A TCR for identifying multiple HPV epitopes and its coding sequence

Abstract

The present invention relates to a TCR for recognizing multiple antigen epitopes of HPV and its coding sequence. This TCR can simultaneously bind to the QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes. The TCR comprises a variable region of TCR α chain and a variable region of TCR β chain, wherein the amino acid sequence of CDR3 of the variable region of TCR α chain is CAVDTGGFKTIF (SEQ ID NO:1), and / or the amino acid sequence of CDR3 of the variable region of TCR β chain is CASSTSDGNYGYTF (SEQ ID NO:2). By adopting the above technical solution, the present invention provides a TCR that can specifically recognize the E2 antigen short peptides QVDYYGLYY (SEQ ID NO:3) and KSAIVTLTY (SEQ ID NO:4) derived from HPV16 simultaneously. The above short peptides can form complexes with HLA-A0101 and be co-presented on the cell surface.

Description

Technical Field

[0001] The present invention relates to TCRs that can simultaneously recognize two epitopes derived from the HPV16 antigen and their coding sequences, and also relates to the use of these TCRs in the prevention and treatment of HPV16-related diseases. Background Art

[0002] The HPV16 E2 gene is an important regulatory gene in the genome of human papillomavirus type 16 (HPV16). It is mainly responsible for regulating the transcription of viral genes and the replication of viral DNA. The E2 protein encoded by it is a neutral protein containing approximately 370 amino acids. Globally, HPV16 is the most common high-risk human papillomavirus that causes cervical cancer, accounting for approximately 60% of cervical cancer cases. This proportion is particularly significant in cases of cervical squamous cell carcinoma. Currently, relatively in-depth studies have been conducted on the structure and function of the E2 protein molecule, including the structure of the transcriptional activation region and the DNA-binding region. The E2 protein is mainly involved in the transcriptional regulation of HPV viral genes, initiating DNA replication, and the partitioning of the viral genome. At the same time, the E2 molecule is also considered to play an important role in the process of viral DNA replication, post-transcription, and the packaging of viral genes. Additionally, studies suggest that the E2 protein can encode activators and inhibitors to regulate the expression of early genes of the HPV virus, interact with the promoter that regulates the transcription of E6 and E7, and thus affect the expression of E6 and E7. QVDYYGLYY (SEQ ID NO:3) and KSAIVTLTY (SEQ ID NO:4) are short peptides derived from the HPV16 E2 antigen and are a target for the treatment of HPV16-related diseases.

[0003] Adoptive immunotherapy with TCR-T (T cell receptor-engineered T cells) is an immunotherapy strategy in which a patient's autologous T cells are genetically engineered to precisely recognize and kill specific tumor antigens. Its core principle is to introduce a specific TCR (T cell receptor) gene into the patient's T cells, enabling them to recognize antigens presented on the cell surface through the major histocompatibility complex (MHC), thereby triggering the immune response of T cells. Therefore, one of the current research focuses in this field is to screen out TCRs that can specifically recognize HPV16-related antigen peptides and transduce these TCRs into T cells to obtain specific T cells against the HPV16 antigen for cellular immunotherapy. However, it is not yet clear which antigen peptides can effectively induce specific T cell clones and whether there are TCRs that can simultaneously recognize multiple epitopes of HPV16. Therefore, it is urgently necessary to conduct in-depth research on TCRs that specifically recognize HPV16 antigen peptides and develop effector cell transduction technologies with corresponding functions. Summary of the Invention

[0004] Object of the present invention: In order to overcome the defects of the prior art, the present invention provides a TCR for identifying multiple antigen epitopes of HPV and its coding sequence. This TCR can specifically recognize the mixture formed by the E2 antigen short peptides QVDYYGLYY (SEQ ID NO:3) and KSAIVTLTY (SEQ ID NO:4) and HLA-A0101.

[0005] Technical solution of the present invention: A TCR for identifying multiple antigen epitopes of HPV, which can simultaneously bind to the QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes. This TCR comprises a variable region of TCR α chain and a variable region of TCR β chain, wherein the amino acid sequence of CDR3 of the variable region of TCR α chain is CAVDTGGFKTIF (SEQ ID NO:1), and / or the amino acid sequence of CDR3 of the variable region of TCR β chain is CASSTSDGNYGYTF (SEQ ID NO:2);

[0006] The amino acid sequences of CDR1, CDR2 and CDR3 of the variable region of the α chain of the TCR are respectively:

[0007] αCDR1 - DSAIYN (SEQ ID NO:5)

[0008] αCDR2 - IQSSQRE (SEQ ID NO:6)

[0009] αCDR3 - AVDTGGFKTI (SEQ ID NO:1)

[0010] The amino acid sequences of CDR1, CDR2 and CDR3 of the variable region of the β chain of the TCR are respectively:

[0011] βCDR1 - MNHEY (SEQ ID NO:8)

[0012] βCDR2 - SMNVEV (SEQ ID NO:9)

[0013] βCDR3 - ASSTSDGNYGYT (SEO ID NO:2).

[0014] In another preferred embodiment, the variable region of TCR α chain comprised in the TCR is an amino acid sequence having at least 90% sequence similarity with SEQ ID NO:18, and the variable region of TCR β chain is an amino acid sequence having at least 90% sequence similarity with SEQ ID NO:20.

[0015] In another preferred embodiment, the TCR is in a soluble form.

[0016] In another preferred embodiment, the TCR is in single-chain form.

[0017] In another preferred embodiment, the TCR is formed by connecting the variable region of the α chain and the variable region of the β chain through a peptide linker sequence.

[0018] In another preferred embodiment, a coupling molecule is bound to the N-terminus or C-terminus of the α chain and β chain of its TCR; the coupling molecule is a detectable label.

[0019] The second aspect of the present invention provides a nucleic acid molecule, which comprises a nucleic acid sequence encoding the TCR molecule described in the first aspect of the present invention or its complementary strand.

[0020] In another preferred embodiment, the nucleotide sequence of the nucleic acid molecule encoding the variable region of the TCR α chain is SEQ ID NO: 17.

[0021] In another preferred embodiment, the nucleotide sequence of the nucleic acid molecule encoding the variable region of the TCR β chain is SEQ ID NO: 19.

[0022] The third aspect of the present invention provides a vector, which comprises the nucleic acid molecule described in the second aspect of the present invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.

[0023] The fourth aspect of the present invention provides a host cell, which comprises the vector described in the third aspect of the present invention or the nucleic acid molecule described in the second aspect of the present invention is integrated into its genome.

[0024] The fifth aspect of the present invention provides a cell, which is transduced with the nucleic acid molecule described in the second aspect of the present invention or the vector described in the third aspect of the present invention; preferably, the cell is a T cell or a stem cell.

[0025] The sixth aspect of the present invention provides a pharmaceutical composition, which comprises a pharmaceutically acceptable carrier and the TCR described in the first aspect of the present invention, the nucleic acid molecule described in the second aspect of the present invention, the vector described in the third aspect of the present invention or the cell described in the fifth aspect of the present invention.

[0026] The seventh aspect of the present invention provides the use of the TCR described in the first aspect of the present invention, the nucleic acid molecule described in the second aspect of the present invention, the vector described in the third aspect of the present invention or the cell described in the fifth aspect of the present invention in the preparation of a medicament for treating cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1Analysis of the overlap between the TCR profiles of CD8+ T cells recognizing the QVDYYGLYY-HLA-AO101 tetramer and the TCR profiles of CD8+ T cells recognizing the KSAIVTLTY-HLA-AO101 tetramer;

[0028] Figure 2 Molecular docking diagram of the binding of the TCR recognizing multiple HPV epitopes identified in the present invention to the QVDYYGLYY-HLA-AO101 and KSAIVTLTY-HLA-AO101 complexes;

[0029] Figure 3 Results of the CCK8 killing function test of effector T cells transduced with the TCR recognizing multiple HPV epitopes of the present invention;

[0030] Figure 4 Flow cytometry detection results of activation markers after effector T cells transduced with the TCR of the present invention killed target cells. Detailed implementation mode

[0031] Next, the technical solutions in this embodiment will be clearly and completely described in conjunction with the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0032] It should be noted that in the description of the present invention, all directional indications (such as up, down, front, back...) are only used to explain the relative positional relationship and movement conditions between components in a specific posture (as shown in the drawings). If the specific posture changes, the directional indications will also change accordingly.

[0033] In addition, the technical solutions between various embodiments of the present invention can be combined with each other, but it must be based on the fact that those skilled in the art can implement them. When the combination of technical solutions conflicts or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the protection scope required by the present invention.

[0034] As Figure 1 shown, through the study of HPV16-infected tumor-infiltrating lymphocytes, TCRs that can simultaneously recognize the HPV16 antigen short peptides QVDYYGLYY (SEQ ID NO: 3) and KSAIVTLTY (SEQ ID NO: 4) were found. The antigen short peptides can form complexes with HLA-A0101 and be presented on the cell surface together.

[0035] The present invention also provides nucleic acid molecules encoding the TCR.

[0036] In a preferred embodiment of the present invention, the amino acid sequences of CDR1, CDR2, and CDR3 of the variable region of the α-chain of the TCR are respectively:

[0037] αCDR1 - DSAIYN (SEQ ID NO:5)

[0038] αCDR2 - IQSSQRE (SEQ ID NO:6)

[0039] αCDR3 - AVDTGGFKTI (SEQ ID NO:1)

[0040] The amino acid sequences of CDR1, CDR2, and CDR3 of the variable region of the β-chain of the TCR are respectively:

[0041] βCDR1 - MNHEY (SEQ ID NO:8)

[0042] βCDR2 - SMNVEV (SEQ ID NO:9)

[0043] βCDR3 - ASSTSDGNYGYT (SEO ID NO:2)

[0044] The amino acid sequences of the CDR regions of the present invention described above can be embedded into any suitable framework structure to prepare a chimeric TCR. As long as the framework structure is compatible with the CDR regions of the TCR of the present invention, those skilled in the art can design or synthesize TCR molecules with corresponding functions based on the CDR regions disclosed in the present invention.

[0045] Therefore, the TCR molecule of the present invention refers to a TCR molecule comprising the above-mentioned α- and β-chain CDR region sequences and any suitable framework structure.

[0046] The variable region of the TCR α-chain of the present invention is an amino acid sequence having at least 90%, more preferably 95% sequence identity with SEQ ID NO:18; the variable region of the TCR β-chain of the present invention is an amino acid sequence having at least 90%, more preferably 95% sequence identity with SEQ ID NO:20.

[0047] In a preferred embodiment of the present invention, the TCR molecule is a heterodimer composed of an α-chain and a β-chain. Specifically, the α-chain of the heterodimeric TCR comprises a variable region and a constant region, and the amino acid sequence of the variable region of the α-chain includes the above-mentioned α-chain CDR1 (SEQ ID NO:5), CDR2 (SEQ ID NO:6), and CDR3 (SEQ ID NO:1).

[0048] Preferably, the TCR molecule comprises the amino acid sequence SEQ ID NO:18 as the variable region of the α chain. On the other hand, the β chain of the heterodimeric TCR also comprises a variable region and a constant region, wherein the amino acid sequence of the variable region of the β chain includes CDR1 (SEQ ID NO:8), CDR2 (SEQ ID NO:8) and CDR3 (SEQ ID NO:2) of the above-mentioned β chain.

[0049] Preferably, the TCR molecule comprises the amino acid sequence SEQ ID NO:20 as the variable region of the β chain.

[0050] The TCR of the present invention can be used independently or combined with a coupling molecule by covalent bond or other means, preferably by covalent binding.

[0051] The coupling molecule includes a detectable label (for diagnostic purposes, especially when the TCR is used to detect cells presenting the QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes), a therapeutic agent or a combination of these substances. Therapeutic agents that can bind or couple to the TCR of the present invention include but are not limited to: (1), radioactive isotopes; (2), biological toxins.

[0052] Nucleic acid molecule

[0053] A second aspect of the present invention discloses a nucleic acid molecule encoding the TCR molecule or a fragment thereof described in the first aspect of the present invention; the fragment may include one or more CDRs, variable regions of the α chain and β chain, or the entire α chain and / or β chain.

[0054] The nucleotide sequences encoding the CDR regions of the α chain of the TCR molecule of the first aspect of the present invention are as follows:

[0055] αCDR1 - GATAGCGCTATTTACAAC (SEQ ID NO:11)

[0056] αCDR2 - ATTCAGTCAAGTCAGAGAGAG (SEQ ID NO:12)

[0057] αCDR3 - GCTGTCGATACTGGAGGCTTCAAAACTATC (SEQIDNO:13)

[0058] The nucleotide sequences encoding the CDR regions of the β chain of the TCR molecule of the first aspect of the present invention are as follows:

[0059] βCDR1 - ATGAACCATGAGTAT (SEQ ID NO:14)

[0060] βCDR2 - TCAATGAATGTTGAGGTG (SEQ ID NO:15)

[0061] βCDR3 - GCCAGCAGTACCTCCGACGGAAACTATGGCTACACC (SEO ID NO:16)

[0062] Therefore, the nucleotide sequences of the TCR α chain encoded by the nucleic acid molecules provided by the present invention include but are not limited to SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:13; meanwhile, the nucleotide sequences encoding the TCR β chain may include but are not limited to SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16.

[0063] The nucleotide sequence of the nucleic acid molecule can be in single - stranded or double - stranded form, can be either RNA or DNA, and can optionally contain or not contain introns.

[0064] Preferably, the nucleotide sequence of the nucleic acid molecule of the present invention has no intron structure but can effectively encode the polypeptide of the present invention. For example, the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR α chain of the present invention includes SEQ ID NO:1 and / or the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR β chain of the present invention includes SEG ID NO:2. Or, the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR α chain of the present invention includes SEQ ID NO:11 - 13 and / or the nucleotide sequence of the nucleic acid molecule of the present invention encoding the variable domain of the TCR β chain of the present invention includes SEQ ID NO:14 - 16.

[0065] It should be noted that due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Therefore, the nucleic acid sequence encoding the TCR of the present invention can be either exactly the same as the sequence listed in the drawings or its degenerate variant. For example, a "degenerate variant" refers to a nucleic acid molecule that, although different from SEQ ID NO:13 in nucleotide sequence, can still encode the protein sequence shown in SEQ ID NO:1.

[0066] The following specific examples further illustrate the present invention in more detail. For the experimental conditions not specifically described in the examples, conventional experimental methods are used. The experimental materials and reagents involved in the examples can be obtained through commercial channels unless otherwise specifically stated.

[0067] The short peptides QVDYYGLYY and KSAIVTLTY (Jiangsu GenScript Biotechnology Co., Ltd.) were synthesized and renatured with biotin-labeled HLA-A0101 to prepare pMHC haploids. These haploids were combined with PE-labeled streptavidin (BD Company) to form PE-labeled tetramers.

[0068] Freshly excised HPV-positive tumor tissue was cut into 2-4 mm pieces using sterile surgical scissors and forceps and placed in a 24-well plate containing 2 mL of complete T cell culture medium per well and incubated at 37 °C, 5% CO 2 The cells were cultured in an incubator to isolate tumor-infiltrating T lymphocytes (TILs).

[0069] TILs were stained with PE-labeled tetramers, CD8+ and tetramer double-positive cells were screened, and single-cell TCR sequencing was performed. The QVDYYGLYY and KSAIVTLTY tetramer TCR immune profiles were analyzed, and TCR genes that appeared simultaneously in the two immune profiles were screened and cloned.

[0070] A lentiviral vector containing the candidate TCR gene was synthesized, and the specificity of the candidate TCR gene was verified by CCK8 cell activity assay and T cell activation assay. The target cells were COS7-HLA-A0101 cells loaded with QVDYYGLYY or KSAIVTLTY, and the control group was COS7-HLA-A0101 cells without load. The experimental results showed that the candidate TCR gene can specifically recognize COS7-HLA-A0101 cells loaded with QVDYYGLYY or KSAIVTLTY at the same time.

Claims

1. A TCR that recognizes multiple HPV antigen epitopes, characterized in that: The TCR is capable of simultaneously binding to the QVDYYGLYY-HLA-A0101 and KSAIVTLTY-HLA-A0101 complexes, and the TCR comprises a TCR α chain variable region and a TCR β chain variable region, wherein: The amino acid sequences of CDR1, CDR2 and CDR3 in the variable region of the TCRα chain are: αCDR1-DSAIYN (SEQ ID NO: 5) αCDR2-IQSSQRE (SEQ ID NO: 6) αCDR3-CAVDTGGFKTIF (SEQ ID NO:1) The amino acid sequences of the TCRβ chain variable region CDR1, CDR2 and CDR3 are: βCDR1-MNHEY (SEQ ID NO: 8) βCDR2-SMNVEV (SEQ ID NO:9) βCDR3-CASSTSDGNYGYTF (SEQ ID NO: 2).

2. The TCR for recognizing multiple HPV antigen epitopes according to claim 1, characterized in that: The TCR comprises a TCRα chain variable region having an amino acid sequence with at least 90% sequence similarity to SEQ ID NO:18, and a TCRβ chain variable region having an amino acid sequence with at least 90% sequence similarity to SEQ ID NO:

20.

3. The TCR for recognizing multiple HPV antigen epitopes according to claim 1 or 2, characterized in that: The N-terminus or C-terminus of the α-chain and β-chain of its TCR are bound to coupling molecules; The conjugated molecule is a detectable label.

4. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleic acid sequence encoding the TCR molecule according to any one of claims 1 to 3 or its complementary sequence.

5. A carrier, characterized in that The vector contains the nucleic acid molecule according to claim 4; the vector is a lentiviral vector.

6. An isolated host cell, characterized in that The host cell contains the vector according to claim 5, or the exogenous nucleic acid molecule according to claim 4 is integrated into its chromosome.

7. A cell, characterized in that The cell is transduced with the nucleic acid molecule of claim 4 or the vector of claim 5; the cell is a T cell or a stem cell.

8. A pharmaceutical composition, characterized in that Comprising a pharmaceutically acceptable carrier and the TCR described in any one of claims 1 to 3, the nucleic acid molecule described in claim 4, or the cell described in claim 7.

9. The use of the TCR according to claim 1 or the cell according to claim 7, characterized in that: Used for preparing medicine for treating cervical cancer.

Images