Radiation response gene, engineering bacterium, preparation and application thereof

Abstract

The invention discloses a radiation response gene, an engineering bacterium, a preparation and application thereof, and belongs to the technical field of gene engineering and ionizing radiation detection. The invention designs a gene capable of efficiently reporting ionizing radiation, and the gene is transferred into probiotic escherichia coli to construct the radiation response engineering bacterium, so that the safety is ensured, and the radiation response engineering bacterium can express green fluorescent protein after being irradiated by gamma rays, thereby reporting the in-vivo radiation dose. The embodiment of the invention proves that the radiation response engineering bacterium constructed by the invention can report ionizing radiation in the intestinal tract of a mouse, and the ionizing radiation dose can be judged by detecting the fluorescence intensity of excrement. The method has important significance in the field of in-vivo ionizing radiation detection.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering and ionizing radiation detection technology, and more specifically to a radiation response gene, an engineering bacterium, a preparation and the application thereof in in vivo ionizing radiation detection. Background Art

[0002] Ionizing radiation (IR) refers to a type of electromagnetic wave or high-energy particle beam with short wavelength, high frequency and high energy. The energy it carries can free the electrons in atoms or molecules of matter from the nucleus. IR is widely used in medicine, agriculture, wastewater treatment and other fields. However, it is very harmful to organisms. After acting on organisms, it will cause the ionization of molecules in the organism, causing the orderly biochemical reactions in the body to become unbalanced, leading to serious damage to cells, organs and the overall level. Ionizing radiation is highly dangerous, but human vision cannot perceive it, so the detection of ionizing radiation is crucial.

[0003] At present, the detection of IR mainly relies on various types of radiation dosimeters, which can be divided into physical dosimeters and chemical dosimeters according to the working principle. They can measure the type of radiation and radiation dose more accurately, but when used for the exposure dose of organisms, they are only used as an estimation basis and cannot directly reflect the biological dose. They cannot perform radiation detection in vivo and the detection continuity is poor. These shortcomings limit their application in tumor radiotherapy and radiation biological dose assessment of special operation groups. Therefore, the development of a radiation biological detection method that can detect the exposure dose in vivo will be of great significance to the existing radiation detection methods.

[0004] The intestine is one of the main target organs of ionizing radiation, and the body's intestine naturally has about 1015 intestinal flora. Related studies ("The impact of gut microbiota on radiation-induced enteritis", Jian YP et al., 2021, 11: 586392; "Alterations of the gut microbiome compositionand lipid metabolic profile in radiation enteritis", Li YYet al., Front Cell Infect Microbiol, 2020, 10: 541178) found that the intestinal flora can be used as a marker of radiation-induced intestinal damage, which provides a starting point for detecting human radiation doses using intestinal bacteria as a chassis. Therefore, how to develop a gene that responds to radiation and construct an engineered bacterium that can respond to radiation in vivo is of great significance to those skilled in the art. Summary of the invention

[0005] In view of the above problems, the present invention designs a gene that efficiently reports ionizing radiation and applies it to ionizing radiation detection, thereby achieving the purpose of efficiently reporting ionizing radiation in vivo.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A radiation response gene is used in the detection of ionizing radiation in vivo, and the nucleotide sequence of the radiation response gene is shown in SEQ ID NO:1.

[0008] Another object of the present invention is to provide a radiation-responsive recombinant plasmid, comprising the radiation-responsive gene and the pRAR074-control-sfGFP plasmid.

[0009] Another object of the present invention is to provide a method for constructing a radiation-responsive recombinant plasmid, comprising the following steps:

[0010] (1) designing specific primers according to the nucleotide sequence shown in SEQ ID NO: 1, and performing gradient annealing phosphorylation reaction on the radiation-responsive gene fragment to obtain a phosphorylated product;

[0011] (2) PCR amplification of the pRAR074-control-sfGFP plasmid was performed, and the amplified product was purified and then double-digested with KpnI-HF and HindIII-HF. The target fragment was recovered by gel extraction to obtain the vector backbone fragment;

[0012] (3) The phosphorylated product obtained in (1) and the vector backbone fragment obtained in (2) are connected, and the connected product is transformed into competent Escherichia coli, positive clones are screened, and plasmids are extracted and sequenced for verification. The correct one is the radiation-responsive recombinant plasmid.

[0013] Preferably, the specific primers described in step (1) include:

[0014] Upstream primer

[0015] pJ23119-SOSBOX-F:5'-TTGACAGCTTATCATCGATTTGACAGCTAG

[0016] CTCAGTCCTAGGTAT-3', SEQ ID NO: 2;

[0017] Downstream primer

[0018] pJ23119-SOSBOX-R: 5'-CCAAAACAGCCAAGCTTTTATTTGTAGAGC

[0019] TCATCCATGCCAT-3', SEQ ID NO: 3.

[0020] Preferably, step (1) the gradient annealing phosphorylation reaction comprises the following steps:

[0021] a. Primer gradient annealing

[0022] Prepare a primer annealing system, maintain at 95°C for 3 min, then decrease from 95°C to 25°C at a rate of 1°C / 20s to obtain annealing products;

[0023] b. Phosphorylation of annealing products

[0024] The phosphorylation reaction system was prepared and incubated at 37°C for 30 min to obtain the phosphorylated product.

[0025] Preferably, the primer annealing system described in step (1) a is: 14 μL of ddH2O, 2 μL of 10×T4 Polynucleotide Kinase Buffer, and 2 μL of each of the upstream and downstream primers with a concentration of 100 μM;

[0026] Preferably, the phosphorylation reaction system described in step (1) b: ddH2O 13 μL, 5×T4 ligase Buffer (containing 10 mM ATP) 4 μL, primer annealing product 2 μL, T4 Polynucleotide Kinase 1 μL.

[0027] Preferably, the PCR amplification primers for the pRAR074-control-sfGFP plasmid in step (2) include: upstream primer PF: 5'-AAGCTTGGCTGTTTTGGCGGAT-3', SEQ ID NO.4; downstream primer PR: 5'-ATCGATGATAAGCTGTCAAACATGAGC-3', SEQ ID NO.5.

[0028] Preferably, the PCR amplification system of the pRAR074-control-sfGFP plasmid in step (2) is: 4 μL of 5×Q5 reaction buffer, 0.4 μL of 10 mM dNTP, 1 μL of each 10 μM upstream and downstream primers, 0.4 μL of DNA template, 0.4 μL of Q5 DNA polymerase, and ddH2O supplemented to 20 μL.

[0029] Preferably, the PCR amplification program of the pRAR074-control-sfGFP plasmid in step (2) is: 98°C 30s; 98°C 10s, 64°C 30s, 72°C 20s, 35 cycles; 72°C 120s.

[0030] Preferably, the ligation system in step (3) is: 1 μL of phosphorylated product, 1.5 μL of backbone vector fragment, 2 μL of 5×T4 ligase Buffer (containing 10 mM ATP), 1 μL of T4 ligase, and 5.5 μL of ddH2O.

[0031] Preferably, the connection condition in step (3) is: standing in an incubator at 37°C for 6 hours.

[0032] Another object of the present invention is to provide a radiation-responsive engineered bacterium comprising the above-mentioned radiation-responsive recombinant plasmid.

[0033] Preferably, the radiation-responsive engineered bacteria further comprise probiotic Escherichia coli.

[0034] More preferably, the probiotic Escherichia coli Nissle 1917.

[0035] Another object of the present invention is to provide a method for constructing radiation-responsive engineered bacteria, which is obtained by transforming the above-mentioned radiation-responsive recombinant plasmid into probiotic Escherichia coli, screening positive clones, and sequencing verification.

[0036] Another object of the present invention is to provide a radiation-responsive preparation, which comprises the above-mentioned radiation-responsive engineered bacteria.

[0037] Specifically, the dosage form of the preparation includes solution, suspension, emulsion, bacterial preparation, granule, tablet or capsule.

[0038] Another object of the present invention is to provide the use of the above-mentioned radiation-responsive engineered bacteria or radiation-responsive preparation in in vivo ionizing radiation detection.

[0039] Through the above technical solutions, it can be known that the present invention discloses a radiation response gene, and transfers it into probiotic Escherichia coli to construct radiation response engineering bacteria, which not only ensures safety, but also enables it to express green fluorescent protein after being irradiated with gamma rays, thereby reporting the radiation dose in the body. According to experimental results, it is found that the radiation response engineering bacteria constructed by the present invention can report ionizing radiation in the intestine of mice, and judge the ionizing radiation dose by detecting the fluorescence intensity of feces. This is of great significance in the field of in vivo ionizing radiation detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 :The electrophoresis of 3945bp vector backbone DNA fragment, M: DNA marker (1kb), 1: vector backbone DNA fragment;

[0041] Figure 2: Results of the transformation of the radiation-responsive recombinant plasmid pJ23119-SOSBOX-sfGFP into probiotic Escherichia coli Nissle 1917, a: negative control, b: positive single clone;

[0042] Figure 3 : The relationship between the fluorescence response intensity of each group of bacterial solution and the radiation dose and recovery time under the radiation dose gradient, A: When the radiation dose is constant, the curve diagram of the fluorescence response intensity of each group of bacterial solution changes with time, B: When the fluorescence response intensity of each group of bacterial solution changes with the radiation dose under the same recovery time;

[0043] Figure 4 : Fluorescence response intensity of each bacterial solution after 6 hours of recovery under different irradiation doses, control group: wild type EcN, *** represents P﹤0.001;

[0044] Figure 5 : The fluorescence response intensity of the bacterial solution of each group at different recovery times after irradiation with a dose of 50 Gy, non-irradiated group: wild-type EcN (control group), irradiated group: engineered bacteria constructed by the present invention, *** represents P < 0.001;

[0045] Figure 6 :The imaging results of bacteria in each group in the mouse intestine under 12Gy irradiation dose;

[0046] Figure 7 : Imaging results and analysis of bacteria in mouse feces in each group under 12Gy irradiation dose, where A: imaging results in feces;

[0047] B: Fecal fluorescence intensity analysis, control group: wild-type EcN, engineered bacteria: radiation-responsive engineered strain, (-): non-irradiated group, (+): irradiated group, ** represents P﹤0.01. DETAILED DESCRIPTION

[0048] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0049] The reagents involved in the embodiments of the present invention are all purchased from commercial channels, and the methods not mentioned are conventional experimental methods and will not be described in detail here.

[0050] The following is an example description:

[0051] Plasmid pRAR074-control-sfGFP (plasmid number: #185032) was purchased from Add Gene platform;

[0052] Competent Escherichia coli DH5α was purchased from Beijing Bomade Biotechnology Co., Ltd.;

[0053] LB liquid medium was purchased from Beijing Solebow Biotechnology Co., Ltd.;

[0054] Escherichia coli Nissle 1917 was purchased from Beina Biotechnology.

[0055] Example 1 Construction of radiation-responsive recombinant plasmid pJ23119-SOSBOX-sfGFP

[0056] (1) Cloning of radiation-responsive genes

[0057] According to the nucleotide sequence shown in SEQ ID NO.1, primers shown in Table 1 were designed.

[0058]

[0059] The gene fragment shown in SEQ ID NO.1 (synthesized by Suzhou Genewise Biotechnology Co., Ltd.) was used as a DNA template, and the primers in Table 1 were used to form a double-stranded DNA fragment (93 bp) of complementary pairing by gradient annealing and phosphorylation. The operation process is as follows:

[0060] a. Primer gradient annealing: prepare primer annealing system: 14 μL ddH2O, 2 μL 10×T4 Polynucleotide Kinase Buffer, 2 μL each of upstream and downstream primers with a concentration of 100 μM; maintain the primer annealing system at 95°C for 3 min, then reduce the temperature from 95°C to 25°C at a rate of 1°C / 20s to obtain annealing products.

[0061] b. Phosphorylation of annealing products: Prepare phosphorylation reaction system: ddH2O 13μL, 5×T4 ligase Buffer (containing 10mM ATP) 4μL, primer annealing product 2μL, T4 Polynucleotide Kinase 1μL. After preparation, place it in a 37℃ incubator for 30min to obtain the phosphorylated product.

[0062] (2) Obtaining vector backbone fragments

[0063] Plasmid pRAR074-control-sfGFP was used as a DNA template, and PF (AAGCTTGGCTGTTTTGGCGGAT, SEQ ID NO.4) and PR (ATCGATGATAAGCTGTCAAACATGAGC, SEQ ID NO.5) were used as primers for PCR amplification. The PCR amplification system was: 4 μL of 5×Q5 reaction buffer, 0.4 μL of 10 mM dNTP, 1 μL of each 10 μM upstream and downstream primers, 0.4 μL of DNA template, 0.4 μL of Q5 DNA polymerase, and ddH2O was added to 20 μL. The PCR amplification program was: 98°C for 30 s; 98°C for 10 s, 64°C for 30 s, 72°C for 20 s, 35 cycles; 72°C for 120 s. The PCR product was detected by agarose gel electrophoresis. Figure 1 As shown, the target fragment size is 3945 bp, which is the vector backbone DNA fragment.

[0064] The PCR product was purified using a DNA purification kit (Zymo Research), and the purified DNA fragment was double-digested using KpnI-HF and HindIII-HF. The double-digestion system was: KpnI-HF 1μL, HindIII-HF 1μL, 10×rCutSmart buffer 5μL, purified DNA fragment 1μg, ddH2O supplemented to 50μL. After standing in a 37°C incubator for 6 hours, the target fragment was recovered using a gel recovery kit (Zymo Research), and the concentration was measured to be 83.6ng / μL, thus obtaining the vector backbone fragment.

[0065] (3) Construction of recombinant plasmid

[0066] The phosphorylated product obtained in (1) and the vector backbone fragment obtained in (2) were incubated at 25°C for 3 h for ligation. The ligation system was as follows: 1 μL phosphorylated product, 1.5 μL backbone vector fragment, 2 μL 5×T4 ligase Buffer (containing 10 mM ATP), 1 μL T4 ligase, and 5.5 μL ddH2O.

[0067] According to the instructions of the competent Escherichia coli DH5α (Beijing Bomade Biotechnology Co., Ltd.), the above-mentioned ligation product was chemically transformed into competent Escherichia coli DH5α, spread on LB solid culture medium plates containing 50g / mL chloramphenicol and cultured at 37°C overnight, and positive clones were picked for gene sequencing. The radiation response gene sequence shown in SEQ ID NO.1 was correct.

[0068] The clones with correct sequencing were selected for expansion culture, and the plasmid was extracted using a plasmid extraction kit (Omega). The nucleotide sequence of the plasmid was measured as shown in SEQ ID NO.6, which contained the nucleotide sequence shown in SEQ ID NO.1, proving that the radiation-responsive recombinant plasmid was successfully constructed and named pJ23119-SOSBOX-sfGFP.

[0069] Example 2 Construction of radiation-responsive engineered bacteria

[0070] Based on the radiation-responsive recombinant plasmid pJ23119-SOSBOX-sfGFP obtained in Example 1, the probiotic Escherichia coli Nissle 1917 (abbreviated as EcN) was used as the host bacteria to construct an orally administrable radiation-responsive intestinal engineered bacteria. The specific operation is as follows:

[0071] (1) Preparation of electroporation competent cells

[0072] Take EcN and streak it on the LB plate, invert and culture it at 37℃ for 12h, pick a single colony and inoculate it into 30mL LB liquid culture medium, and culture it on a shaking platform at 37℃ and 220r / min until OD600 is between 0.3-0.5. After standing on ice for 10min, centrifuge it at 4℃ and 4000×g for 10min, discard the supernatant, add 20mL of 10% sterile glycerol solution precooled on ice to gently resuspend the bacteria; repeat the centrifugation, discard the supernatant and resuspend the bacteria twice under the above conditions, where the amount of precooled 10% sterile glycerol solution added is 20mL and 1-2mL respectively, and the bacteria resuspended for the last time are dispensed into 1.5mL centrifuge tubes, 100μL per tube, to obtain the electroporation competent bacterial solution, which is stored in a -80℃ refrigerator for use (need to be thawed on ice in advance when used).

[0073] (2) Electroconversion

[0074] Take 100 μL of the electroporation competent bacterial solution obtained in (1) and add it to the electroporation cup (pre-cooled), and add 5 μL of the radiation-responsive recombinant plasmid pJ23119-SOSBOX-sfGFP at a concentration of 200 ng / μL. After gently pipetting and mixing, let stand on ice for 10 mL, and transfer to the gene transfer instrument for instant electroporation to achieve electroporation. The specific conditions are: voltage 2500 V, capacitance 25 μF, and resistance 200 Ω.

[0075] (3) Monoclonal screening

[0076] Transfer the transformed bacterial liquid to a sterile EP tube (specification 1.5 mL), add 0.5 mL of LB liquid culture medium (preheated in a 37°C water bath), culture in a shaking incubator at 37°C and 220 r / min for 1.5 h, centrifuge at 4000×g for 10 min, discard most of the supernatant, retain about 50 μL of liquid, mix by pipetting, and spread on an LB solid culture medium plate containing 50 μg / mL chloramphenicol.

[0077] Place the above culture plate upside down in a 37°C incubator for overnight static culture, and pick out the positive single clones (such as Figure 2 b) in the figure is an orally administrable radiation-responsive engineered probiotic strain.

[0078] Example 3 Testing the response ability of radiation-responsive engineered bacteria to gamma rays in vitro

[0079] Use 50 µg mL -1 The radiation-responsive engineered bacteria obtained in Example 2 were cultured in a chloramphenicol LB liquid medium at 37°C in a shaking incubator for 12 hours, and then packaged and heated to 467.36 cGy·min -1 The irradiation dose rate was 0, 10, 20, 30, 40, 50, and 60 Gy, and 200 μL of bacterial solution was added to a black transparent bottom 96-well plate after irradiation. Each irradiation dose gradient had 12 wells. The fluorescence intensity and OD600 of the bacterial solution in each well were detected by a multifunctional microplate reader at 0, 1, 2, 3, 4, 5, 6, 7, 8, and 9 h after irradiation (i.e., recovery time). The excitation wavelength was 485 nm and the emission wavelength was 535 nm when detecting fluorescence. The cells were shaken for 5 s before each detection. The cells were incubated at 37 °C during non-detection time. Unirradiated wild EcN was taken as a control and recorded as the non-irradiated group.

[0080] Under the above-mentioned radiation dose gradient, when the radiation dose is constant, the curve diagram of the fluorescence response intensity of each group of bacterial liquid changing with time is as follows: Figure 3 As shown in A; Under the same recovery time, the curve diagram of the fluorescence response intensity of each group of bacterial liquid changes with the irradiation dose, as shown in Figure 3 B. It can be seen that the engineered probiotics constructed in the present invention can produce an obvious fluorescence response to ionizing radiation, and has a dose-dependency, that is, within the irradiation dose range of 10Gy-60Gy, the fluorescence intensity increases with the increase of the irradiation dose.

[0081] like Figure 4 The fluorescence response intensity of each bacterial solution after 6 hours of recovery under different irradiation doses is shown in the figure. It can be seen that after 6 hours of recovery, when the irradiation dose is 10Gy, the engineered bacteria constructed by the present invention can produce a fluorescence response that is significantly (P﹤0.001) stronger than that of the control group (wild-type EcN). Figure 5As shown in the figure, the fluorescence response intensity of each group of bacterial liquid at different recovery times after irradiation with a 50Gy irradiation dose shows that after 1 hour of recovery, the irradiated group can produce a fluorescence response that is significantly (P﹤0.001) stronger than that of the non-irradiated group (wild-type EcN), indicating that the engineered bacteria constructed by the present invention have a faster response speed.

[0082] Example 4 Detection of the response ability of radiation-responsive engineered bacteria to gamma rays

[0083] use 60 The in vivo application performance of engineered probiotics was tested by local irradiation of mouse intestine with Co gamma rays. The process is as follows:

[0084] (1) The experimental groups were divided into negative control non-irradiated group, negative control irradiated group, engineered bacteria non-irradiated group, and engineered bacteria irradiated group. Each group consisted of 3 C57BL / 6J mice (male, 6-8 weeks old, 18-22g). After all experimental animals were adaptively raised for 3 days, each group was subjected to the following operations:

[0085] Negative control group: wild EcN (bacterial content 10 9 CFU / mL) was administered orally to each mouse at a dose of 200 mL / mouse without irradiation;

[0086] Negative control irradiation group: wild-type EcN (10 9 CFU / mL) was administered orally to each mouse at a dose of 200 mL / mouse, and then irradiated;

[0087] Engineering bacteria non-irradiated group: engineering bacteria (bacterial content 10 9 CFU / mL, the preparation method is the same as Example 2) administered orally to each mouse, the oral dose is 200 mL / mouse, and no irradiation is performed;

[0088] Engineering bacteria irradiation group: engineering bacteria (bacterial content 10 9 CFU / mL, the preparation method is the same as Example 2) administered intragastrically to each mouse, the intragastrically dose is 200 mL / mouse, and irradiated;

[0089] The irradiated mice were anesthetized with isoflurane using a gas anesthesia machine 30 minutes after gavage. After anesthesia for 10 minutes, the mice were fixed, partially shielded with lead bricks, and the entire abdomen was irradiated from the pubic bone to the xiphoid process. 60 A single Co γ-ray abdominal irradiation was performed with a dose of 12 Gy and a dose rate of 72.24 cGy / min.

[0090] (2) Intestinal tissues of mice in each group were taken 8 hours after gavage for in vivo imaging observation. The ROI area was divided using the in vivo imaging software AniView and the average signal intensity was calculated. The results are shown in Figure 6 .Depend on Figure 6 It can be seen that the engineered bacteria constructed by the present invention can produce an obvious fluorescent response to ionizing radiation in the intestine. There is no visible fluorescence in the intestines of the negative control non-irradiated group and the negative control irradiated group. The fluorescence signal intensity in the intestine of the engineered bacteria irradiated group is significantly stronger than that of the engineered bacteria non-irradiated group.

[0091] (3) Feces of mice in each group 10 hours after gavage were homogenized, filtered with a 5 μm sterile filter, centrifuged at 4000 × g for 5 min, resuspended in 1 mL sterile phosphate buffer, and transferred to a black transparent bottom 96-well plate. Fluorescence intensity and OD600 were detected using a multifunctional microplate reader. The excitation wavelength for fluorescence detection was 485 nm and the emission wavelength was 535 nm. Shake for 5 s before each detection. The results are shown in Table 1. Figure 7 .Depend on Figure 7 It can be seen that there is no visible fluorescence in the feces of the negative control non-irradiated group and the negative control irradiated group, and the fluorescence signal intensity in the feces of the engineered bacteria irradiated group is significantly stronger than that of the engineered bacteria non-irradiated group.

[0092] In summary, the radiation-responsive engineered bacteria constructed in the present invention can be used in vivo for non-invasive detection of intestinal ionizing radiation.

[0093] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0094] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A radiation response gene for use in in vivo ionizing radiation detection, characterized in that: The nucleotide sequence of the radiation-responsive gene is shown in SEQ ID NO:

1.

2. A radiation-responsive recombinant plasmid, characterized in that: It comprises the radiation response gene according to claim 1 and the pRAR074-control-sfGFP plasmid.

3. A method for constructing a radiation-responsive recombinant plasmid, characterized in that: The following steps are involved: (1) designing specific primers according to the nucleotide sequence shown in SEQ ID NO: 1, and performing gradient annealing phosphorylation reaction on the radiation-responsive gene fragment of claim 1 to obtain a phosphorylated product; (2) PCR amplification of the pRAR074-control-sfGFP plasmid was performed, and the amplified product was purified and then double-digested with KpnI-HF and HindIII-HF. The target fragment was recovered by gel extraction to obtain the vector backbone fragment; (3) The phosphorylated product obtained in (1) and the vector backbone fragment obtained in (2) are connected, and the connected product is transformed into competent Escherichia coli, positive clones are screened, and plasmids are extracted and sequenced for verification. The correct one is the radiation-responsive recombinant plasmid.

4. The method for constructing a recombinant plasmid according to claim 3, characterized in that: The specific primers described in step (1) include: Upstream primer pJ23119-SOSBOX-F: 5'-TTGACAGCTTATCATCGATTTGACAGCTAGCT CAGTCCTAGGTAT-3', SEQ ID NO: 2; Downstream primer pJ23119-SOSBOX-R: 5'-CCAAAACAGCCAAGCTTTTATTTGTAGAGCTC ATCCATGCCAT-3', SEQ ID NO:

3.

5. A radiation-responsive engineered bacterium, characterized in that: The invention comprises the radiation-responsive recombinant plasmid described in claim 2 or the radiation-responsive recombinant plasmid obtained by the construction method described in any one of claims 3-4.

6. The radiation-responsive engineered bacteria according to claim 5, characterized in that: Also contains probiotic E. coli.

7. A method for constructing radiation-responsive engineered bacteria, characterized in that: The engineered bacteria is obtained by transforming the radiation-responsive recombinant plasmid described in claim 2 or the radiation-responsive recombinant plasmid obtained by the construction method of any one of claims 3-4 into the probiotic Escherichia coli described in claim 6, screening positive clones, and sequencing verification.

8. Use of the radiation-responsive engineered bacteria according to any one of claims 5-6 or the radiation-responsive engineered bacteria obtained by the construction method according to claim 7 in the preparation of radiation-responsive preparations.

9. A radiation-responsive preparation, characterized in that It comprises the radiation-responsive engineered bacteria described in any one of claims 5-6 or the radiation-responsive engineered bacteria obtained by the construction method described in claim 7.

10. Use of the radiation-responsive engineered bacteria according to any one of claims 5-6, the radiation-responsive engineered bacteria obtained by the construction method according to claim 7, or the radiation-responsive preparation according to claim 9 in in vivo ionizing radiation detection.

Images