Glucan particle composition coated with STING agonist as well as preparation method and application of glucan particle composition

Abstract

The invention discloses a glucan particle composition coated with an STING agonist as well as a preparation method and application of the glucan particle composition. The STING agonist is encapsulated and fixed in a cavity in the GPs through in-situ self-assembly of the polypeptide coupled with the STING agonist in the GPs. Glucose particles are adopted as a delivery carrier of the STING agonist, and compared with delivery carriers such as lipidosome and polymers, the glucose particles are simple in preparation process, can be prepared in a cheap and large-scale mode and have very good stability; sTING small molecules are retained in a GPs cavity by using a micro-scale structure formed after polypeptide assembly, so that the limitation of the permeability of the GPs is overcome.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a composition of glucan particles containing a STING agonist, a preparation method and an application thereof. Background Art

[0002] Immunotherapy is revolutionizing cancer treatment, however, only a small fraction of patients respond to immunotherapy. Limited patient response rates have been attributed to the presence of immunosuppressive networks in the tumor microenvironment (TME). Stimulation of innate immune danger sensors, such as stimulator of interferon genes (STING), is an effective therapeutic strategy to generate durable antitumor immune responses. Activation of STING induces the secretion of type I interferons and pro-cytokines, enhances natural killer (NK) cell- and T cell-mediated tumor killing, and drives multifaceted antitumor immune functions.

[0003] In recent years, there has been a rapid growth of interest in the development of natural and synthetic analogs of natural cytoplasmic cyclic dinucleotides (CDNs) and non-nucleotide small molecule STING agonists. Most STING agonists are natural CDNs from bacteria or humans that work by mimicking STING's natural ligand 2'3'-cGAMP. c-di-GMP, c-di-AMP, and 3'3-cGAMP are found in prokaryotic cells. However, natural CDNs are electronegative, hydrophilic, and easily degraded by phosphodiesterases (mainly ENPP1). These characteristics, coupled with their large size, make them unable to penetrate cell membranes, resulting in low drug bioavailability in tumor tissues and requiring intratumoral administration. To address these limitations, various approaches are being taken, such as synthetic CDNs, small molecule STING agonists, and ENPP1 inhibitors. Although new STING agonists based on non-CDN structures have recently been reported for systemic administration, their toxicity profiles and efficacy have not yet been studied in clinical trials. Nanoparticles, such as those based on polymers and liposomes, can enhance the local and systemic therapeutic effects of CDN-based STING agonists, demonstrating the potential and utility of nanomedicine-based STING agonist delivery. However, recent findings have begun to illuminate a potential drawback of STING agonists, namely that they may lead to STING activation in “off-target” cell types (such as effector T cells), leading to apoptosis and ultimately hindering the formation of immune memory. Different approaches to targeted delivery of STING agonists to antigen-presenting cells (APCs) within tumors could reduce this off-target systemic effect and improve the overall efficacy of treatment.

[0004] Yeast cell wall β-(1,3;1,6)-glucan particles (GPs) are biogenic hollow porous particles of 3-5 μm in size with good physicochemical stability and biocompatibility. This cavity allows it to effectively adsorb molecules, and the porous structure of GPs allows small molecules and biomolecules to enter and exit freely. Many in vivo and in vitro studies have demonstrated that GPs can deliver macromolecules such as DNA, siRNA, and proteins. These types of macromolecules are trapped in GPs by assembling layer by layer with cationic polymers to form complexes (polymers). Small neutral drug molecules, such as curcumin, are physically encapsulated in glucan particles by embedding them in hydrogels that are partially sealed in GPs. Moreover, GPs are an immunomodulator with a variety of pathogen-associated molecular patterns (PAMPs) that can be specifically recognized and internalized by lectin receptors such as Dectin-1, TLRs, and complement receptor 3 (CR3) on the surface of immune cells such as macrophages and dendritic cells. Once internalized, they activate the signaling pathways downstream of the receptors, thereby exerting an immunomodulatory function. Since GPs have the ability to activate innate immunity and are approved as safe by the FDA, they are ideal carriers for the targeted delivery of STING agonists to APCs.

[0005] Peptide-based biomaterials have attracted the interest of more and more researchers and are widely used due to their good biocompatibility and ability to form different supramolecular structures. Many research results show that peptide sequences assemble into supramolecular structures, such as Q11 sequence (QQKFQFQFEQQ), TTR sequence (YTIAALLSPYS), etc. At the same time, the self-assembly of peptides is also responsive. For example, the VK2H peptide designed by Zhang et al. has a reversible response to pH. It can be assembled into fibers when pH>9, and when pH<6, the assembly will disassemble. Therefore, the microscale structure formed after the peptide assembly will be retained in the GPs cavity to overcome the limitation of GPs permeability (i.e., leakage of biomolecules after encapsulation). At the same time, the responsiveness of peptide self-assembly enables them to achieve spatiotemporal controllable assembly in a confined environment. Therefore, the STING agonist can be retained in the cavity within the glucan particle by controlling the self-assembly of the peptide within the glucan particle to form nanofibers. Summary of the invention

[0006] The main purpose of the present invention is to provide a composition of glucan particles coated with a STING agonist, a preparation method and an application thereof, so as to overcome the problems in the prior art that the STING agonist is metabolically unstable, easily and rapidly cleared, and has insufficient cytoplasmic entry, thereby affecting the efficacy of the agonist, and to make up for the deficiency of the STING agonist in activating an immunosuppressive microenvironment in "off-target" cell types.

[0007] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention includes:

[0008] A composition of dextran particles encapsulating a STING agonist, wherein a polypeptide coupled to the STING agonist is self-assembled in situ in GPs, thereby encapsulating and fixing the STING agonist in a cavity in the GPs.

[0009] The polypeptide is Q13.

[0010] The STING agonist is MSA2.

[0011] A method for preparing a composition of glucan particles containing a STING agonist, the method comprising the following steps:

[0012] Step 1 Preparation of glucan particles: obtained from yeast according to alkaline and acidic methods;

[0013] Step 2: Synthesis of MSA2-Q13: Synthesize MSA2-butyric acid from MSA2, and synthesize MSA2-Q13 according to the method of connecting amino acids;

[0014] Step 3: Preparation of MSA2-Q13@GPs: The porous structure of GPs promotes the internalization of MSA2-Q13 into GPs through capillary action, and the addition of salt solution triggers the self-assembly of MSA2-Q13 in GPs to obtain the composite MSA2-Q13@GPs.

[0015] The synthesis steps of MSA2-Q13 in step 2 are as follows:

[0016] Step 2-1: Synthesis of MSA2-butyric acid: tert-butyl 4-bromobutyrate is first esterified with MSA-2, and then the tert-butyl ester protecting group is removed under acidic conditions;

[0017] Step 2-2 Peptide Q13 was synthesized by a standard solid phase peptide synthesis method. MSA2-butyric acid was synthesized onto the resin, the reagent was eluted and the resin was dried, and then the mixture was washed with 95% TFA + 2.5% H 2 MSA2-Q13 was cleaved from the resin and the side chain protecting groups were removed under the condition of O + 2.5% Tis, and precipitated with cold ether.

[0018] The preparation process of MSA2-Q13@GPs in step 3 is as follows: dissolving the polypeptide MSA2-Q13 powder in an acetonitrile / water mixture; mixing the MSA2-Q13 solution with the dextran particles to form a thick paste; centrifuging for the first time to allow the mixture to precipitate at the bottom; repeating the mixing and centrifuging steps to obtain a uniform paste; centrifuging for a second time to allow the mixture to precipitate at the bottom, and after standing at room temperature, freeze-drying the paste to form a lyophilized powder.

[0019] The acetonitrile / water mixture was 30% v / v, and the concentration of the MSA2-Q13 solution was 10 mg / mL. The ratio of MSA2-Q13 solution to GPs particles was 40 μL:10 mg. The first centrifugation parameter was 5000×g / min, 10 seconds, the second centrifugation parameter was 5000×g / min, 2 minutes, and the room temperature placement time was 2 hours.

[0020] Use of a composition of dextran particles coated with a STING agonist in the preparation of anti-tumor drugs.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1) In the present invention, glucan particles (derived from yeast cell walls) are used as delivery carriers of STING agonists. Compared with delivery carriers such as liposomes and polymers, the preparation process of glucose particles is simple, they can be prepared in large quantities at a low cost, and they have very good stability.

[0023] 2) In the present invention, the microscale structure formed after polypeptide assembly is utilized to retain the STING small molecule in the GPs cavity to overcome the limitation of GPs permeability.

[0024] 3) The composition can be specifically phagocytosed by DC cells and macrophages, avoiding side effects such as immunosuppressive microcirculation caused by using STING agonists alone.

[0025] 4) The composition can simultaneously activate the cGAS-STING signaling pathway and the NF-κB pathway in APC cells, promoting the maturation of DC cells and the polarization of macrophages to M1.

[0026] 5) The combination showed better effect in inhibiting tumor growth in animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 represents an electron scanning image of dextran particles;

[0028] Figure 2 Represents laser confocal images of dextran particles incubated with thioflavin T (Th T) in bright field (Bright Field) and fluorescent field (ThT);

[0029] Figure 3 Laser confocal images showing MSA2-Q13-encapsulated dextran particles (MSA2-Q13@GPs) incubated with Th T in bright field (BrightField) and fluorescence field (Th T);

[0030] Figure 4Laser confocal images showing the uptake of fluorescently labeled MSA2-Q13@GPs by different cell types: dendritic cells (BMDC), macrophages (BMDM), colon cancer cells (MC-38), fibroblasts (NIH3T3), and endothelial cells (HUVEC);

[0031] Figure 5 Statistical graph showing the effects of untreated, MSA2-treated, and MSA2-Q13@GPs-treated cells on PD-L1 expression levels in MC-38 cells;

[0032] Figure 6 Statistical graph showing the effects of untreated, MSA2-treated, and MSA2-Q13@GPs-treated cells on the expression level of IDO1 in MC-38 cells;

[0033] Figure 7 Flow cytometry showing the effects of untreated and MSA2-Q13@GPs-treated dendritic cells on maturation;

[0034] Figure 8 Flow cytometry showing the effects of untreated and MSA2-Q13@GPs-treated cells on M1 polarization of macrophages;

[0035] Fig. 9 Graph showing the tumor growth curves of MC-38 colorectal cancer bearing mice in the untreated and MSA2-Q13@GPs treated groups. DETAILED DESCRIPTION

[0036] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] First of all, it should be noted that the definitions of the terms mentioned in the specification of the present invention are known to those skilled in the art. For example, the definitions of some of the terms are as follows:

[0038] The term "MSA2" refers to an oral non-nucleotide STING agonist with the structural formula:

[0039]

[0040] The term "Q13" refers to a 13-amino acid polypeptide with a molecular structure of KRQQKFQFQFEQQRK-NH 2 , the structural formula is as follows:

[0041]

[0042] The term "GPs" refers to the β-(1,3;1,6)-glucan particles of the yeast cell wall.

[0043] In one aspect, an embodiment of the present invention provides a method for preparing a composition (MSA2-Q13@GPs) of glucan particles containing Q13-coupled STING stimulator (MSA2); in another aspect, it also provides the use of the aforementioned composition (MSA2-Q13@GPs) in the preparation of anti-tumor drugs.

[0044] In order to further understand the present invention, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The non-essential improvements and adjustments made by those skilled in the art under the core guiding ideology of the present invention still belong to the protection scope of the present invention. The experimental methods for which specific conditions are not indicated in the following examples are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0045] Unless otherwise specified, the experimental materials used in the following examples can be purchased from conventional chemical reagent companies.

[0046] Example 1 Preparation of GPs

[0047] Preparation of GPs particles: They were obtained from Saccharomyces cerevisiae or baker's yeast according to the alkaline and acidic methods described in the literature.

[0048] The specific preparation process is as follows:

[0049] 1) Add 1L preheated NaOH solution (1mol / L) to a 2L beaker, then add 100g baker's yeast powder and stir evenly with a stirring rod. Keep stirring at 80℃ in a magnetic stirrer for 1 hour;

[0050] 2) Cool the mixture to room temperature, then transfer the contents to two 500 mL centrifuge bottles, centrifuge at 8000 × g for 10 minutes, collect the precipitate, and discard the supernatant. Resuspend the precipitate with 500 mL of ultrapure water, centrifuge again, and centrifuge at 8000 × g for 10 minutes. Repeat this step 3 times;

[0051] 3) The precipitate was resuspended in 500 mL of deionized water with pH = 5 and incubated at 55°C for 1 hour, then centrifuged at 8000×g for 10 minutes, the precipitate was collected and the supernatant was discarded. The precipitate was resuspended in 100 mL of ultrapure water and centrifuged again at 8000×g for 10 minutes. This step was repeated 3 times.

[0052] 4) Resuspend the pellet with 100 mL of isopropanol and centrifuge again at 8000 × g for 10 minutes. Repeat this step 3 times;

[0053] 5) Resuspend the pellet with 100 mL of acetone and centrifuge again at 8000 × g for 10 minutes. Repeat this step 3 times;

[0054] 6) Allow to dry naturally. The product is a white powder (about 10 g of product) and is stored at -20°C.

[0055] Results: Figure 1 As shown, the obtained dextran particle powder was photographed using a scanning electron microscope to obtain the morphology of GPs. GPs are hollow particles with a diameter of about 3-5 μm, and the particle size is relatively uniform, which is consistent with the results reported in the literature.

[0056] Example 2 Synthesis of MSA2-Q13

[0057] In order to connect MSA2 to the peptide and ensure that it can quickly release MSA2 after entering the cell, we first modified MSA2 and synthesized MSA2-butyric acid.

[0058] Tert-butyl 4-bromobutyrate is first esterified with MSA-2, and then the tert-butyl ester protecting group is removed under acidic conditions. The specific reaction is divided into two steps:

[0059] Step 1

[0060]

[0061] In a 25 mL flask, MSA2 (29.73 mg, 0.1 mmol) solid and K 2 CO 3 Solid (27.6 mg, 0.2 mmol), then add tert-butyl 4-bromobutyrate (44.6 mg, 0.2 mmol), and stir at room temperature to react. Use a silica gel plate (n-hexane: ethyl acetate = 5:5) to monitor the progress of the reaction until the raw material point disappears. After the reaction is completed, use a rotary evaporator to remove the solvent.

[0062] Step 2:

[0063]

[0064] In a 25 mL flask, 95% TFA + 2.5% H 2 O + 2.5% Tis was used to dissolve the product obtained in the previous step, and stirred at room temperature for 2 hours. After the reaction was completed, the solvent was removed using a rotary evaporator, and washed with DCM for several times and dried by spin drying. Finally, cold ether was used for precipitation.

[0065] Peptide Q13 was synthesized using a resin by a standard solid phase peptide synthesis (SPPS) method. After the last amino acid was synthesized, MSA2-butyric acid was synthesized onto the resin according to the method of connecting amino acids. The resin was then washed 5 times with DMF / DCM / DMF / DCM and dried. The resin was then washed with 95% TFA+2.5% H 2 MSA2-Q13 was cleaved from the resin and the side chain protecting groups were removed under the conditions of 2% O + 2.5% Tis, and finally precipitated with cold ether.

[0066]

[0067] Example 3 Preparation of MSA2-Q13@GPs

[0068] The preparation of MSA2-Q13@GPs is achieved through a spatiotemporally controllable process. The porous structure of GPs promotes the internalization of MSA2-Q13 into GPs through capillary action. Then, a salt solution is added to trigger the self-assembly of MSA2-Q13 within GPs. The specific operation process is as follows:

[0069] 1) Dissolve the peptide MSA2-Q13 powder in a 30% v / v acetonitrile / water mixture at a concentration of 10 mg / mL;

[0070] 2) Mix 40 μL of MSA2-Q13 solution (10 mg / mL) with 10 mg of GPs dry particles to form a thick paste;

[0071] 3) Rapid centrifugation for 10 seconds (5000 × g / min) to allow the mixture to precipitate at the bottom;

[0072] 4) Repeat the mixing and centrifugation steps to obtain a homogenous paste;

[0073] 5) Centrifuge for 2 minutes (5000×g / min) to allow the mixture to precipitate at the bottom;

[0074] 6) After standing at room temperature for 2 hours, the paste was freeze-dried to remove the solvent to form a freeze-dried powder.

[0075] 7) Repeat steps 2-6 4 times to achieve the purpose of multiple loading of MSA2-Q13.

[0076] Preparation of MSA2-Q13@GPs solution: 40 μL of ultrapure water was first added to the MSA2-Q13@GPs lyophilized powder (10 mg) and mixed evenly. After standing for 2 hours, 100 μL of 10×PBS solution was added and mixed evenly. After standing overnight, 860 μL of ultrapure water was added and mixed well to obtain a dispersed MSA2-Q13@GPs particle solution. The mixture was centrifuged for 2 minutes (5000×g / min) and washed three times with 1×PBS buffer. Reprecipitated with 1 mL of 1×PBS to obtain a fully dispersed MSA2-Q13@GPs particle solution, which was stored at 4°C.

[0077] Results: In order to confirm the assembly of MSA2-Q13 in GPs, the distribution of Th T fluorescent dye in GPs was observed using laser confocal microscopy to determine the co-localization of MSA2-Q13 assembly and GPs. Figure 2 As shown in Figure 2, in the GPs+Th T group, a weak fluorescence signal was observed, which may be a weak background fluorescence. Figure 3 As shown, in the MSA2-Q13@GPs+Th T group, the particles showed a strong fluorescence signal. This significant change indicates that MSA2-Q13 was in situ assembled inside GPs and formed an amyloid fiber structure that can strongly bind to the Th T fluorescent dye. This method provides intuitive and strong evidence of the assembly of MSA2-Q13 in GPs.

[0078] Example 4 Cell Targeting of MSA2-Q13@GPs

[0079] Dendritic cells (BMDC), macrophages (BMDM), colon cancer cells (MC-38), fibroblasts (NIH3T3), and endothelial cells (HUVEC) were plated into confocal dishes (500,000 / dish) and cultured at 37°C for 1 day. DTAF-labeled MSA2-Q13@GPs were added and incubated for 4 hours. The cell culture medium was then removed and the cells were washed 2-3 times with PBS or saline for 3-5 minutes each time. The distribution of MSA2-Q13@GPs in different cell types was observed by confocal microscopy.

[0080] Results: Figure 4 As shown, bright green fluorescence appeared inside BMDC and BMDM cells, indicating that these cells can effectively take up GPs. In contrast, no green fluorescence was observed inside other types of cells (MC-38, NIH / 3T3, HUVEC), indicating that they hardly take up GPs. This result proves that MSA2-Q13@GPs can selectively deliver STING agonists to antigen-presenting cells.

[0081] Example 5 Use of MSA2-Q13@GPs to avoid high expression of PD-L1

[0082] After the MC-38 tumor cell line was revived, it could be used for experiments after 2-3 generations of passage. Tumor cells were plated in a 12-well plate at 100,000 / well. After incubating the cells with MSA2 and MSA2-Q13@GPs for 2 days, the cells were collected and the expression level of PD-L1 in the tumor cell line was detected by flow cytometry using PD-L1 antibody according to the instructions.

[0083] like Figure 5 As shown in the figure, when MSA2 was used alone, the expression level of PD-L1 in MC-38 cells was upregulated. However, when MSA2-Q13@GPs was used, the expression of PD-L1 was not significantly affected.

[0084] Example 6 Use of MSA2-Q13@GPs to avoid high expression of IDO1

[0085] After the MC-38 tumor cell line was revived, it could be used for experiments after 2-3 generations of passages. Tumor cells were plated in a 12-well plate at 100,000 / well. After incubating the cells with MSA2 and MSA2-Q13@GPs for 2 days, the cells were collected and the total mRNA of the cells was extracted according to the instructions. The transcription level of IDO1 in the tumor cell line was detected by Q-PCR.

[0086] Primer sequence for IDO1 (5'-3'):

[0087] F:CCAGTGCAGTAGAGCGTCAA

[0088] R:TCCCAGACCCCCTCATACAG

[0089] like Figure 6 As shown in the figure, when MSA2 was used alone, the transcription level of IDO1 mRNA in MC-38 cells was upregulated. However, when MSA2-Q13@GPs was used, the transcriptional expression of IDO1 was not significantly affected.

[0090] Example 7: MSA2-Q13@GPs promotes the maturation of dendritic cells

[0091] BMDCs were plated in 12-well plates. After 1 day, MSA2-Q13@GPs were added and incubated for 3 days. The cells were collected and resuspended in PBS. Centrifuged at 350×g for 5 minutes and the supernatant was discarded. Appropriate conjugated fluorescent antibodies (CD11c-PE, CD80-FTIC, CD86-APC) at a predetermined optimal concentration were added and incubated on ice in the dark for 15-20 minutes. Centrifuged at 350×g for 5 minutes with at least 2 mL of PBS buffer and washed twice. The cell pellet was resuspended in 0.5 mL of PBS buffer and fluorescence-activated flow cytometry was performed to analyze the differentiation level of dendritic cells.

[0092] Results: Figure 7 As shown, the effect of MSA2-Q13@GPs on BMDC cell maturation was evaluated by detecting the expression levels of CD80 and CD86. After 72 hours of treatment, the maturity of BMDC cells was significantly enhanced when MSA2-Q13@GPs was used, reaching 84.4%, compared with the untreated group (28.3%), showing the significant effect of MSA2-Q13@GPs in promoting the maturation of dendritic cells.

[0093] Example 8: MSA2-Q13@GPs promotes macrophage polarization toward M1

[0094] BMDM were plated in 12-well plates. After 1 day, MSA2-Q13@GPs were added and incubated for 3 days. The cells were collected and resuspended in PBS. Centrifuged at 350×g for 5 minutes and the supernatant was discarded. Appropriate conjugated fluorescent antibodies (CD11b-FITC, F4 / 80-PE, CD86-APC Cy7) at a predetermined optimal concentration were added and incubated on ice in the dark for 15-20 minutes. Centrifuged at 350×g for 5 minutes with at least 2 mL of PBS buffer and washed twice. The cell pellet was resuspended in 0.5 mL of PBS buffer and fluorescence-activated flow cytometry was performed to analyze the differentiation level of the cells.

[0095] Results: Figure 8 As shown, the effect of MSA2-Q13@GPs on the polarization of M0 macrophages to M1 macrophages was evaluated by detecting the expression levels of F4 / 80 and CD86. After 72 hours of treatment, the M1 polarization level of BMDM cells was significantly enhanced when MSA2-Q13@GPs was used, reaching 66.9% compared with the untreated group (25.8%), showing the significant effect of MSA2-Q13@GPs in inducing M1 macrophage polarization.

[0096] Example 9 MSA2-Q13@GPs inhibits tumor growth

[0097] Female C57BL / 6J mice (4-6 weeks old) were purchased and randomly divided into cages and housed in an SPF animal room for one week to adapt to the environment. 6 MC-38 cells / cells were implanted subcutaneously into the right flank of mice. When the tumor grew to 100-150mm 3 The animals were randomly assigned to different treatment groups, namely the saline group and the MSA2-Q13@GPs group. GPs were administered peritumorally at a dose of 1 mg / animal, once every 4 days, for a total of 3 times. Tumor size was measured with a vernier caliper every two to three days, and the calculation formula was: tumor volume (mm 3 )=(length×width 2 ) / 2. All animals were euthanized at the end of the experiment. 3 When the volume or body condition was poor, the mice were euthanized.

[0098] Results: Fig. 9 As shown in the figure, compared with the control group, the tumor growth rate of mice in the MSA2-Q13@GPs treatment group was significantly reduced, and the tumor growth was basically stopped. This result proves the effectiveness of MSA2-Q13@GPs in tumor treatment.

[0099] In summary, the preparation method of the present invention is simple and can be used to prepare the MSA2-Q13@GPs composition, which can be used in the preparation of tumor inhibitory drugs and has economical practicality and industrial application prospects.

[0100] The above embodiments are only exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

Claims

1. A composition of glucan particles containing a STING agonist, characterized in that: The STING agonist was encapsulated and fixed into the cavity within GPs by in situ self-assembly of peptides coupled to the STING agonist within the dextran particles.

2. The composition of glucan particles containing a STING agonist according to claim 1, characterized in that: The polypeptide is Q13.

3. The composition of glucan particles containing a STING agonist according to claim 1, characterized in that: The STING agonist is MSA2.

4. A method for preparing a composition of glucan particles containing a STING agonist, characterized in that , the method comprises the following steps: Step 1 Preparation of glucan particles: obtained from yeast according to alkaline and acidic methods; Step 2: Synthesis of MSA2-Q13: Synthesize MSA2-butyric acid from MSA2, and synthesize MSA2-Q13 according to the method of connecting amino acids; Step 3: Preparation of MSA2-Q13@GPs: The porous structure of GPs promotes the internalization of MSA2-Q13 into GPs through capillary action, and the addition of salt solution triggers the self-assembly of MSA2-Q13 in GPs to obtain the composite MSA2-Q13@GPs.

5. The method for preparing the composition of glucan particles containing a STING agonist according to claim 4, characterized in that: The synthesis steps of MSA2-Q13 in step 2 are as follows: Step 2-1: Synthesis of MSA2-butyric acid: tert-butyl 4-bromobutyrate is first esterified with MSA-2, and then the tert-butyl ester protecting group is removed under acidic conditions; Step 2-2: Peptide Q13 was synthesized by a standard solid phase peptide synthesis method. MSA2-butyric acid was synthesized onto the resin, the reagent was eluted and the resin was dried, MSA2-Q13 was cut from the resin and the side chain protecting groups were removed using 95% TFA + 2.5% H2O + 2.5% Tis, and the mixture was precipitated with cold ether.

6. The method for preparing the composition of glucan particles containing a STING agonist according to claim 4, characterized in that: The preparation process of MSA2-Q13@GPs in step 3 is as follows: dissolving the peptide MSA2-Q13 powder in an acetonitrile / water mixture; mixing the MSA2-Q13 solution with the dextran particles to form a thick paste; The first centrifugation allows the mixture to settle at the bottom; the mixing and centrifugation steps are repeated to obtain a homogenous paste; The mixture was centrifuged a second time to precipitate at the bottom, and after standing at room temperature, the paste was freeze-dried to form a lyophilized powder.

7. The method for preparing the composition of glucan particles containing a STING agonist according to claim 6, characterized in that: The acetonitrile / water mixture was 30% v / v, and the concentration of the MSA2-Q13 solution was 10 mg / mL. The ratio of MSA2-Q13 solution to GPs powder was 40 μL:10 mg. The first centrifugation parameter was 5000×g / min, 10 seconds, the second centrifugation parameter was 5000×g / min, 2 minutes, and the room temperature placement time was 2 hours.

8. Use of a composition of dextran particles coated with a STING agonist in the preparation of anti-tumor drugs.

Images