TCR (T cell receptor) for recognizing HPV (human papillomavirus) multiple antigen epitopes and coding sequence of TCR

Abstract

The invention relates to a TCR (T cell receptor) capable of recognizing multiple antigen epitopes of HPV (human papillomavirus) and a coding sequence of the TCR, the TCR can be simultaneously combined with a QVDYYGLYY-HLA-A0101 compound and a KSAIVTLTY-HLA-A0101 compound, the TCR comprises a TCR alpha chain variable region and a TCR beta chain variable region, the amino acid sequence of a CDR3 in the TCR alpha chain variable region is CAVDTGGFKTIF (SEQ ID NO: 1), and / or the amino acid sequence of a CDR3 in the TCR beta chain variable region is CASSTSDGNYGYTF (SEQ ID NO: 2). By adopting the technical scheme, the invention provides the TCR capable of simultaneously and specifically recognizing E2 antigen oligopeptides QVDYYGLYY (SEQ ID NO: 3) and KSAIVTLTY (SEQ ID NO: 4) from an HPV16 source, and the oligopeptides and HLA-A0101 can form a compound and jointly present the compound to the surface of a cell.

Description

Technical Field

[0001] The present invention relates to a TCR capable of simultaneously recognizing two HPV16-derived antigen epitopes and a coding sequence thereof, and also relates to the use of the TCR in preventing and treating HPV16-related diseases. Background Art

[0002] The HPV16 E2 gene is an important regulatory gene in the human papillomavirus type 16 (HPV16) genome, which is mainly responsible for regulating the transcription of viral genes and the replication of viral DNA. The E2 protein it encodes is a neutral protein containing about 370 amino acids. Globally, HPV16 is the most common high-risk human papillomavirus that causes cervical cancer, accounting for about 60% of cervical cancer cases. This proportion is particularly significant in cases of cervical squamous cell carcinoma. At present, there have been relatively in-depth studies on the structure and function of the E2 protein molecule. The transcription activation region and the DNA binding region structure, the E2 protein is mainly involved in the transcriptional regulation of HPV viral genes, the initiation of DNA replication and the segmentation of the viral genome. At the same time, the E2 molecule is also believed to play an important role in the replication of viral DNA, post-transcription of genes, and the packaging of viral genes. In addition, studies have shown that the E2 protein can encode activators and repressors, regulate the expression of HPV viral early genes, and interact with promoters that regulate the transcription of E6 and E7, thereby affecting the expression of E6 and E7. QVDYYGLYY (SEQ ID NO: 3) and KSAIVTLTY (SEQ ID NO: 4) are short peptides derived from HPV16 E2 antigen and are targets for the treatment of HPV16-related diseases.

[0003] TCR-T (T cell receptor engineered T cells) adoptive immunotherapy is an immunotherapy strategy that uses genetic engineering to modify the patient's autologous T cells to accurately identify and kill specific tumor antigens. The core principle is to introduce specific TCR (T cell receptor) genes into the patient's T cells, enabling them to recognize antigens presented on the cell surface through the major histocompatibility complex (MHC), thereby triggering the immune response of T cells. Therefore, one of the current research focuses in this field is to screen out TCRs that can specifically recognize HPV16-related antigen peptides and transduce these TCRs into T cells to obtain specific T cells targeting HPV16 antigens for cellular immunotherapy. However, it is not clear which antigen peptides can effectively induce specific T cell clones and whether there are TCRs that can simultaneously recognize multiple HPV16 antigen epitopes. Therefore, it is urgent to conduct in-depth research on TCRs that specifically recognize HPV16 antigen peptides and develop effector cell transduction technologies with corresponding functions. Summary of the invention

[0004] Objective of the present invention: In order to overcome the defects of the prior art, the present invention provides a TCR that recognizes HPV multiple antigen epitopes and its encoding sequence, wherein the TCR can specifically recognize a mixture of E2 antigen short peptides QVDYYGLYY (SEQ ID NO: 3) and KSAIVTLTY (SEQ ID NO: 4) and HLA-A0101.

[0005] The technical solution of the present invention: A TCR that recognizes multiple HPV antigen epitopes, the TCR can simultaneously bind to QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes, the TCR comprises a TCR α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region CDR3 amino acid sequence is CAVDTGGFKTIF (SEQ ID NO: 1), and / or the TCR β chain variable region CDR3 amino acid sequence is CASSTSDGNYGYTF (SEQ ID NO: 2); The amino acid sequences of the three complementarity determining regions (CDRs) of the TCRα chain variable domain are: αCDR1-DSAIYN (SEQ ID NO: 5) αCDR2-IQSSQRE (SEQ ID NO: 6) αCDR3-AVDTGGFKTI (SEQ ID NO:7) The three complementarity determining regions of the TCRβ chain variable domain are: βCDR1-MNHEY (SEQ ID NO: 8) βCDR2-SMNVEV (SEQ ID NO:9) βCDR3-ASSTSDGNYGYT (SEO ID NO: 10).

[0006] In another preferred embodiment, the TCR comprises a TCR α chain variable region having an amino acid sequence with at least 90% sequence similarity to SEQ ID NO: 18, and / or a TCR β chain variable region having an amino acid sequence with at least 90% sequence similarity to SEQ ID NO: 20.

[0007] In another preferred embodiment, the TCR is in soluble form.

[0008] In another preferred embodiment, the TCR is in single chain form.

[0009] In another preferred embodiment, the TCR is composed of an α chain variable region and a β chain variable region connected by a peptide linker sequence.

[0010] In another preferred embodiment, the N-terminus or C-terminus of the α chain and / or β chain of its TCR is bound to a coupling molecule; the coupling molecule is a detectable marker, a therapeutic agent, a pharmacokinetic modifying portion or any combination of these substances.

[0011] The second aspect of the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding the TCR molecule described in the first aspect of the present invention or its complementary chain.

[0012] In another preferred embodiment, the nucleic acid molecule encodes the nucleotide sequence of SEQ ID NO: 17 of the TCR α chain variable region.

[0013] In another preferred embodiment, the nucleic acid molecule encodes the nucleotide sequence SEQ ID NO: 19 of the variable region of the TCR β chain.

[0014] The third aspect of the present invention provides a vector, which comprises the nucleic acid molecule described in the second aspect of the present invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

[0015] The fourth aspect of the present invention provides a host cell, which comprises the vector described in the third aspect of the present invention or the nucleic acid molecule described in the second aspect of the present invention is integrated into its genome.

[0016] The fifth aspect of the present invention provides a cell, wherein the cell is transduced with the nucleic acid molecule described in the second aspect of the present invention or the vector described in the third aspect of the present invention; preferably, the cell is a T cell or a stem cell.

[0017] The sixth aspect of the present invention provides a pharmaceutical composition, which comprises a pharmaceutically acceptable carrier and the TCR described in the first aspect of the present invention, the nucleic acid molecule described in the second aspect of the present invention, the vector described in the third aspect of the present invention, or the cell described in the fifth aspect of the present invention.

[0018] The seventh aspect of the present invention provides the use of the TCR described in the first aspect, the nucleic acid molecule described in the second aspect, the vector described in the third aspect or the cell described in the fifth aspect of the present invention in the preparation of a drug for treating tumors or autoimmune diseases. Preferably, the disease is a tumor. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 To analyze the overlap between the TCR profile of CD8+ T cells that recognize QVDYYGLYY-HLA-AO101 tetramer and the TCR profile of CD8+ T cells that recognize KSAIVTLTY-HLA-AO101 tetramer; Figure 2This is a molecular docking diagram of the TCR identifying HPV multi-epitopes and the QVDYYGLYY-HLA-AO101 and KSAIVTLTY-HLA-AO101 complexes identified by the present invention; Figure 3 The results of the CCK8 killing function test of the effector T cells transduced with the HPV multi-epitope TCR recognized by the present invention were verified; Figure 4 It is the result of flow cytometric detection of activation markers after effector T cells transduced with the TCR of the present invention kill target cells. DETAILED DESCRIPTION

[0020] The technical scheme in this embodiment will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] It should be noted that in the description of the present invention, all directional indications (such as up, down, front, back, etc.) are only used to explain the relative position relationship, movement status, etc. between the components under a certain specific posture (as shown in the accompanying drawings). If the specific posture changes, the directional indication will also change accordingly.

[0022] In addition, the technical solutions between the various embodiments of the present invention may be combined with each other, but this must be based on the fact that they can be implemented by those skilled in the art. When the combination of technical solutions is mutually contradictory or cannot be implemented, it should be deemed that such combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0023] like Figure 1 As shown, through the study of HPV16-infected tumor-infiltrating lymphocytes, a TCR that can simultaneously recognize the HPV16 antigen short peptides QVDYYGLYY (SEQ ID NO: 3) and KSAIVTLTY (SEQ ID NO: 4) was found. The antigen short peptides can form a complex with HLA-A0101 and be presented on the cell surface together.

[0024] The present invention also provides a nucleic acid molecule encoding the TCR.

[0025] In a preferred embodiment of the present invention, the α chain of the TCR comprises a CDR having the following amino acid sequence: αCDR1-DSAIYN (SEQ ID NO: 5) αCDR2-IQSSQRE (SEQ ID NO: 6) αCDR3-AVDTGGFKTI (SEQ ID NO:7) The three complementarity determining regions of the TCRβ chain variable domain are: βCDR1-MNHEY (SEQ ID NO: 8) βCDR2-SMNVEV (SEQ ID NO:9) βCDR3-ASSTSDGNYGYT(SEO ID NO:10) The CDR region amino acid sequence of the present invention can be embedded into any suitable framework structure to prepare a chimeric TCR. As long as the framework structure is compatible with the CDR region of the TCR of the present invention, those skilled in the art can design or synthesize a TCR molecule with corresponding functions based on the CDR region disclosed in the present invention. Therefore, the TCR molecule of the present invention refers to a TCR molecule comprising the above-mentioned α and / or β chain CDR region sequences and any suitable framework structure.

[0026] The variable domain of the TCR α chain of the present invention is an amino acid sequence having at least 90%, more preferably 95% sequence identity with SEQ ID NO: 18; and / or the variable domain of the TCR β chain of the present invention is an amino acid sequence having at least 90%, more preferably 95% sequence identity with SEQ ID NO: 20.

[0027] In a preferred embodiment of the present invention, the TCR molecule is a heterodimer composed of an α chain and a β chain. Specifically, the α chain of the heterodimeric TCR comprises a variable region and a constant region, and the amino acid sequence of the variable region of the α chain comprises CDR1 (SEQ ID NO: 5), CDR2 (SEQ ID NO: 6) and CDR3 (SEQ ID NO: 7) of the above-mentioned α chain.

[0028] Preferably, the TCR molecule comprises the amino acid sequence SEQ ID NO: 18 as the variable region of the α chain. On the other hand, the β chain of the heterodimeric TCR also comprises a variable region and a constant region, wherein the variable region amino acid sequence of the β chain comprises CDR1 (SEQ ID NO: 8), CDR2 (SEQ ID NO: 9) and CDR3 (SEQ ID NO: 10) of the above β chain.

[0029] Preferably, the TCR molecule comprises the amino acid sequence SEQ ID NO: 20 as the variable region of the β chain.

[0030] The TCR of the present invention can be used independently, or can be combined with a coupling molecule through a covalent bond or other means, preferably through a covalent bond.

[0031] The conjugated molecule includes a detectable marker (for diagnostic purposes, particularly when the TCR is used to detect cells presenting QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes), a therapeutic agent, or a combination of these substances. The therapeutic agent that can be combined or conjugated with the TCR of the present invention includes, but is not limited to: (1) radioactive isotopes; (2) biological toxins.

[0032] Nucleic acid molecules The second aspect of the present invention discloses a nucleic acid molecule encoding the TCR molecule or a fragment thereof as described in the first aspect of the present invention; the fragment may include one or more CDRs, variable regions of the α chain and / or β chain, or the entire α chain and / or β chain.

[0033] The nucleotide sequence encoding the CDR region of the α chain of the TCR molecule of the first aspect of the present invention is as follows: αCDR1-GATAGCGCTATTTACAAC (SEQ ID NO:11) αCDR2-ATTCAGTCAAGTCAGAGAGAG (SEQ ID NO:12) αCDR3- GCTGTCGATACTGGAGGCTTCAAAACTATC (SEQIDNO:13) The nucleotide sequence encoding the CDR region of the β chain of the TCR molecule of the first aspect of the present invention is as follows: βCDR1-ATGAACCATGAGTAT (SEQ ID NO:14) βCDR2- TCAATGAATGTTGAGGTG (SEQ ID NO:15) βCDR3- GCCAGCAGTACCTCCGACGGAAACTATGGCTACACC (SEO ID NO:16) Therefore, the nucleotide sequence of the TCRα chain encoded by the nucleic acid molecule provided by the present invention includes but is not limited to SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13; at the same time, the nucleotide sequence encoding the TCRβ chain may include but is not limited to SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16.

[0034] The nucleotide sequence of the nucleic acid molecule may be in single-stranded or double-stranded form, may be either RNA or DNA, and may or may not selectively contain introns.

[0035] Preferably, the nucleotide sequence of the nucleic acid molecule of the present invention has no intron structure, but can effectively encode the polypeptide of the present invention. For example, the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR α chain of the present invention includes SEQ ID NO: 1 and / or the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR β chain of the present invention includes SEQ ID NO: 2. Alternatively, the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR α chain of the present invention includes SEQ ID NO: 11~13 and / or the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR β chain of the present invention includes SEQ ID NO: 14~16.

[0036] It should be noted that due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Therefore, the nucleic acid sequence encoding the TCR of the present invention may be completely consistent with the sequence listed in the accompanying drawings, or it may be a degenerate variant thereof. For example, a "degenerate variant" refers to a nucleic acid molecule that can still encode the protein sequence shown in SEQ ID NO:7 despite differences in nucleotide sequence from SEQ ID NO:13.

[0037] The following specific examples illustrate the present invention in more detail. Experimental conditions not specifically described in the examples were all performed using conventional experimental methods. Experimental materials and reagents involved in the examples, unless otherwise specified, can be obtained through commercial channels.

[0038] The short peptides QVDYYGLYY and KSAIVTLTY (Jiangsu GenScript Biotechnology Co., Ltd.) were synthesized and renatured with biotin-labeled HLA-A0101 to prepare pMHC haploids. These haploids were combined with PE-labeled streptavidin (BD Company) to form PE-labeled tetramers.

[0039] Freshly resected HPV-positive tumor tissue was cut into 2-4 mm pieces using sterile surgical scissors and forceps, and placed in a 24-well plate with 2 mL of complete T cell culture medium per well. Tumor-infiltrating lymphocytes (TILs) were isolated by incubating in a 37°C, 5% CO2 incubator.

[0040] TILs were stained with PE-labeled tetramers, CD8+ and tetramer double-positive cells were screened, and single-cell TCR sequencing was performed. The QVDYYGLYY and KSAIVTLTY tetramer TCR immune profiles were analyzed, and TCR genes that appeared simultaneously in the two immune profiles were screened and cloned.

[0041] A lentiviral vector containing the candidate TCR gene was synthesized, and the specificity of the candidate TCR gene was verified by CCK8 cell activity assay and T cell activation assay. The target cells were COS7-HLA-A0101 cells loaded with QVDYYGLYY or KSAIVTLTY, and the control group was COS7-HLA-A0101 cells without load. The experimental results showed that the candidate TCR gene can specifically recognize COS7-HLA-A0101 cells loaded with QVDYYGLYY or KSAIVTLTY at the same time.

Claims

1. A TCR that recognizes multiple HPV antigen epitopes, characterized in that: The TCR is capable of simultaneously binding to the QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes, and the TCR comprises a TCR α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region CDR3 amino acid sequence is CAVDTGGFKTIF (SEQ ID NO: 1), and / or the TCR β chain variable region CDR3 amino acid sequence is CASSTSDGNYGYTF (SEQ ID NO: 2); The amino acid sequences of the three complementarity determining regions (CDRs) of the TCRα chain variable domain are: αCDR1-DSAIYN (SEQ ID NO: 5) αCDR2-IQSSQRE (SEQ ID NO: 6) αCDR3-AVDTGGFKTI (SEQ ID NO:7) The three complementarity determining regions of the TCRβ chain variable domain are: βCDR1-MNHEY (SEQ ID NO: 8) βCDR2-SMNVEV (SEQ ID NO:9) βCDR3-ASSTSDGNYGYT (SEO ID NO: 10).

2. The TCR for recognizing multiple HPV antigen epitopes according to claim 1, characterized in that: The TCR comprises a TCR α chain variable region having an amino acid sequence with at least 90% sequence similarity to SEQ ID NO: 18, and / or a TCR β chain variable region having an amino acid sequence with at least 90% sequence similarity to SEQ ID NO:

20.

3. The TCR for recognizing multiple HPV antigen epitopes according to claim 1 or 2, characterized in that: The N-terminus or C-terminus of the α chain and / or β chain of its TCR is bound to a coupling molecule; The conjugated molecule is a detectable marker, a therapeutic agent, a pharmacokinetic modifying moiety, or any combination of these substances.

4. A multivalent TCR complex, characterized in that Comprising at least two TCR molecules, wherein at least one TCR molecule is the TCR described in any one of claims 1 to 3 above.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleic acid sequence encoding the TCR molecule according to any one of claims 1 to 3 or its complementary sequence.

6. A carrier, characterized in that The vector contains the nucleic acid molecule according to claim 5; the vector is a viral vector: specifically, the vector is a lentiviral vector.

7. An isolated host cell, characterized in that The host cell contains the vector according to claim 6, or the exogenous nucleic acid molecule according to claim 5 is integrated into its chromosome.

8. A cell, characterized in that The cell is transduced with the nucleic acid molecule of claim 5 or the vector of claim 6; the cell is a T cell or a stem cell.

9. A pharmaceutical composition, characterized in that Comprising a pharmaceutically acceptable carrier and the TCR described in any one of claims 1 to 3, the TCR complex described in claim 4, the nucleic acid molecule described in claim 5, or the cell described in claim 8.

10. Use of the T cell receptor according to any one of claims 1 to 3, or the TCR complex according to claim 4, or the cell according to claim 8, characterized in that: Used for preparing drugs for treating tumors or autoimmune diseases.

Images