Circular RNA drugs for treating heart failure and their applications

By developing specific sequences of circular RNA combined with mPTP components, mPTP openness is regulated, and the problem that existing heart failure treatment drugs cannot repair cardiomyocytes is solved, effectively protecting cardiomyocyte functions, significantly reducing ROS levels, and delaying the progress of heart failure.

CN119770510BActive Publication Date: 2025-07-25INST OF HEALTH & MEDICINE HEFEI COMPREHENSIVE NAT SCI CENT +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411912951.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-07-25
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

Existing heart failure treatment drugs cannot repair damaged cardiomyocytes at the molecular level, and they are drug resistance and cannot effectively restore the heart's blood pumping function. The existing mitochondrial targeted antioxidants have limited effect.

Method used

A specific sequence of circular RNA was developed, which can bind to the mPTP components ATP5B and TRAP1 proteins, regulate the opening of mPTP, reduce the ROS level in cardiomyocytes, and protect the function of cardiomyocytes.

Benefits of technology

It significantly improves the targeting and specificity of heart failure treatment, reduces the ROS level in cardiomyocytes, protects cardiomyocyte function, delays the progress of heart failure, is highly safe and suitable for a variety of mitochondrial injury-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119770510B_ABST
    Figure CN119770510B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biomedical technology, and specifically relates to circular RNA drugs for treating heart failure and their applications. The present invention provides a class of circular RNAs, including mecciND2 and mecciNd2 with nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 respectively. The mecciND2 or mecciNd2 can inhibit the excessive opening of the mitochondrial membrane permeability transition pore, significantly reduce the ROS level in cardiomyocytes, maintain mitochondrial activity, and thereby protect cardiomyocytes. Intravenous injection of mecciNd2 in a mouse heart failure model can effectively protect heart function and delay the progression of heart failure. The present invention uses circular RNA as a drug for treating heart failure, which has good safety and specificity. The present invention provides a novel mitochondrial-targeted biotherapeutic approach for the treatment of heart failure, bringing new breakthroughs to the treatment of heart failure.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a circular RNA drug for treating heart failure and its application. More specifically, it relates to the application of a class of circular RNAs with specific sequence properties and regulating the release of mitochondrial reactive oxygen species (ROS) as drugs for treating heart failure. Background Art

[0002] Heart failure (HF) is the leading cause of death in cardiovascular diseases. The fundamental problem of heart failure is the decline in cardiac pumping function. The reasons for the decline in cardiac pumping function are manifold, which can be summarized as myocardial contraction and / or relaxation dysfunction, long-term excessive cardiac load, and ventricular filling limitation. Currently, HF remains incurable, and severe HF can only be treated by surgical intervention or even heart transplantation. The drugs for treating HF mainly aim to improve the symptoms of HF by dilating blood vessels, reducing blood pressure, reducing the preload and afterload of the heart, reducing the energy demand of the heart, and avoiding further adverse myocardial remodeling. These drugs do not repair damaged myocardial cells at the molecular level, restore myocardial function fundamentally, and will produce drug resistance. Although the survival rate has been improved, HF patients still have a high mortality rate and a low quality of life.

[0003] Mitochondria are crucial for highly energy-consuming organs, especially the heart. The ATP consumed by the human heart in a day is 15 to 20 times its own weight. Therefore, mitochondria in the heart need to synthesize about 6 kg of ATP per day to maintain cardiac function. Cardiomyocytes are the cells with the most mitochondria. The mitochondria in mature cardiomyocytes are relatively large, accounting for about 40% of the volume of mammalian adult cardiomyocytes. Mitochondrial dysfunction in cardiomyocytes is a key factor leading to HF. The cardiac ATP production in HF hearts will be reduced by about 30% compared with normal myocardium.

[0004] Targeting damaged mitochondria and restoring the self-function of cardiomyocytes are important targets for HF treatment, but there is currently no treatment method for mitochondrial dysfunction. A key reason for mitochondrial dysfunction in cardiomyocytes is the abnormal increase in ROS production. Specifically clearing excessive ROS in mitochondria is also one of the strategies for developing HF drugs. Currently, no antioxidant drugs for HF patients have been developed. Some studies have shown that broad-spectrum antioxidants such as vitamin C, vitamin E, and N-acetylcysteine (NAC) are helpful for treating heart diseases. Some mitochondria-targeted antioxidants such as mitoTEMPO and mitoQ have shown good HF treatment effects in animal experiments.

[0005] The mitochondrial permeability transition pore (mPTP) is the main channel for the release of mitochondrial ROS. It is located between the inner and outer mitochondrial membranes and is a non-selective channel composed of protein complexes that allows molecules smaller than 1.5 kDa to enter and exit. Under normal conditions, mPTP is in a closed state to maintain the mitochondrial membrane potential and normal functions. In the heart with heart failure, mPTP opens excessively, resulting in the loss of mitochondrial membrane potential in cardiomyocytes and oxidative damage to cardiomyocytes. Cyclophilin D (CypD) is a positive regulatory protein of mPTP, which binds to the protein ATP5B that composes mPTP and promotes the opening of mPTP. Mitochondrial heat shock protein TRAP1 is a negative regulatory protein of mPTP, which competes with mPTP to bind to CypD, thereby inhibiting the opening of mPTP. Currently, mPTP is also an important target for the development of heart failure drugs.

[0006] Circular RNAs (circRNAs) are a large class of special RNA molecules whose 5' and 3' ends are covalently linked to form a closed circular structure. Recent studies have shown that circRNAs have important regulatory functions and are closely related to various cardiovascular diseases. Currently, it is known that circular RNAs in animal cells can be derived from nuclear genomes and mitochondrial genomes, and circular RNAs encoded by mitochondrial genomes are called mecciRNAs (mitochondria-encoded circRNAs). Many studies have shown that circular RNAs, including mecciRNAs, play important regulatory roles in the normal activities of mitochondria, including promoting mitochondrial protein transport and regulating mitochondrial ROS levels, and these functions are closely related to the occurrence and development of heart failure. Currently, no circular RNA drugs have been applied to the clinical treatment of heart failure. Summary of the Invention

[0007] To solve the above problems, the present invention provides the use of a class of circular RNAs with specific sequence properties and capable of regulating the release of mitochondrial ROS as drugs for treating heart failure. One of the sequence characteristics of this class of circular RNAs is that they can bind to mPTP components and their regulatory proteins and regulate the opening of mPTP, thereby maintaining the mitochondrial function of cardiomyocytes, reducing the intracellular ROS level, protecting cardiomyocytes, and delaying the progression of heart failure.

[0008] On the one hand, the use of circular RNAs in drugs for preventing, adjuvant treating, and / or treating heart failure.

[0009] Specifically, the circular RNA binds to the mPTP component ATP5B and the TRAP1 protein. More specifically, the circular RNA has a single-stranded region and contains the sequences CUAC, UACC, or ACUA.

[0010] More specifically, the circular RNA is encoded by the mitochondrial genome.

[0011] Preferably, the sequence of the circular RNA is SEQ ID No.1 and / or SEQ ID No.2.

[0012] Specifically, the drug further comprises a pharmaceutically acceptable excipient.

[0013] More specifically, the pharmaceutically acceptable excipient is selected from one or a combination of two or more of a wetting agent, an emulsifier, a preservative, an antioxidant, a buffer, an excipient, a diluent, a lubricant, an antibacterial agent, a suspending agent, a suspending aid, a solubilizer, a thickening agent, a stabilizer, a sweetening agent, and a flavoring agent.

[0014] Preferably, the pharmaceutically acceptable excipient is selected from at least one of lactose, mannose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, magnesium stearate, and mineral oil.

[0015] Specifically, the drug may further comprise a viral vector.

[0016] More specifically, the viral vector may be one or more of an adenovirus vector, a lentivirus vector, and a retrovirus vector.

[0017] Specifically, the drug may further comprise an embedding carrier.

[0018] More specifically, the embedding carrier includes but is not limited to cholesterol, nanoparticles, or liposomes.

[0019] Preferably, the embedding carrier may be a liposome.

[0020] Specifically, the dosage form of the drug is a tablet, a liquid preparation, a capsule, a powder, or a granule.

[0021] Specifically, the administration route of the drug is selected from oral administration, intravenous injection, intradermal injection, or subcutaneous injection.

[0022] In another aspect, the present invention provides a drug for preventing, adjuvantly treating, and / or treating heart failure, and the drug comprises a circular RNA with a sequence of SEQ ID No.1 and / or SEQ ID No.2.

[0023] Specifically, the heart failure includes but is not limited to acute heart failure or chronic heart failure.

[0024] Specifically, the drug further comprises a pharmaceutically acceptable excipient.

[0025] More specifically, the pharmaceutically acceptable excipients are selected from one or a combination of two or more of wetting agents, emulsifying agents, preservatives, antioxidants, buffering agents, excipients, diluents, lubricants, bacteriostatic agents, suspending agents, suspending aids, solubilizing agents, thickening agents, stabilizers, sweeteners, and fragrances.

[0026] Preferably, the pharmaceutically acceptable excipients are selected from at least one of lactose, mannose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl paraben, propyl paraben, magnesium stearate, and mineral oil.

[0027] Specifically, the drug may further include a viral vector.

[0028] More specifically, the viral vector may be one or more of an adenovirus vector, a lentivirus vector, and a retrovirus vector.

[0029] Specifically, the drug may further include an embedding carrier.

[0030] More specifically, the embedding carrier includes, but is not limited to: cholesterol, nanoparticles, or liposomes.

[0031] Preferably, the embedding carrier may be a liposome.

[0032] Specifically, the dosage form of the drug is tablets, liquids, capsules, powders, or granules.

[0033] Specifically, the administration method of the drug is selected from oral administration, intravenous injection, intradermal injection, or subcutaneous injection.

[0034] The technical effects achieved by the present invention:

[0035] (1) Higher targeting and specificity: The circular RNA of the present invention binds to ATP5B and TRAP1 proteins and regulates the levels of proteins such as TRAP1 in mitochondria, inhibits the excessive opening of mPTP, regulates the release of mitochondrial ROS in cardiomyocytes, and significantly reduces the ROS level in cardiomyocytes. The circular RNA of the present invention has better targeting and specificity compared to broad-spectrum antioxidant therapy.

[0036] (2) Safety of circular RNA: Circular RNA is not likely to trigger an immune response, so it has higher safety in application.

[0037] (3) Multiple applicability: The circular RNA of the present invention is not only applicable to the treatment of heart failure, but also has the functions of protecting mitochondria and alleviating oxidative stress, and has the potential to be extended to other mitochondrial damage-related diseases.

[0038] (4) Clinical and economic value: The existing treatment methods mainly aim to relieve the symptoms of heart failure. The circular RNA of this invention targets damaged mitochondria, inhibits the release of excessive mitochondrial ROS, and helps restore the self-function of cardiomyocytes, providing more effective treatment options for patients, and is expected to reduce the treatment cost and improve the quality of life of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 To identify mitochondrial circular RNAs that bind to TRAP1 and ATP5B proteins; wherein, A is the result of TRAP1 RIP-seq in human 293T cells, and the Western blot result proves that the TRAP1 protein has been successfully enriched by the specific antibody; B is the statistical result of mitochondrial circular RNAs identified by TRAP1 RIP-seq; C is the result of ATP5B RIP-seq in human 293T cells, and the Western blot result proves that the ATP5B protein has been successfully enriched by the specific antibody; D is the statistical result of mitochondrial circular RNAs identified by ATP5B RIP-seq.

[0040] Figure 2 It is the sequence characteristics of mitochondrial circular RNAs predicted by HOMER software to bind to TRAP1 and ATP5B.

[0041] Figure 3 It is the schematic diagram of the secondary structures of mecciND2 and mecciNd2 predicted by mfold.

[0042] Figure 4 It is that in vitro synthesized mecciND2 and mecciNd2 bind to TRAP1 and increase the content of TRAP1 in mitochondria; wherein, A is that mecciND2 transfected into 293T cells can specifically bind to the TRAP1 protein; B is the change in the level of TRAP1 protein in mitochondria detected by the APEX experiment after transfection with mecciND2; C is the change in the levels of TRAP1 and CypD at the whole cell level and mitochondrial level detected by Western blot after transfection with mecciND2; ACTIN is the internal reference protein at the whole cell level; TOMM40 is the internal reference protein at the mitochondrial level; D is the quantitative result of the proteins in Figure C; E is that mecciNd2 transfected into HL-1 cells can specifically bind to the TRAP1 protein; F is the change in the level of TRAP1 protein in mitochondria detected by the APEX experiment after transfection with mecciNd2; G is the change in the levels of TRAP1 and CypD at the whole cell level detected by Western blot after transfection with mecciNd2; H is the quantitative result of the proteins in Figure G; ns indicates no significant difference, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0043] Figure 5 To transfect mecciND2 into human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) stimulated by hypoxia or doxorubicin, and detect the mPTP and ROS levels in cardiomyocytes; among them, A shows the Calcein AM signal indicating the degree of mPTP closure. The stronger the green fluorescence, the higher the degree of closure, and the weaker the green fluorescence, the higher the degree of opening. B shows DCFH-DA indicating the ROS level in cells. A strong red signal indicates high ROS in cells, and a weak red signal indicates low ROS content in cells. Hoechst specifically labels the cell nucleus, and the white dotted box indicates the outline of cardiomyocytes. In the figure, untreated means the cells are cultured under normoxic conditions without doxorubicin stimulation. The scale bar in the figure is 5 μm; ns indicates no significant difference, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0044] Figure 6 To transfect mecciNd2 into mouse cardiomyocytes HL-1 stimulated by hypoxia or doxorubicin, and detect the mPTP and ROS levels in cardiomyocytes; among them, A and C show the Calcein AM signal indicating the degree of mPTP closure. The stronger the green fluorescence, the higher the degree of closure, and the weaker the green fluorescence, the higher the degree of opening. B and D show DCFH-DA indicating the ROS level in cells. A strong red signal indicates high ROS in cells, and a weak red signal indicates low ROS content in cells. Hoechst specifically labels the cell nucleus. The scale bar in the figure is 5 μm; ns indicates no significant difference, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0045] Figure 7 To study the therapeutic effect of mecciNd2 in a mouse heart failure model induced by doxorubicin; among them, A is a flow chart of doxorubicin treatment and mecciNd2 injection; B shows the expression of mecciNd2 in the heart after mecciNd2 injection; C shows the ejection fraction of the hearts of mice in each group detected by cardiac color Doppler ultrasound; D is a picture of the external appearance of the hearts of representative individuals in each group of mice. The scale bar in the figure is 5 mm; E shows the staining results of H&E and Masson of mouse heart tissue sections at the end of treatment. The scale bar in the figure is 50 μm; F shows the cross-section of cardiomyocytes statistically analyzed according to the H&E staining results; G shows the myocardial fibrosis situation statistically analyzed according to the Masson staining results; ns indicates no significant difference, * indicates p < 0.05, *** indicates p < 0.001; the number of mice in each group is 6, 6, 6, and 6 respectively.

[0046] Figure 8Therapeutic effect of mecciNd2 in a mouse heart failure model induced by pressure overload; among them, A is the flow chart of the mouse experiment; TAC: transverse aortic constriction; B is the ejection fraction of the heart detected by cardiac color Doppler ultrasound in each group of mice; Sham: sham operation; C is the appearance diagram of the heart of representative individuals in each group of mice; the scale bar in the figure is 5 mm; D is the staining results of H&E and Masson of the heart tissue sections of mice at the end of treatment; the scale bar in the figure is 50 μm; E is the cross-section of cardiomyocytes statistically obtained according to the H&E staining results; F is the myocardial fibrosis condition statistically obtained according to the Masson staining results; ns indicates no significant difference, ** indicates p < 0.01, *** indicates p < 0.001; the number of mice in each group is 4, 4, 6, and 6 respectively. Detailed implementation manners

[0047] The following combines specific embodiments to further elaborate on the present invention. The following embodiments are not used to limit the present invention, but only to illustrate the present invention. The experimental methods used in the following embodiments, unless otherwise specified, and the experimental methods without specific conditions noted in the embodiments are usually in accordance with conventional conditions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0048] Terms:

[0049] 1. mPTP, mitochondrial permeability transition pore, mitochondrial membrane permeability transition pore.

[0050] 2. ATP5B is a component of mPTP; TRAP1 is a negative regulatory protein of mPTP; CypD is a positive regulatory protein of mPTP.

[0051] 3. TAC, transverse aortic constriction.

[0052] 4. Doxorubicin, DOX, adriamycin, is a chemotherapeutic drug with cardiotoxicity. Long-term use will cause chronic heart failure.

[0053] The nucleotide sequences of mecciND2 and mecciNd2 described in the present invention are shown in SEQ ID No.1 and SEQ ID No.2, respectively, and the secondary structure has more single-stranded regions and contains sequences such as "CUAC", "UACC", or "ACUA" as potential TRAP1 binding sites, and can bind to mPTP components and the regulatory protein TRAP1.

[0054] SEQ ID No.1:

[0055] CAUAACCAAUACUACCAAUCAAUACUCAUCAUUAAUAAUCAUAAUAGCUAUAGCAAUAAAACUAGGAAUAGCCCCCUUUCACUUCUGAGUCCCAGAGGUUACCCAAGGCACCCCUCUGACAUCCGGCCUGCUUCUUCUCACAUGACAAAAACUAGCCCCCAUCUCAAUCAUAUACCAAAUCUCUCCCUCACUAAACGUAAGCCUUCUCCUCACUCUCUCAAUCUUAUCCAUCAUAGCAGGCAGUUGAGGUGGAUUAAACCAAACCCAGCUACGCAAAAUCUUAGCAUACUCCUCAAUUACCCACAUAGGAUGAAUAAUAGCAGUUCUACCGUACAACCCUAA;

[0056] SEQ ID No.2:

[0057] UUCCACCACUAACAGGAUUCUUACCAAAAUGAAUUAUCAUCACAGAACUUAUAAAAAACAACUGUCUAAUUAUAGCAACACUCAUAGCAAUAAUAGCUCUACUAAACCUAUUCUUUUAUACUCGCCUAAUUUA。

[0058] Note: According to the regulations of the WIPOST.26 standard, the uracil "U" in the sequence is represented by "T" in the sequence listing.

[0059] Example 1 Identification and Characterization of Circular RNAs Binding to TRAP1

[0060] 1.1 Experimental Methods

[0061] (1) RNA-IP of TRAP1 or ATP5B

[0062] The extraction of mitochondria has been described in detail in a published article (PMID: 33588027); after crosslinking the mitochondria with 1% formaldehyde, they were lysed in ice-cold RIPA buffer, and the RIPA buffer formula was 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.1% SDS, and RNase inhibitor, 2 mM DTT, and protease inhibitor were added; in the remaining supernatant, a TRAP1 (or ATP5B) specific antibody or IgG control antibody was added, and incubated at 4°C for 4 hours to complete antigen-antibody coupling; a Protein G magnetic bead suspension (Invitrogen, 10004D) was added to the antigen-antibody mixture, and incubated at 4°C for 2 hours to allow the antigen-antibody complex to bind to the magnetic beads; the protein-antibody-magnetic bead complex was washed twice with RIPA buffer successively, and then washed twice with high-salt RIPA buffer (containing 500 mM NaCl); 1 / 5 of the magnetic bead sample was taken, SDS loading buffer was added, and boiled in a water bath at 100°C for 10 minutes for subsequent Western blot analysis. Protease K was added to the remaining protein-antibody-magnetic bead complex, and incubated at 55°C for 30 minutes to digest the protein. Subsequently, RNA was extracted using TRIzol reagent. The purified RNA can be used for real-time quantitative PCR (RT-qPCR) or high-throughput sequencing analysis.

[0063] (2)RNA-seq (Transcriptome sequencing technology)

[0064] Beijing Novogene Bioinformatics Technology Co., Ltd. was commissioned for high-throughput sequencing. The library construction type was a RIP library, and mitochondrial RNA was randomly fragmented for library construction. The sequencing platform was Novaseq 6000 PE150, and the sequencing depth was 8G clean data. The sequencing data was analyzed using the circular RNA analysis software CIRI2 or the find_circ program, and the reference genome was hg38.

[0065] (3)Circular RNA motif prediction

[0066] The circular RNA sequences bound to ATP5B or TRAP1 were used to predict motifs using the HOMER software with default parameters.

[0067] (4)Circular RNA secondary structure prediction

[0068] Enter the mfold website (http: / / www.mfold.org), select "RNA Folding Form", put the sequences of mecciND2 and mecciNd2 into the input box respectively, select the "circular" form, and perform prediction with default parameters.

[0069] 1.2 Experimental Results

[0070] like Figure 1 As shown in , TRAP1 and ATP5B bind to hundreds of mitochondrial circular RNAs.

[0071] like Figure 2 As shown in the figure, the circular RNA motifs bound by TRAP1 and ATP5B were predicted using HOMER software.

[0072] like Figure 3 As shown, the secondary structures of mecciND2 and mecciNd2 both have more single-stranded regions.

[0073] Example 2 Detection of the interaction between circular RNA and TRAP1 protein

[0074] 2.1 Experimental methods

[0075] 2.1.1 Group I self-splicing intron-mediated circular RNA circularization method

[0076] (1) Design of transcription template

[0077] The transcription template was designed according to the published article (PMID: 33406226) and chemically synthesized by a sequencing company. The template contained the inverted T4 td gene Group I intron, T7 promoter, and circular RNA sequence.

[0078] (2) In vitro synthesis of circular RNA precursors

[0079] The linear DNA fragment of circular RNA was transcribed with T7 promoter and synthesized into circular RNA precursor RNA by in vitro transcription using T7 transcription kit (Thermo Scientific, K0441).

[0080] Add the following components to a 50 μL reaction system:

[0081] T7-DNA template: 1 μg;

[0082] T7 RNA polymerase: 5 μL;

[0083] ATP, CTP, GTP, UTP (if biotin labeling is required, use UTP / biotin-UTP mixture): 10 mM each;

[0084] The mixture was incubated at 37°C for 4 hours.

[0085] (3) Purification of transcription products

[0086] Treat with DNase I to remove the template DNA and terminate the transcription reaction. Then purify the transcribed linear RNA using TRIzol reagent.

[0087] (4)In vitro circularization reaction

[0088] Incubate the transcribed linear RNA in the presence of circularization buffer (15 mM MgCl2, 1 mM DTT, 50 mM Tris-HCl, pH 7.5) and 2 mM GTP at 55 °C for 15 minutes.

[0089] (5)Isolation and purification of circularized products

[0090] Separate the reaction products on a 5% urea PAGE gel, excise the band corresponding to circular RNA, and elute the RNA overnight in elution buffer (20 mM Tris-HCl, pH 7.5, 250 mM NaOAc, 1 mM EDTA, 0.25% SDS). Purify the eluted RNA using the RNA Clean&Concentrator-5 kit (Zymo Research, R1013) to obtain high-purity circularized circular RNA for subsequent experiments and analysis.

[0091] 2.1.2 Pull-down experiment of biotin-labeled circular RNA on cytoplasmic TRAP1

[0092] (1)Cell transfection

[0093] Seed the cells in a 15 mm culture dish and transfect with 20 pmol of biotin-labeled circular RNA (or circ-ctrl as a control) for 24 hours.

[0094] (2)Cell treatment

[0095] Before collecting the cells, place the cells in a UV cross-linker and perform UV cross-linking at an intensity of 120 mJ / cm². After cross-linking, digest the cells with trypsin and collect them with PBS. Resuspend the cell pellet in 1 mL of ice-cold digitonin buffer (150 mM NaCl, 50 mM HEPES, pH 7.4, 50 μg / mL digitonin, protease inhibitor, RNase inhibitor), rotate and incubate at 4 °C for 15 minutes, and then centrifuge at 2,000 × g. Collect the supernatant as the cytoplasmic fraction for the subsequent pull-down experiment.

[0096] (3)Magnetic bead capture

[0097] Take 50 μL of streptavidin magnetic beads (Invitrogen, 11205D), and block them with 1% BSA and 500 ng / μL yeast tRNA at room temperature for 30 minutes. Add the blocked magnetic beads to the cytoplasmic fraction and incubate with rotation at room temperature for 1 hour. Collect and wash the magnetic beads using a magnetic separator. Finally, resuspend the magnetic beads in 100 μL of digitonin buffer, add SDS loading buffer, and boil at 100 °C for 10 minutes for subsequent Western blot detection.

[0098] 2.1.3 Proximity labeling technique (APEX)

[0099] (1) Transfect 5 nM circular RNA into 293T or HL-1 cells stably expressing mitochondrially matrix-localized APEX2, and culture for 24 hours.

[0100] (2) Place the cells in a culture medium containing 500 mM biotin-phenol (APExBIO, A8011), and incubate at 37 °C for 30 minutes. Then, add 1 mM H2O2 and treat at room temperature for 1 minute. Immediately add 2 mL of termination solution (10 mM ascorbic acid, 5 mM Trolox), and react for 1 minute to terminate the labeling.

[0101] (3) Lyse the cells with 1 mL of RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, protease inhibitor, RNase inhibitor). Add 50 µL of M-280 streptavidin magnetic beads (Invitrogen, 11206D), and incubate at room temperature for 2 hours to allow the labeled proteins to bind to the magnetic beads.

[0102] (4) Wash the magnetic beads 3 times with RIPA buffer, resuspend the magnetic beads in 60 µL of 2×SDS loading buffer containing 20 mM DTT and 2 mM biotin, and boil at 95 °C for 15 minutes. The final protein sample is used for Western blot detection.

[0103] 2.1.4 Western blot

[0104] Separate the protein mixture obtained in 2.1.2 or 2.1.3 by SDS-PAGE gel electrophoresis, and then transfer it to a nitrocellulose membrane. After blocking with 5% skim milk / TBST, prepare and incubate the primary and secondary antibodies, and finally develop the image and perform gray value statistical analysis using image J.

[0105] 2.2 Experimental results

[0106] As shown Figure 4 in A and E of [[REF]], mecciND2 and mecciNd2 transfected into cells bind to TRAP1 protein.

[0107] As shown Figure 4 in B and F of [[REF]], mecciND2 and mecciNd2 lead to an increase in the level of TRAP1 protein in mitochondria.

[0108] As shown Figure 4 in C, D, G and H of [[REF]], mecciND2 and mecciNd2 lead to a decrease in the level of CypD protein in cells.

[0109] Example 3 Functional Detection of Circular RNA in Cardiomyocytes

[0110] 3.1 Experimental Methods

[0111] (1) Transfection and treatment of cardiomyocytes: In vitro circularized mecciND2 or mecciNd2 was transfected into human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) and mouse cardiomyocyte line HL-1 cells using Lipofectamine 3000 product from Thermo. Hypoxic treatment conditions were: 1% O2 / 5% CO2 / balance N2, 37 °C, 24 hours; normoxic culture was used as a control. Doxorubicin treatment conditions were: 2 μM doxorubicin, 6 hours.

[0112] (2) mPTP and ROS detection: Commercial mPTP and ROS detection kits were used in this invention to perform live cell staining on specific cells, live cell photography was carried out using a laser confocal microscope, and fluorescence statistics were performed using Image J software.

[0113] 3.2 Experimental Results

[0114] As shown Figure 5 and Figure 6 shown, when cardiomyocytes are under hypoxic or doxorubicin stimulation, transfection with mecciND2 and mecciNd2 can maintain the closure of mitochondrial mPTP in cardiomyocytes, reduce ROS levels, and protect cardiomyocytes.

[0115] Example 4 Therapeutic Effect of mecciNd2 on Doxorubicin-Induced Heart Failure

[0116] 4.1 Experimental Methods

[0117] Mice (SPF-grade C57BL / 6, 8 weeks old, purchased from Beijing Spearf Bio-Technology Co., Ltd.):

[0118] Administer doxorubicin by intraperitoneal injection (5 mg / kg each time), and at the same time, inject mecciNd2 or control circular RNA encapsulated by liposome (7 μg each time) via the tail vein once a week for a total of 4 weeks. The procedure is as shown in Figure 7 A shown in the figure. The control circular RNA contains a 264-nt GFP sequence (SEQ ID No.3).

[0119] SEQ ID No.3:

[0120] AUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAG.

[0121] Note: According to the regulations of the WIPOST.26 standard, the uracil "U" in the sequence is represented by "T" in the sequence listing.

[0122] The experiment was divided into 4 groups, and the specific information is as follows:

[0123] Group 1: Inject PBS and control circular RNA (labeled as PBS; circ-ctrl in the figure);

[0124] Group 2: Inject PBS and mecciNd2 (labeled as PBS; mecciNd2 in the figure);

[0125] Group 3: Inject doxorubicin and control circular RNA (labeled as doxorubicin; circ-ctrl in the figure);

[0126] Group 4: Inject doxorubicin and mecciNd2 (labeled as doxorubicin; mecciNd2 in the figure).

[0127] At the fifth week, detect the cardiac function of the mice by color Doppler ultrasound; after sacrificing the mice, take out the hearts for measurement and photography; fix the heart tissues with 4% paraformaldehyde, dehydrate them with gradient alcohol, embed them in paraffin, and cut them into 5-μm-thick sections. After dewaxing the sections with xylene, perform hematoxylin and eosin staining or put them into the Masson staining solution for staining to obtain HE-stained sections.

[0128] 4.2 Experimental Results

[0129] As Figure 7 shown in B of [], one day after the tail vein injection of mecciNd2, the expression level of mecciNd2 in the heart tissue can be increased by about 20 times, and the increased expression level of mecciNd2 can be maintained until the 5th day.

[0130] As Figure 7 shown in C of [], compared with the DOX mice injected with the control circular RNA, the left ventricular ejection fraction of the DOX mice treated with mecciNd2 maintained normal levels.

[0131] As Figure 7 shown in D of [], the heart morphology of the DOX mice injected with the control circular RNA was significantly atrophied, while the heart morphology of the DOX mice treated with mecciNd2 was similar to that of the PBS mice.

[0132] As Figure 7 shown in E to G of [], compared with the PBS mice, the cardiomyocytes of the DOX mice injected with the control circular RNA were atrophied and the proportion of myocardial fibrosis increased. The treatment with mecciNd2 significantly reduced the atrophy and fibrosis of cardiomyocytes in the DOX mice.

[0133] Example 5 Therapeutic Effect of mecciNd2 on TAC-Induced Heart Failure

[0134] 5.1 Experimental Method

[0135] Mice (SPF-grade C57BL / 6, 8 weeks old, purchased from Beijing Speefoo Biotechnology Co., Ltd.):

[0136] Aortic arch constriction (TAC) surgery: Anesthetize the mice with avertin (250 mg / kg, intraperitoneal injection), make a small incision at the sternum to open the chest cavity, and expose the aortic arch. Pass a 6-0 silk thread through the aortic arch between the right brachiocephalic artery and the left common carotid artery, place a 27G pad needle parallel to the aortic arch closely, tighten the silk thread to ligate the aortic arch and then withdraw the pad needle to form aortic arch constriction. After tying a knot again to fix it, close the chest cavity layer by layer. The sham operation group (Sham) performed the same operation. The only difference was that the sham operation group only passed the thread without ligating the aortic arch.

[0137] One week after TAC surgery, inject mecciNd2 or control circular RNA (7 μg each time) wrapped by liposomes into the tail vein, inject once every three days, and inject a total of 3 times. The process is as Figure 8 shown in A of []. The control circular RNA contains a 264 nt GFP sequence, which is the same as the SEQ ID No.3 sequence in 4.1.

[0138] The experiment was divided into 4 groups, and the specific information is as follows:

[0139] Group 1: Sham operation was performed and control circular RNA was injected (labeled as Sham; circ-ctrl in the attached figure);

[0140] Group 2: Sham operation was performed and mecciNd2 was injected (labeled as Sham; mecciNd2 in the attached figure);

[0141] Group 3: TAC operation was performed and control circular RNA was injected (labeled as TAC; circ-ctrl in the attached figure);

[0142] Group 4: TAC operation was performed and mecciNd2 was injected (labeled as TAC; mecciNd2 in the attached figure).

[0143] Three weeks after the last injection, the cardiac function of the mice was detected by color Doppler ultrasound; after sacrificing the mice, the hearts were taken out for measurement and photography; the heart tissues were fixed with 4% paraformaldehyde, dehydrated with gradient alcohol, embedded in paraffin, and cut into sections with a thickness of 5 μm. After dewaxing the sections with xylene, they were successively stained with hematoxylin solution and eosin to obtain HE-stained sections or placed in Masson staining solution for staining.

[0144] 5.2 Experimental results

[0145] As Figure 8 shown in B, compared with the TAC mice injected with control circular RNA, the left ventricular ejection fraction of the TAC mice treated with mecciNd2 maintained at a normal level.

[0146] As Figure 8 shown in C, the hearts of the TAC mice injected with control circular RNA showed eccentric hypertrophy, while the hearts of the TAC mice treated with mecciNd2 did not increase significantly.

[0147] As Figure 8 shown in D to F, compared with the Sham mice, the myocardial cell area of the TAC mice injected with control circular RNA increased significantly, and the proportion of myocardial fibrosis increased. However, the treatment with mecciNd2 significantly reduced the hypertrophy and fibrosis of myocardial cells in the TAC mice.

Claims

1. Use of circular RNA in the preparation of a drug for preventing and / or treating heart failure, characterized in that, The circular RNA binds to the mPTP components ATP5B and TRAP1 protein; The sequence of the circular RNA is SEQ ID No.1 and / or SEQ ID No.

2.

2. The application according to claim 1, wherein The drug further comprises a pharmaceutically acceptable excipient.

3. The application according to claim 1, characterized in that The drug further comprises a viral vector.

4. The application according to claim 3, wherein The viral vector is one or more of an adenovirus vector and a retrovirus vector.

5. The application according to claim 1, characterized in that, The drug further comprises an embedding vector.

6. The application according to claim 5, wherein The embedding vector is a nanoparticle.

7. The application according to claim 5, characterized in that, The embedding vector is a liposome.

8. A drug for preventing and / or treating heart failure, characterized in that, The drug comprises a circular RNA having a sequence of SEQ ID No.1 and / or SEQ ID No.

2.

9. The drug according to claim 8, characterized in that, The heart failure includes acute heart failure or chronic heart failure.

Citation Information

Patent Citations

  • Application of mitochondrial genetic variation in predicting curative effect of glucocorticoid on SLE (systemic lupus erythematosus), kit and detection method

    CN113373217A

  • Application of circular RNA circSMAD3 in preparation of medicine for preventing and treating myocardial remodeling and heart failure

    CN119061130A