to 22 In, ns: no significant difference, *P<0.05, **P<0.01, ***P<0.001. DETAILED DESCRIPTION

[0047] The present invention provides the use of a substance for detecting protein tyrosine phosphatase non-receptor type 14 or its coding gene in the preparation of colon cancer diagnosis and / or prognosis products. The accession number of the protein tyrosine phosphatase non-receptor type 14 in the present invention is NM_005401.5 in GenBank.

[0048] As an embodiment, the diagnosis of the present invention includes colon cancer staging diagnosis. As an embodiment, the prognosis of the present invention includes one or more of the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject; as another embodiment, the prognosis of the present invention includes the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject. As an embodiment, the protein tyrosine phosphatase non-receptor type 14 of the present invention is significantly upregulated in colon cancer patients.

[0049] The present invention also provides the use of a substance for detecting protein tyrosine phosphatase non-receptor type 14 or its encoding gene in the preparation of a colon cancer progression monitoring product. As an embodiment, the protein tyrosine phosphatase non-receptor type 14 expression level of the present invention increases with the progression of colon cancer stages.

[0050] As an embodiment, the colon cancer cells of the present invention include HCT116 cell line and / or DLD-1 cell line.

[0051] As one embodiment, the product of the present invention includes a diagnostic agent, a test kit, a chip, a test paper or a well plate; as another embodiment, the product of the present invention is a diagnostic agent or a test kit.

[0052] As an embodiment, the substance for detecting protein tyrosine phosphatase non-receptor type 14 of the present invention includes detecting anti-protein tyrosine phosphatase non-receptor type 14 antibody. The present invention has no strict requirements on the source of the anti-protein tyrosine phosphatase non-receptor type 14 antibody, and it can be purchased conventionally. For example, the anti-protein tyrosine phosphatase non-receptor type 14 antibody (anti-PTPN14 antibody) used in the embodiment of the present invention was purchased from Wuhan Sanying Biotechnology Co., Ltd.

[0053] As an embodiment, the substance for detecting the gene encoding protein tyrosine phosphatase non-receptor type 14 of the present invention includes primers. As an embodiment, the primers of the present invention include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:5, specifically: 5'-AGGTCGACTCTAGAGGATCCCGCCACCATGCCTTTTGGTCTGAAGCTCC GCCGG-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:6, specifically: 5'-TCCTTGTAGTCCATGGATCCAATGAGTCTGGAGTTTTGGAGGAACTG-3'.

[0054] The present invention also provides a kit for diagnosing colon cancer, evaluating the prognosis of colon cancer patients or monitoring the progression of colon cancer, wherein the kit comprises a reagent for detecting protein tyrosine phosphatase non-receptor type 14 or a gene encoding the protein tyrosine phosphatase.

[0055] As an embodiment, the reagent of the present invention includes a reagent for PCR amplification or a reagent for immunoblotting detection. As an embodiment, the reagent for immunoblotting detection of the present invention includes an anti-protein tyrosine phosphatase non-receptor type 14 antibody. As an embodiment, the reagent for PCR amplification of the present invention includes a primer. As an embodiment, the primer of the present invention includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:5, specifically: 5'-AGGTCGACTCTAGAGGATCCCGCCACCATGCCTTTTGGTCTGAAGCTCC GCCGG-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:6, specifically: 5'-TCCTTGTAGTCCATGGATCCAATGAGTCTGGAGTTTTGGAGGAACTG-3'.

[0056] The present invention also provides the use of an agent for knocking down protein tyrosine phosphatase non-receptor type 14 or its encoding gene in one or more of preventing and treating colon cancer, improving colon cancer progression and improving the prognosis of colon cancer patients.

[0057] As one embodiment, the prevention and treatment of colon cancer, improvement of colon cancer progression and improvement of prognosis of colon cancer patients described in the present invention include inhibiting the proliferation of colon cancer cell lines, inhibiting the migration of colon cancer cell lines, inhibiting the invasion of colon cancer cell lines and inhibiting the tumor formation of colon cancer; as another embodiment, the prevention and treatment of colon cancer, improvement of colon cancer progression and improvement of prognosis of colon cancer patients include inhibiting the proliferation of colon cancer cell lines, inhibiting the migration of colon cancer cell lines, inhibiting the invasion of colon cancer cell lines and inhibiting the tumor formation of colon cancer. As one embodiment, the reagent for knocking down protein tyrosine phosphatase non-receptor type 14 or its encoding gene described in the present invention includes shRNA, and the shRNA includes one or more of sh-PTPN14-1, sh-PTPN14-2 and sh-PTPN14-3; the target sequence of the sh-PTPN14-1 is shown in SEQ ID NO:1; the target sequence of the sh-PTPN14-2 is shown in SEQ ID NO:2; the target sequence of the sh-PTPN14-3 is shown in SEQ ID NO:3; as another embodiment, the reagent for knocking down protein tyrosine phosphatase non-receptor type 14 or its encoding gene described in the present invention is sh-PTPN14-3, and the target sequence of the sh-PTPN14-3 is shown in SEQ ID NO:3.

[0058] The present invention conducted in vitro experiments and found that overexpression of PTPN14 promoted the proliferation, migration and invasion of colon cancer cell lines, while knocking down PTPN14 inhibited the proliferation, migration and invasion of colon cancer cell lines. In vivo experiments found that overexpression of PTPN14 promoted subcutaneous tumor formation of colon cancer cell lines in nude mice, while knocking down PTPN14 inhibited subcutaneous tumor formation of colon cancer cell lines in nude mice.

[0059] The present invention also provides an shRNA for preventing and treating colon cancer, improving colon cancer progression or improving the prognosis of colon cancer patients, wherein the shRNA includes one or more of sh-PTPN14-1, sh-PTPN14-2 and sh-PTPN14-3; the target sequence of the sh-PTPN14-1 is shown in SEQ ID NO: 1; the target sequence of the sh-PTPN14-2 is shown in SEQ ID NO: 2; the target sequence of the sh-PTPN14-3 is shown in SEQ ID NO: 3. As an embodiment, the shRNA of the present invention is sh-PTPN14-3. Compared with sh-PTPN14-1 and sh-PTPN14-2, the PTPN14 mRNA level and expression level after sh-PTPN14-3 elimination are the lowest.

[0060] To further illustrate the present invention, the application of PTPN14 or its encoding gene provided by the present invention in the diagnosis and / or prognosis of colon cancer is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0061] Example 1

[0062] 1. The inventors retrospectively selected surgical specimens of primary lesions of 50 patients with pathologically confirmed colon adenocarcinoma. The paraffin sections of the specimens of the 50 patients were stained with anti-PTPN14 antibody for immunohistochemistry (IHC). The negative, weakly positive, moderately positive, strongly positive and extremely positive staining intensities were scored as 0, 1, 2, 3 and 4 points, respectively. The percentage of the staining area (0%, 1%-25%, 26%-50%, 51%-75% and >75%) was scored as 0, 1, 2, 3 and 4 points, respectively. The staining intensity score and the staining area score were multiplied to calculate the immunohistochemistry score (IHC Score). Typical patients and their scores are shown in Figure 1 .

[0063] 2. The cancer tissues and adjacent tissues of 50 patients were paired for staining. Among the 50 adjacent tissues, 37 were negative and 13 were positive (including 6 weakly positive, 4 moderately positive and 3 strongly positive); among the 50 paired cancer tissues, only 5 were negative, and the remaining 45 were positive (including 6 weakly positive, 12 moderately positive, 16 strongly positive and 11 extremely positive), indicating that the expression level of PTPN14 in cancer tissues was higher than that in paired adjacent tissues ( Figure 2 ).

[0064] 3. Patients were grouped according to their tumor TNM staging. It was found that with the progression of the staging, the mean value of IHC Score gradually increased, and the difference was statistically significant (P<0.001), indicating that the expression level of PTPN14 was related to the progression of tumor TNM staging ( Figure 3 ). The median IHC score of the 50 patients was 9. Patients with scores of 9 or below were included in the PTPN14 low expression group (31 patients), and patients with scores above 9 were included in the PTPN14 high expression group (19 patients). Combined with the overall survival (OS) and survival status (death or survival) of the patients obtained during follow-up, the Kaplan-Meier method was used to draw the survival curve. It was found that the prognosis of the PTPN14 high expression group was significantly worse than that of the low expression group, and the difference was statistically significant (P<0.001)( Figure 4 ).

[0065] In conclusion, PTPN14 expression level is associated with tumor TNM stage progression and prognosis in patients with colon cancer, and has practical prognostic marker value.

[0066] Example 2

[0067] To further clarify the value of PTPN14 in predicting colon cancer stage progression and survival, the inventors evaluated it by drawing a receiver operating characteristic curve (ROC).

[0068] 1. The ROC curve was drawn based on the IHC scores and survival status of the 50 patients in Example 1. The area under the curve was 0.806 (95% confidence interval, 0.681-0.930) ( Figure 5 , where the red line represents the diagonal reference line and the blue line represents the ROC curve). The sensitivity and specificity corresponding to each coordinate point of the ROC curve were obtained using the statistical software SPSS25.0. The Youden index (sensitivity + specificity - 1) was calculated, and the coordinate points corresponding to its optimal cutoff value were selected to calculate the corresponding sensitivity and specificity. It was found that the sensitivity of PTPN14 in predicting the survival of colon cancer patients was 78.6% and the specificity was 77.8%.

[0069] 2. Patients with TNM stage I-II had early-stage colon cancer, and patients with TNM stage III-IV had advanced colon cancer. The ROC curve was drawn based on IHC score and TNM stage, and the area under the curve was 0.877 (95% confidence interval, 0.773-0.980) ( Figure 6 , where the red line represents the diagonal reference line and the blue line represents the ROC curve). The sensitivity and specificity were obtained in the same way as in step 1. It was found that the sensitivity of PTPN14 in predicting the stage progression of colon cancer patients was 88.5% and the specificity was 75.0%.

[0070] Example 3

[0071] 1. Construction of plasmids overexpressing PTPN14

[0072] Using GV230 as the basic vector (element sequence: CMV-MCS-EGFP-SV40-Neomycin, fluorescent marker: EGFP), the PTPN14 gene (GenBank_ID is NM_005401.5) was inserted into the cloning site (BamHI / BamHI) of the basic vector, and the recombinant vector with correct sequencing was selected, which is the plasmid for overexpressing PTPN14.

[0073] 2. Lentiviral Transfection and Screening

[0074] The Lenti-PacTM lentiviral packaging kit (purchased from GeneCopoeia, order number LT001) was used to stably transfect cells with the lentiviral packaging cassette.

[0075] Vector group: Referring to the instructions of the kit, HIV mixed packaging plasmid and blank vector (GV230) were co-transfected into HEK293T cells.

[0076] Lv-PTPN14 group: Referring to the instructions of the kit, the HIV mixed packaging plasmid and the PTPN14 overexpression plasmid obtained in step 1 were co-transfected into HEK293T cells.

[0077] After culturing HEK293T cells for 48 hours in the Vector group and Lv-PTPN14 group, the cell culture fluid was harvested and centrifuged at 2000 rpm for 10 minutes to remove cell debris to obtain lentiviral infection fluid. Subsequently, the collected lentiviral infection fluid was used to infect the HCT116 cell line for 72 hours, and then screened with 3 μg / ml puromycin, and monoclonal cells were collected two weeks later.

[0078] 3. The untransfected HCT116 cell line was used as the control group (Control group), and the PTPN14 mRNA levels of monoclonal cells (HCT116) in the Control group, Vector group, and Lv-PTPN14 group were detected by qPCR. The results showed that compared with the Control group, the PTPN14 mRNA level in the Vector group did not change significantly (P=0.123); while the PTPN14 mRNA level in the Lv-PTPN14 group was significantly different from that in the Vector group (P=0.006), which was statistically significant ( Figure 7 ). The expression levels of PTPN14 in the Control group, Vector group and Lv-PTPN14 group were detected by immunoblotting. The results showed that compared with the Control group, the expression level of PTPN14 in the Vector group did not change significantly (P=0.336), while the expression level of PTPN14 in the Lv-PTPN14 group was significantly different from that in the Vector group (P=0.004), which was statistically significant ( Figure 8 ). The above results showed that the PTPN14 overexpression cell line and the corresponding blank transfected cell line were successfully constructed, and the subsequent phenotypic experiments will be compared between the Vector group and the Lv-PTPN14 group.

[0079] 4. The proliferation ability of the Vector group and Lv-PTPN14 group was detected by MTT experiment and colony formation experiment.

[0080] After the cells of the Vector group and the Lv-PTPN14 group were plated in 96-well plates, the OD values ​​of the Vector group and the Lv-PTPN14 group were detected at 450 nm at 24 hours, 48 ​​hours and 72 hours, respectively, according to the instructions of the MTT kit. The results showed that the OD values ​​of the Lv-PTPN14 group at 24 hours (P = 0.001), 48 hours (P < 0.001) and 72 hours (P = 0.009) were significantly higher than those of the Vector group, and the differences were statistically significant ( Fig. 9 The cells in the Vector group and the Lv-PTPN14 group were plated according to the requirements of the colony formation experiment. After 1 week of culture, they were fixed with paraformaldehyde and stained with crystal violet. The number of colonies formed in the two groups was counted respectively. The number of colonies formed in the Lv-PTPN14 group was significantly higher than that in the Vector group (P=0.009), and the difference was statistically significant ( Fig.10 ). The above results showed that the proliferation ability of HCT116 cell line was significantly enhanced after overexpression of PTPN14.

[0081] 5. The migration ability of Vector group and Lv-PTPN14 group was detected by scratch test.

[0082] After the cells in the Vector group and Lv-PTPN14 group were evenly plated and grown, scratches were made using a pipette tip, and the scratches were photographed under a 10x microscope to record the conditions at 0 h, 24 h, and 48 h ( Fig.11 ), and the blank area was calculated using Image J software ( Fig.12 A), compared with the 0-hour result to calculate the scratch repair ratio ( Fig.12 The results showed that the scratch repair rate of the Lv-PTPN14 group was significantly increased at 24 hours (P = 0.004) and 48 hours (P = 0.002) compared with the Vector group, and the differences were statistically significant. The above results show that overexpression of PTPN14 can promote the migration ability of HCT116 cell line.

[0083] 6. The invasion ability of Vector group and Lv-PTPN14 group was detected by Transwell experiment.

[0084] The Transwell chamber was evenly paved with matrix gel in advance, and the cells of the Vector group and Lv-PTPN14 group were placed in the upper layer of the Transwell chamber, respectively. After 48 hours, the cells that invaded through the matrix gel on the lower wall of the Transwell chamber were fixed with paraformaldehyde and stained with crystal violet. The field of view was selected under a 20x microscope and photographed and recorded ( Fig.13 The number of cells invading through the matrix gel in the two groups was calculated ( Fig.13The results showed that the number of invasive cells in the Lv-PTPN14 group was greater than that in the Vector group (P=0.006), and the difference was statistically significant. The above results show that overexpression of PTPN14 can promote the invasion ability of HCT116 cell line.

[0085] From steps 4 to 6, it can be seen that overexpression of PTPN14 can promote the proliferation, migration and invasion ability of the HCT116 cell line.

[0086] 7. Overexpression of PTPN14 promotes tumorigenesis in colon cancer cell lines

[0087] The cells of the Vector group and the Lv-PTPN14 group in the logarithmic growth phase were inoculated subcutaneously into 4-week-old BALB / c nude mice to construct a cell line-derived xenograft (CDX) model. The changes in the tumor volume of the mice were measured and recorded every week. Fig.14 C), 21 days after inoculation, the mice were killed by cervical dislocation, and the subcutaneous tumor specimens of the mice were obtained and placed next to a ruler to take pictures (14 A), and their weight was measured and recorded ( Fig.14 Middle B). At 21 days, the tumor weight of the Lv-PTPN14 group was significantly higher than that of the Vector group (P<0.001), and the difference was statistically significant. The tumor volume of the Lv-PTPN14 group was significantly larger than that of the Vector group at 1 week (P=0.021), 2 weeks (P=0.002), and 3 weeks (P=0.002) after inoculation, and the differences were statistically significant, indicating that overexpression of PTPN14 promotes tumorigenesis of the HCT116 cell line.

[0088] Example 4

[0089] 1. Construction of plasmid for knocking down PTPN14

[0090] Using GV811 (purchased from Shanghai Gene Medical Technology Co., Ltd.) as the basic vector (element sequence: hU6-MCS-Ubiquitin-firefly_Luciferase-sv40-puromycin, fluorescent label: EGF P), shRNA was designed according to the PTPN14 gene (GenBank_ID is NM_005401.5), and the shRNA was inserted into the cloning site (Age I and EcoR I) of the basic vector, and the recombinant vector with correct sequencing was selected, which was the plasmid for knocking down PTPN14; among which, the target information of the shRNA for knocking down PTPN14 is shown in Table 1.

[0091] Table 1 Target information for knocking down PTPN14

[0092]

[0093] 2. Construction of blank control plasmid

[0094] Using GV811 as the basic vector (element sequence: hU6-MCS-Ubiquitin-firefly_Luciferase-sv40-puromycin, fluorescent marker: EGFP), design a control shRNA (target sequence: 5'-TTCTCC GAACGTGTCACGT-3', SEQ ID NO: 4), insert the control shRNA into the cloning site (Age I / EcoR I) of the basic vector, and select the recombinant vector with correct sequencing, which is the blank control plasmid.

[0095] 3. Lentiviral Transfection and Screening

[0096] The Lenti-PacTM lentiviral packaging kit (purchased from GeneCopoeia, order number LT001) was used to stably transfect cells with the lentiviral packaging cassette.

[0097] Vector group: Referring to the instructions of the kit, HIV mixed packaging plasmid and the blank control plasmid in step 2 were co-transfected into HEK293T cells.

[0098] Sh-PTPN14-1 group: Referring to the instructions of the kit, HIV mixed packaging plasmid and knockdown PTPN14 plasmid-1 obtained in step 2 were co-transfected into HEK293T cells.

[0099] Sh-PTPN14-2 group: Referring to the instructions of the kit, HIV mixed packaging plasmid and knockdown PTPN14 plasmid-2 obtained in step 2 were co-transfected into HEK293T cells.

[0100] Sh-PTPN14-3 group: Referring to the instructions of the kit, HIV mixed packaging plasmid and knockdown PTPN14 plasmid-3 obtained in step 2 were co-transfected into HEK293T cells.

[0101] After culturing HEK293T cells in each treatment group for 48 hours, the cell culture fluid was harvested and centrifuged at 2000 rpm for 10 minutes to remove cell debris to obtain lentiviral infection fluid. Subsequently, the collected lentiviral infection fluid was used to infect the DLD-1 cell line for 72 hours, and then screened with 4 μg / ml puromycin, and monoclonal cells were collected two weeks later.

[0102] 4. The untransfected DLD-1 cell line was used as the control group (Control group), and the PTPN14 mRNA levels of monoclonal cells (DLD-1) in each treatment group were detected by qPCR. The results showed that compared with the Control group, the PTPN14 mRNA level of the Vector group did not change significantly (P = 0.070), while the PTPN14 mRNA levels of the sh-PTPN14-1 group, sh-PTPN14-2 group, and sh-PTPN14-3 group were significantly different from those of the Vector group (all P < 0.001), which was statistically significant ( Fig.15 ). The expression levels of PTPN14 in each treatment group were detected by immunoblotting experiments. It was found that compared with the Control group, the expression level of PTPN14 in the Vector group did not change significantly (P=0.190), while the expression levels of PTPN14 in the sh-PTPN14-1 group, sh-PTPN14-2 group, and sh-PTPN14-3 group were significantly different from those in the Vector group (all P<0.001), which was statistically significant ( Fig.16 ). The above results prove that the PTPN14 knockdown cell line and the corresponding blank transfected cell line were successfully constructed, among which the mRNA level and expression level of the sh-PTPN14-3 group were relatively the lowest. Subsequent phenotypic experiments will be compared between the Vector group and the sh-PTPN14-3 group.

[0103] 5. The proliferation ability of Vector group and sh-PTPN14-3 group was detected by MTT experiment and colony formation experiment.

[0104] After the cells of the Vector group and the sh-PTPN14-3 group were plated in a 96-well plate, the MTT assay was performed according to the instructions of the kit. The OD values ​​of the Vector group and the sh-PTPN14-3 group were detected at a wavelength of 450 nm at 24 hours, 48 ​​hours, and 72 hours, respectively. It was found that the OD values ​​of the Vector group at 24 hours (P=0.001), 48 hours (P<0.001), and 72 hours (P<0.001) were significantly higher than those of the sh-PTPN14-3 group, and the differences were statistically significant ( Fig.17 The cells in the Vector group and the sh-PTPN14-3 group were plated according to the requirements of the colony formation experiment. After 1 week of culture, they were fixed with paraformaldehyde and stained with crystal violet. The number of colonies formed in the two groups was counted respectively. The number of colonies formed in the sh-PTPN14-3 group was significantly less than that in the Vector group (P=0.001), and the difference was statistically significant ( Fig.18 ). The above results showed that knocking down PTPN14 significantly inhibited the proliferation ability of DLD-1 cell line.

[0105] 6. The migration ability of Vector group and Lv-PTPN14 group was detected by scratch test.

[0106] After the cells in the Vector group and sh-PTPN14-3 group were evenly plated and grown, scratches were made using a pipette tip, and photos were taken under a 10x microscope to record the growth conditions at 0 h, 24 h, and 48 h ( Fig.19 ), and the blank area was calculated using Image J software ( Fig. 20 A), compared with the 0-hour result to calculate the scratch repair ratio ( Fig. 20 The results showed that the scratch repair rate of the sh-PTPN14-3 group was significantly slower than that of the Vector group at 24 hours (P=0.009) and 48 hours (P=0.001), and the differences were statistically significant. The above results show that knocking down PTPN14 significantly inhibits the migration ability of the DLD-1 cell line.

[0107] 7. The invasion ability of Vector group and Lv-PTPN14 group was detected by Transwell experiment.

[0108] The Transwell chamber was evenly coated with matrix gel in advance, and the cells of the Vector group and the sh-PTPN14-3 group were placed in the upper layer of the Transwell chamber, respectively. After 48 hours, the cells that invaded through the matrix gel on the lower wall of the Transwell chamber were fixed with paraformaldehyde and stained with crystal violet ( Fig.21 A), select the field of view under a 20x microscope to take pictures and record, and count the number of cells that invade through the matrix gel in the two groups ( Fig.21 The results showed that the number of invasive cells in the sh-PTPN14-3 group was less than that in the Vector group (P=0.001), and the difference was statistically significant. The above results showed that knocking down PTPN14 significantly inhibited the invasion ability of the DLD-1 cell line.

[0109] From steps 5 to 7, it can be seen that overexpression of PTPN14 can promote the proliferation, migration and invasion ability of the DLD-1 cell line.

[0110] 8. Knockdown of PTPN14 inhibits tumorigenesis in colon cancer cell lines

[0111] The cells of the Vector group and the sh-PTPN14-3 group in the logarithmic growth phase were inoculated subcutaneously into 4-week-old BALB / c nude mice to construct a cell line-derived xenograft (CDX) model. The changes in the tumor volume of the mice were measured and recorded every week. Fig. 22C), 21 days after inoculation, the mice were killed by cervical dislocation, and the subcutaneous tumor specimens were obtained and placed next to a ruler for photography ( Fig. 22 A), measure and record its weight ( Fig. 22 Middle B). At 21 days, the tumor weight of the Vector group was significantly higher than that of the sh-PTPN14-3 group (P<0.001), and the difference was statistically significant. The tumor volume of the Vector group was significantly larger than that of the sh-PTPN14-3 group at 1 week (P=0.008), 2 weeks (P<0.001), and 3 weeks (P<0.001) after inoculation, and the differences were statistically significant, indicating that knockdown of PTPN14 inhibited tumorigenesis in the DLD-1 cell line.

[0112] According to the above content, it can be seen that the expression level of PTPN14 is related to the stage progression and prognosis of patients with colon cancer. Overexpression of PTPN14 promotes the proliferation, migration and invasion of colon cancer cell lines, and knocking down PTPN14 inhibits the proliferation, migration and invasion of colon cancer cell lines. Overexpression of PTPN14 promotes subcutaneous tumor formation of colon cancer cell lines in nude mice, and knocking down PTPN14 inhibits subcutaneous tumor formation of colon cancer cell lines in nude mice. PTPN14 or its encoding gene can be used as a marker to diagnose colon cancer, evaluate the prognosis of colon cancer, and monitor the progression of colon cancer.

[0113] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of a substance for detecting protein tyrosine phosphatase non-receptor type 14 or its encoding gene in the preparation of a product for diagnosis and / or prognosis of colon cancer.

2. The use according to claim 1, characterized in that: The diagnosis includes colon cancer staging diagnosis; The prognosis includes one or more of prognosticating the clinical outcome of the subject, prognosticating the treatment effect of the subject, and prognosticating the survival of the subject.

3. The use according to claim 1, characterized in that: The protein tyrosine phosphatase non-receptor type 14 is significantly upregulated in colon cancer patients.

4. Use of substances for detecting protein tyrosine phosphatase non-receptor type 14 or its encoding gene in the preparation of products for monitoring the progression of colon cancer.

5. The use according to claim 4, characterized in that: The expression level of protein tyrosine phosphatase non-receptor type 14 increases with the progression of colon cancer stages.

6. The use according to any one of claims 1 to 5, characterized in that: The product includes a diagnostic agent, a test kit, a chip, a test strip or a well plate; The substance for detecting protein tyrosine phosphatase non-receptor type 14 includes an antibody for detecting anti-protein tyrosine phosphatase non-receptor type 14; The material for detecting the protein tyrosine phosphatase non-receptor type 14 encoding gene includes primers.

7. A kit for diagnosing colon cancer, evaluating the prognosis of colon cancer patients or monitoring the progression of colon cancer, characterized in that: The kit comprises a reagent for detecting protein tyrosine phosphatase non-receptor type 14 or a gene encoding the ...

8. Use of an agent for knocking down protein tyrosine phosphatase non-receptor type 14 or its encoding gene for one or more of preventing and treating colon cancer, improving colon cancer progression, and improving the prognosis of colon cancer patients.

9. The use according to claim 8, characterized in that: The prevention and treatment of colon cancer, improvement of colon cancer progression and improvement of the prognosis of colon cancer patients include one or more of inhibiting the proliferation of colon cancer cell lines, inhibiting the migration of colon cancer cell lines, inhibiting the invasion of colon cancer cell lines and inhibiting the tumor formation of colon cancer.

10. A shRNA for preventing and treating colon cancer, improving the progression of colon cancer or improving the prognosis of colon cancer patients, characterized in that: The shRNA includes one or more of sh-PTPN14-1, sh-PTPN14-2 and sh-PTPN14-3; The target sequence of the sh-PTPN14-1 is shown in SEQ ID NO: 1; The target sequence of the sh-PTPN14-2 is shown in SEQ ID NO: 2; The target sequence of sh-PTPN14-3 is shown in SEQ ID NO:3.

Images