Process for the enzymatic preparation of a histamine dihydrochloride salt

Abstract

The application provides an enzymatic preparation method of histamine dihydrochloride, and belongs to the technical field of biochemistry. The method uses L-histidine as a substrate, uses a histidine decarboxylase mutant as a biological catalyst, and converts the substrate into histamine under suitable enzyme catalytic reaction conditions. Finally, the histamine dihydrochloride is obtained through a proper extraction and purification process. The substrate conversion rate of the enzyme catalytic reaction is more than 99%, and the purity of the product after extraction is greater than 98%. The enzyme catalytic method has the advantages of high conversion rate, short conversion time, easy extraction and purification, and great industrialization prospect. The method has the advantages of high conversion rate and high yield, and the obtained product has market competitive advantage.

Description

TECHNICAL FIELD

[0001] The present application relates to an enzymatic preparation method of histamine dihydrochloride, belonging to the technical field of biochemistry. BACKGROUND

[0002] Histamine dihydrochloride, CAS 56-92-8, white solid, melting point 249-252℃. It has very strong biological activity and is also an important pharmaceutical intermediate and additive. Histamine dihydrochloride is used for sustained relief and prevention of relapse after first remission treatment in adult patients with acute myeloid leukemia (AML). The drug can reduce the production of oxygen from autophagic cells, inhibit nicotinamide adenine dinosine phosphate oxidase and prevent interleukin-2 activated NK cells and T cells. The approval of histamine dihydrochloride injection on the market is based on the fact that its combination with interleukin-2 significantly reduces the relapse of AML patients. The proportion of patients treated with Ceplene / interleukin-2 combination is more than 50% without leukemia for a long time, and the patients have good tolerance to the product. Therefore, the synthesis of histamine and histamine compounds has become a hot issue of research. There are two salt-forming amino groups on histamine, so a relatively stable histamine dihydrochloride is formed.

[0003] Chemistry letters, 1986, 893-896 discloses that L-histidine is used as raw material to synthesize histamine dihydrochloride through decarboxylation and salt formation steps, which is represented by the following reaction equation:

[0004]

[0005] This synthesis method was first published in China, which uses 2-cyclohexen-1-ketone as catalyst and decarboxylates at 160℃, but the overall reaction has many impurities and is not suitable for actual production.

[0006] JP05255204 uses acetophenone as catalyst / diethylene glycol as solvent for reaction; CN1008594A patent application uses 2,4-dihydroxyacetophenone for decarboxylation, and the product also contains many unknown impurities, which is not suitable for pharmaceutical grade production.

[0007] CN102477014A uses p-methylacetophenone as catalyst to react at 170-175℃ in methylcyclohexanol to prepare histamine, and forms dihydrochloride by adding hydrogen chloride / methylcyclohexanol solvent. High temperature in the reaction puts high requirements on the equipment, and there are certain difficulties and risks in production, which also increases energy consumption. In addition, this route needs to prepare hydrogen chloride solution in methylcyclohexanol, which is relatively cumbersome in process, and the price of methylcyclohexanol is relatively high, which greatly increases the cost of raw materials.

[0008] CN104402825A uses the catalyst cuprous bromide to reduce the decarboxylation temperature to 100-110℃, which can reduce the types and content of unknown impurities and improve the conversion rate of raw materials.

[0009] CN106432089A uses histidine as a starting material, and prepares a nitrile methyl imidazole intermediate under alkaline conditions through strong chlorine oxide oxidation, and then prepares the product through catalytic hydrogenation and salification. This method requires a pressure of 10 MPa, or the combination of Raney nickel and hydrazine hydrate, and the danger is relatively high.

[0010] In summary, the current research and development focuses on decarboxylation catalysts and matched solvents, and through searching for different reaction systems, the reaction purity is improved, and the reaction temperature is reduced. However, in general, the above methods all have the problems of complex reaction system, high cost of raw materials, complicated process, difficult purification, and difficulty in industrial production. SUMMARY

[0011] In order to overcome the above technical defects, the purpose of the present application is to provide a biological enzyme method for preparing histamine dihydrochloride. That is, the present application provides an amino acid sequence of histidine decarboxylase, and provides a process method for preparing histamine dihydrochloride by using the enzyme, and further promotes the industrial production of histamine dihydrochloride.

[0012] The method of the present application uses L-histidine as a substrate, and uses a histidine decarboxylase mutant as a biological catalyst. Under suitable enzyme catalytic reaction conditions, the substrate is decarboxylated and converted into histamine. Finally, histamine dihydrochloride is extracted through a suitable extraction and purification process. The substrate conversion rate of the enzyme catalytic reaction is more than 99%, and the purity of the product after extraction is more than 98%. This enzyme catalytic method has the advantages of high conversion rate, short conversion time, easy extraction and purification, and great industrialization prospects. The method has the advantages of high conversion rate and high yield, and the obtained product has market competitive advantage.

[0013] The histidine decarboxylase mutant of the present application is obtained by double mutation of isoleucine at position 47 and cysteine at position 340 in the wild-type histidine decarboxylase amino acid sequence (shown in SEQ ID NO. 2) derived from Photobacterium sp..

[0014] Further, in the above technical solution, the sequence of the histidine decarboxylase mutant is shown in SEQ ID NO. 3.

[0015] The present application also provides a recombinant expression vector constructed by the above-mentioned histidine decarboxylase mutant sequence.

[0016] The present application also provides a recombinant genetically engineered bacterium prepared by transformation of the above-mentioned recombinant expression vector.

[0017] The application further provides application of the histidine decarboxylase mutant in catalyzing preparation of histamine dihydrochloride from L-histidine.

[0018] Further, in the technical solution, the crude enzyme solution is used as a biological catalyst, and L-histidine is used as a substrate to perform enzyme catalysis in a pH = 6.5 reaction system.

[0019] Further, in the technical solution, the recombinant engineering bacteria containing the histidine decarboxylase mutant gene are induced by IPTG to obtain whole cell wet bacteria, and the bacteria are broken by ultrasonic to obtain the crude enzyme solution. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 A histidine decarboxylase expression vector map;

[0021] Figure 2 A reaction liquid HPLC detection map of the histidine decarboxylase mutant catalyzing L-histidine to generate histamine. DETAILED DESCRIPTION

[0022] The application will be further described below in combination with the drawings and specific examples.

[0023] Example 1

[0024] I. Construction of a wild-type aspartate decarboxylase cloning strain

[0025] The histidine decarboxylase amino acid sequence (SEQ ID NO. 2) from Photobacterium sp. is found and obtained in the NCBI database. The sequence is used as a basis for codon optimization (SEQ ID NO. 1), and the codon optimization and gene synthesis service are commissioned from Beijing Genki Biotechnology Co., Ltd. The optimized and synthesized gene is cloned in the pET-30a(+) plasmid between the NdeI and NotI enzyme digestion sites to obtain the pET30a-HDC recombinant plasmid. The recombinant plasmid pET30a-HDC is heat shock transformed into the E. coli BL21(DE3) competent cells to obtain the wild-type histidine decarboxylase expression engineering bacteria Ec-HDC.

[0026] SEQ ID NO. 1

[0027]

[0028]

[0029] SEQ ID NO. 2

[0030]

[0031] LB medium was used to activate the culture of the engineering bacteria Ec-HDC:

[0032] The configuration method of LB medium: 5 g / L of yeast powder, 10 g / L of protein peptone, 10 g / L of sodium chloride, after configuration, sterilize by high pressure steam at 121°C for 20 min, and then add 2% (w / v) agar as LB solid medium for strain plate culture and single colony isolation and purification. Before using the medium, add kanamycin with a final concentration of 50 μg / mL. Activation and culture method: the glycerol tube containing the engineering bacteria was streaked on the LB solid medium plate for overnight culture at 37°C. Then, a single colony was picked from the plate and inoculated into 5 mL of LB resistant liquid medium, and cultured at 37°C, 220 rpm overnight. The bacterial cells were collected by centrifugation, and the plasmid was extracted according to the operation manual of the plasmid extraction kit.

[0033] The wild-type histidine decarboxylase expression vector extracted above was used as the DNA template, and the histidine decarboxylase was subjected to gene mutation using the PCR mutation kit (Nanjing Novozyme Bio-tech Co., Ltd., item number: C214-01). First, the primer I47K-F and I47K-R were used to construct the 47th amino acid mutation sequence HDC-I47K.

[0034] Then, the mutant sequence vector was used as the template, and the primer C340D-F and C340D-R were used to mutate the 340th amino acid sequence. Finally, the expression vector containing the double-mutant histidine decarboxylase sequence (SEQ ID NO. 3) was obtained.

[0035] SEQ ID NO. 3

[0036] 1 Met Thr Leu Ser lie Glu Asn Gin Asn Lys Leu Asp Glu Phe Trp Ala Tyr Cys Val Lys 21 Asn Gin Tyr Phe Asn lie Gly Tyr Pro Glu Ser Ala Asp Phe Asp Tyr Thr lie Leu Glu 41 Arg Phe Met Arg Phe Ser Lys Asn Asn Cys Gly Asp Trp Ala Glu Tyr Cys Asn Tyr Leu 61 Leu Asn Ser Phe Asp Phe Glu Lys Glu Val Met Glu Tyr Phe Ala Asp Leu Phe Lys lie 81 Pro Phe Glu Asp Ser Trp Gly Tyr Val Thr Asn Gly Gly Thr Glu Ser Asn Met Phe Gly 101 Cys Tyr Leu Gly Arg Glu Leu Phe Pro Asp Gly Thr Leu Tyr Tyr Ser Lys Asp Thr His 121 Tyr Ser Val Ala Lys lie Val Lys Leu Leu Arg lie Lys Ser Gin Leu Val Glu Ser Leu 141 Pro Asn Gly Glu lie Asp Tyr Asp Asp Leu lie Ala Lys lie Lys Gin Asp Asp Glu Lys 161 His Pro lie lie Phe Ala Asn lie Gly Thr Thr Val Arg Gly Ala lie Asp Asp lie Ser 181 Lys lie Gin Ala Met lie Gly Glu Leu Gly lie Lys Arg Glu Asp Tyr Tyr lie His Ala 201 Asp Ala Ala Leu Ser Gly Met lie Leu Pro Phe Val Asp Glu Pro Gin Gly Phe Asn Phe 221 Ala Asp Gly lie Asp Ser lie Gly Val Ser Gly His Lys Met lie Gly Ser Pro lie Pro 241 Cys Gly lie Val Val Ala Lys Lys Arg Asn Val Asp Ala lie Ser Val Glu lie Asp Tyr 261 lie Ser Ala His Asp Lys Thr lie Thr Gly Ser Arg Asn Gly His Thr Pro Leu Met Met 281 Trp Cys Ala Val Lys Ser His Thr His Glu Asp Phe Lys Arg Arg lie Asn Arg Ser Leu 301 Asp Leu Ala Gin His Ala Val Gin Arg Leu Gin Ser Ala Gly lie Asn Ala Trp Cys Asn 321 Lys Asn Ser lie Thr Val Val Phe Pro Cys Pro Ser Glu Ala Val Trp Lys Lys His Asp 341 Leu Ala Thr Ser Gly Gly Gin Ala His Leu lie Thr Thr Ala His His Leu Asp Ala Ser 361 Lys Val Asp Ala Leu lie Asp Asp Val lie Lys Asp Ala Asn Gly Glu Thr lie Ala Ala

[0037] Mutant primers are shown in Table 1, PCR reaction system composition is shown in Table 2, and PCR reaction conditions are shown in Table 3.

[0038] Table 1 Primers for PCR mutation

[0039] Primer Sequence (5'-3')

[0040] 147K-F AATAACAAAGGCGACTGGGCCGAATATTGCAA

[0041] 147K-R CAGTCGCCTTTGTTATTGATGCTAAAGCGCATA

[0042] C340D-F GAAAAAACACGATCTGGCTACTTCTGGTGGCCAGG

[0043] C340D-R GTAGCCAGATCGTGTTTTTTCCAAACTGCTTCGGA

[0044] Table 2 PCR reaction system

[0045] Component Volume (μL) 2 x Max Buffer 25 dNTP Mix (10 mM each) 1 Template DNA (100-500 ng) 1 Primer F (10 μM) 2 Primer R (10 μM) 2 DNA Polymerase 1 ddH2O Up to 50

[0046] Table 3 PCR reaction conditions

[0047]

[0048] After the PCR product was verified by agarose gel electrophoresis, the template plasmid was digested with Dpn I restriction enzyme. The digested product was transformed into E. coli BL21 (DE3) competent cells, then plated on LB kanamycin-resistant plates and incubated at 37°C overnight. Single colonies were randomly picked from the plates, and the plasmid was extracted after liquid culture and verified by sequencing. Finally, the mutant plasmid with correct sequence was obtained, indicating that the expression vector containing the aspartate decarboxylase mutant gene and the recombinant engineering bacteria were obtained. The strain was preserved in a glycerol tube at -80°C. The aspartate decarboxylase mutant gene expression vector was named pET30a-HDC-M2. The engineering bacteria were named Ec-HDC-M2.

[0049] Example 2

[0050] I. Preparation of crude enzyme solution of histidine decarboxylase mutant

[0051] The engineering bacteria Ec-HDC-M2 were inoculated into 5 mL of LB liquid medium (kanamycin concentration 50 μg / mL) and incubated at 37°C overnight for 12 h to obtain a seed solution. Then, 1 mL of the seed solution was transferred into 500 mL of LB liquid medium with the same resistance, and the bacteria were cultured at 37°C under shaking until the OD 600 When the OD reached 0.8, IPTG inducer was added to a final concentration of 0.5 mM. The culture was induced at 28°C for 20 h. After the culture, the bacterial cell culture solution was centrifuged at 8000 rpm for 20 min, and the supernatant was discarded. The bacterial cells were resuspended in PBS buffer with pH = 7.0, and a 25% (w / v) bacterial suspension was prepared for low-temperature ultrasonic disruption. The supernatant was collected as the crude enzyme solution.

[0052] II. Enzyme activity determination of histidine decarboxylase

[0053] The enzyme activity U of histidine decarboxylase was defined as: the amount of enzyme that catalyzes the generation of 1 micromole of histamine per minute using L-histidine as the substrate was defined as one enzyme activity unit, i.e., 1 U.

[0054] A histidine solution with a concentration of 30 g / L was prepared using PBS buffer with pH = 6.5. 20 mL of the histidine solution was taken, and pyridoxal phosphate (PLP) was added to a final concentration of 10 mM. 2 mL of the crude enzyme solution was added, and the reaction was carried out at 35°C for 30 min. Then, the sample was taken for HPLC detection. The content of histamine generated in the reaction was calculated by detecting the peak area and the histamine standard curve, and thus the enzyme activity was calculated.

[0055] Example 3 Optimization of reaction system for catalyzing histidine to prepare histamine dihydrochloride

[0056] The single factor optimization method is used to optimize each component of the enzyme catalysis reaction system. The engineering bacteria Ec-HDC-M2 constructed in Example 1 is used as the research object, and the crude enzyme solution is prepared by the method in Example 2. 200 mL of enzyme catalysis reaction solution is prepared by using pure water, 15 g of histidine, 0.1 g of coenzyme PLP, 15 mL of crude enzyme solution, and the initial pH is adjusted to 7.0. The reaction is started. The reaction process is controlled at 35℃, and hydrochloric acid is used to control the pH to 6.5. After 18 hours of reaction, the sample is taken for HPLC detection. Subsequently, the addition amount of histidine, coenzyme PLP and crude enzyme solution is adjusted respectively to determine the optimal enzyme catalysis reaction system (Table 4).

[0057] Table 4 Optimization of enzyme catalysis reaction system

[0058] Serial No. Histidine (g) Coenzyme PLP (g) Crude Enzyme mL Conversion Rate (%) 1 15 0.1 15 99.6 2 20 0.1 15 99.5 3 25 0.1 15 91.3 4 20 0.1 15 99.5 5 20 0.08 12 99.4 6 20 0.05 12 99.3 7 20 0.02 8 99.5 8 20 0.01 6 90.4

[0059] Example 4 Enzyme catalysis reaction pilot test

[0060] According to the results obtained in Example 3, a 1L enzyme catalysis reaction pilot test is carried out. In the 1L catalysis system, 100 g of histidine and 0.1 g of PLP coenzyme are added, and the volume is adjusted to 960 mL with pure water, and the initial pH is adjusted to 7.0. Then 40 mL of crude enzyme solution is added, and the reaction is started. The reaction process is controlled at 35℃, and the pH is adjusted to 6.5 with hydrochloric acid. After 18 hours of reaction, the sample is taken for HPLC detection. The detection shows that the conversion rate of histamine in the solution reaches 99.4%.

[0061] After the reaction is completed, the reaction solution is adjusted to pH 2.0 with concentrated hydrochloric acid. After filtration with activated carbon in a Buchner funnel and rotary evaporation, the obtained solid is washed with methanol and filtered, and then dried to obtain 104.2 g of histamine dihydrochloride with a yield of 87.8% and a purity of >98% detected by HPLC.

[0062] The above only describes the preferred embodiments of the present application, but the protection scope of the present application is not limited thereto. For those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A histidine decarboxylase mutant, characterized in that: The mutant is a histidine decarboxylase mutant obtained by mutating isoleucine at position 47 to lysine and cysteine at position 340 to aspartic acid in the amino acid sequence of wild-type histidine decarboxylase derived from Photobacterium sp., as shown in SEQ ID NO.

2.

2. A recombinant expression vector constructed from the histidine decarboxylase mutant of claim 1.

3. A recombinant genetically engineered bacterium prepared by transformation of the recombinant expression vector of claim 2.

4. Use of the histidine decarboxylase mutant of claim 1 in catalyzing preparation of histamine dihydrochloride from L-histidine.

5. Use of a histidine decarboxylase mutant according to claim 4 for catalyzing the production of histamine dihydrochloride from L-histidine, characterized in that: The enzyme catalysis reaction was carried out in a reaction system with pH = 6.5 using the crude enzyme solution as a biological catalyst and L-histidine as a substrate.

6. Use of a histidine decarboxylase mutant according to claim 5 for catalyzing the production of histamine dihydrochloride from L-histidine, characterized in that: The recombinant genetically engineered bacterium containing the gene encoding the histidine decarboxylase mutant was induced by IPTG to obtain wet whole cell, and the cell was broken by ultrasonic to obtain the crude enzyme solution.

Images