Specific primer and probe for detecting beta hemolytic streptococcus

Abstract

The invention discloses a specific primer and a probe for detecting beta-hemolytic streptococcus, and relates to the technical field of biological strain detection, and the specific primer and the probe are technically characterized in that the beta-hemolytic streptococcus is anaerobically cultured by using improved tryptone soybean enrichment broth and Columbia CNA blood agar; the beta-hemolytic streptococcus in the textile raw materials is identified by combining a real-time fluorescent PCR technology, and compared with conventional PCR technology identification, the detection efficiency of the beta-hemolytic streptococcus in the textile raw materials is improved through fluorescent PCR technology identification, and the rapid customs clearance requirement of the textile raw materials is met.

Description

Technical Field

[0001] The invention relates to the technical field of biological strain detection, and in particular to specific primers and probes for detecting beta-hemolytic streptococci. Background Art

[0002] Textile raw materials are important raw materials for textile, chemical, pulp and paper, and military industries. With the acceleration of economic globalization and the deepening development of my country's opening up to the outside world, the demand for domestic and imported textile raw materials in my country is increasing, and the risk of biological harm to humans is also increasing year by year. Textile raw materials contain a large amount of carbon that can be used by microorganisms. Under suitable conditions, some microorganisms can use this carbon source to maintain their growth. Foreign studies have shown that microorganisms parasitic on textiles can penetrate textiles and cause deep contamination, which may eventually lead to the spread of pathogens over a large area.

[0003] At present, most textile raw materials only rely on adding antimicrobial agents and preservatives to inhibit the proliferation of carried microorganisms, and cannot completely and effectively kill microorganisms. Therefore, textile raw materials have great biosafety risks. After checking the information and investigation, contaminated textile raw materials may carry hemolytic streptococci with strong infectiousness and pathogenicity. Hemolytic streptococci, also known as sapellin, belong to the gram-positive bacteria of the Streptococcus genus of the Streptococcus family. Hemolytic streptococci are widely distributed in nature and exist in water, air, dust, feces, and the oral cavity, nasal cavity, and throat of healthy people and animals. They can be transmitted through direct contact, air droplets, or through skin and mucous membrane wounds. They can often cause suppurative inflammation of the skin and subcutaneous tissue, respiratory tract infections, outbreaks of epidemic pharyngitis, and allergic reactions such as neonatal sepsis, bacterial endocarditis, scarlet fever and rheumatic fever, and glomerulonephritis.

[0004] According to whether streptococci are hemolytic after growing and multiplying on blood culture medium and their hemolytic properties, they are divided into three categories: α-hemolytic streptococcus, β-hemolytic streptococcus, and γ-hemolytic streptococcus. The bacteria are generally not very resistant and are killed at 60℃ for 30 minutes. They are sensitive to common disinfectants. The bacteria can form grayish white, translucent, smooth, neatly edged, and 0.5-0.75mm diameter small colonies on the blood plate. They decompose glucose and produce acid but not gas. If an inhibition zone appears in the bacitracin sensitivity test, it is positive. The above phenomenon can be used as a basis for judging the presence of hemolytic streptococci in the sample, and the target bacteria in the sample can be identified by molecular biological methods.

[0005] In order to improve the detection efficiency of beta-hemolytic streptococcus in textile raw materials, the present invention provides specific primers and probes for detecting beta-hemolytic streptococcus. Summary of the invention

[0006] The purpose of the present invention is to solve the above problems and provide specific primers and probes for detecting β-hemolytic streptococci. The present invention utilizes improved tryptone soy enrichment broth and Columbia CNA blood agar to anaerobic culture β-hemolytic streptococci, and combines real-time fluorescence PCR technology to identify β-hemolytic streptococci in textile raw materials. Compared with conventional PCR technology identification, fluorescence PCR technology identification improves the detection efficiency of β-hemolytic streptococci in textile raw materials and meets the requirements for rapid customs clearance of textile raw materials.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows:

[0008] The present invention provides specific primers and probes for detecting beta-hemolytic streptococci, wherein the probe sequence is: 5"FAM-CGAAAAGATGGCAACTCCGCT-3"TAMRA;

[0009] The specific primers include an upstream primer and a downstream primer;

[0010] The upstream primer sequence: 5′AGTGAAGGATCTGGGGTCAT 3′;

[0011] The downstream primer sequence: 5′AGCTCCGTCGATAACATGGT 3′.

[0012] The specific primers and probes are used for detecting beta-hemolytic streptococci.

[0013] Compared with the prior art, this solution has the following beneficial effects:

[0014] The fluorescent PCR technology identification provided by the present invention improves the detection efficiency of beta-hemolytic streptococci in textile raw materials and can meet the requirements for rapid customs clearance of textile raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the electrophoresis diagram of the primer concentration optimization test in the embodiment of the present invention;

[0016] Figure 2 Schematic diagram of electrophoresis results of annealing temperature optimization test in an embodiment of the present invention;

[0017] Figure 3 Schematic diagram of electrophoresis results of specificity test in an embodiment of the present invention;

[0018] Figure 4 This is the electrophoresis diagram of the sensitivity test in the embodiment of the present invention;

[0019] Figure 5 is an amplification curve diagram at various final concentrations of fluorescent PCR primers and probes in the embodiment of the present invention;

[0020] Figure 6 is a fluorescence PCR specific test amplification curve diagram in an embodiment of the present invention;

[0021] Figure 7 It is an amplification curve diagram of 6 dilutions in the embodiment of the present invention. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0023] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0024] Embodiment 1:

[0025] The present invention utilizes a culture medium to cultivate beta-hemolytic streptococci, and utilizes a fluorescent PCR technique to identify the beta-hemolytic streptococci in the culture medium in textile raw materials. Compared with conventional PCR technique identification, the fluorescent PCR technique identification improves the detection efficiency of beta-hemolytic streptococci in textile raw materials, and meets the requirements for rapid customs clearance of textile raw materials.

[0026] The culture medium includes modified tryptone soy broth (mTSB), Columbia CAN blood agar, Columbia blood agar, KF streptococcal agar, tryptone soy broth (TSB), Gram staining solution, 3% hydrogen peroxide solution, and VITEK2 Gram-positive bacteria identification card.

[0027] A set of PCR specific primers and a set of specific fluorescent dual-labeled probes were designed based on the conserved genes of β-hemolytic streptococci, and the binding sites of the probes were all located inside the target amplified fragment. The 5' end was labeled with FAM fluorescein as a reporter fluorescent group (indicated by R), and the 3' end was labeled with TAMRA fluorescein as a quencher fluorescent group (indicated by Q).

[0028] Embodiment 2:

[0029] 1. Experimental Materials

[0030] 1.1 Test materials

[0031] Samples of sheep wool, goat wool, cotton, cotton linter, silk, cocoons, cotton yarn, coarse wool, and animal fur were collected, and all samples were uniformly cleaned, air-dried, and sterilized under high pressure before use.

[0032] 1.2 Strains

[0033] The standard strains and isolated strains used in this validation test are shown in Table 1.

[0034] Table 1 Standard strains and isolated strains tested

[0035]

[0036]

[0037] 1.3 Main reagents and instruments

[0038] Sterile homogenization bags, microcentrifuge tubes, disposable inoculation loops, nutrient broth, modified tryptone soy broth (mTSB), Columbia CNA blood agar and other culture media were purchased from Beijing Luqiao Technology Co., Ltd., and DNA extraction kits, 10× PCR reaction buffer, 50× TAE electrophoresis buffer, agarose, DNA Marker (2000 bp), primers and other molecular biology reagents were purchased from Tiangen Biochemical Technology Co., Ltd.

[0039] Biological safety cabinet, electronic balance, slapping homogenizer, vortex oscillator, pipette, constant temperature incubator, anaerobic culture device, high-speed refrigerated centrifuge, PCR instrument, fluorescence quantitative PCR instrument, electrophoresis instrument, electrophoresis tank and gel preparation device, gel imager.

[0040] 2. Experimental Methods

[0041] 2.1 Preparation of bacterial culture

[0042] Take 17 strains in Table 1 and inoculate them into 100 mL nutrient broth for resuscitation, number them from 1 to 17, and dilute each bacterial solution to 10 -4 spare.

[0043] 2.2 Preparation of artificially contaminated samples

[0044] 45 samples were taken from the collected samples, including: 6 samples of sheep wool, 6 samples of goat wool, 6 samples of cotton, 6 samples of cotton linters, 6 samples of silk, 6 samples of cocoons, 2 samples of cotton yarn, 5 samples of coarse flower hair, and 2 samples of animal fur, totaling 30 samples; negative samples: 2 samples of sheep wool, 2 samples of goat wool, 2 samples of cotton, 2 samples of cotton linters, 2 samples of silk, 2 samples of cocoons, 1 sample of cotton yarn, 1 sample of coarse flower hair, and 1 sample of animal fur, totaling 15 samples.

[0045] Aseptically weigh 10 g of each sample and put it into a sterile sampling bag. Prepare two copies of each sample in parallel. Dilute the prepared strain solution to 10-4 Artificially contaminate the prepared samples by adding 1 mL to each sample. Place in a 36°C incubator for 24 hours, inoculate onto Columbia blood agar plates, and incubate anaerobically at 36°C for 24 hours.

[0046] 2.3 DNA extraction

[0047] DNA was extracted from the colonies on the Columbia blood agar plate. Total DNA was extracted according to the instructions of the DNA extraction kit, and the obtained DNA was stored in a -20°C refrigerator.

[0048] 2.4 Validation of conventional PCR method

[0049] 2.4.1 Primers and probes

[0050] The primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd. The primer and probe sequences are shown in Table 2.

[0051] Table 2 Primers and probes for β-hemolytic Streptococcus

[0052]

[0053] 2.4.2 Optimization of detection system

[0054] 2.4.2.1 Primer concentration optimization

[0055] The primers for the reaction system were adjusted as shown in Table 3. PCR amplification was performed according to the reaction parameters in Table 4. The total system was 25 μL, and the total volume was made up with sterile double distilled water.

[0056] Table 3 The corresponding amount of primers and probes at different final concentrations in the system

[0057]

[0058] Table 4 Reaction system

[0059]

[0060] 2.4.2.2 Annealing extension temperature optimization

[0061] The target gene was amplified at 53.8℃, 54.4℃, 55.5℃, 56.0℃, 56.6℃, 57.1℃, 57.7℃, and 58.2℃ as annealing temperatures. The program was set as follows: pre-denaturation at 94℃ for 5min; denaturation at 94℃ for 40s; annealing at X℃ for 30s; extension at 72℃ for 1min; 35 cycles; extension at 72℃ for 10min.

[0062] 2.5 Validation of the fluorescent PCR method

[0063] 2.5.1 Optimization of the detection system

[0064] 2.5.1.1 Primer and probe concentration optimization

[0065] The amount of primers and probes in the reaction system was adjusted as shown in Table 5. The total system was 25 μL. Sterile double distilled water was used to make up the total volume. PCR amplification was performed according to the reaction parameters in 2.4.2.1.

[0066] Table 5 The corresponding amount of primers and probes at different final concentrations in the system

[0067]

[0068] 2.5.1.2 Annealing extension temperature optimization

[0069] The amplification annealing extension temperatures were set to 56°C, 58°C, 60°C, 62°C, and 64°C, respectively, and other reaction parameters remained unchanged, and PCR amplifications were performed respectively.

[0070] 3. Results

[0071] 3.1 Optimization of conventional PCR detection system

[0072] 3.1.1 Optimal Primer Concentration

[0073] Take 15 negative samples and 30 artificially contaminated samples for PCR amplification. Figure 1 The electrophoresis results show that when the primer concentration is 0.2μmol / L, the amplification curve is not obvious; when the primer concentration is 1.0μmol / L, due to the high primer concentration, amplification is inhibited, the amount of amplified products is reduced, and the plateau phase is reached later; when the primer and probe concentrations are 0.4μmol / L, 0.6μmol / L, and 0.8μmol / L, the amplification effect is better, the electrophoresis bands are brighter, and the amplification efficiency is better. Therefore, the primer concentration is selected to be 0.4μmol / L, that is, the amount of primer added to the system is 1.0μL.

[0074] 3.1.2 Optimum annealing temperature

[0075] The target gene was amplified at 53.8°C, 54.4°C, 55.5°C, 56.0°C, 56.6°C, 57.1°C, 57.7°C, and 58.2°C as the annealing temperature. Figure 2 As shown in the figure, when the PCR reaction is at 56℃ annealing temperature, the target band is the clearest and brightest, and the amplification result is good. Therefore, 56℃ is selected as the PCR annealing temperature.

[0076] 3.2 Conventional PCR specificity test

[0077] Depend on Figure 3It can be seen that this method effectively detected 30 samples containing artificial contamination of β-hemolytic Streptococcus extracted from the above 45 samples, and the detection results were consistent with the target results, while the extracted negative samples could not be effectively amplified, indicating that the established method has good specificity in detecting β-hemolytic Streptococcus.

[0078] 3.3 Conventional PCR sensitivity test

[0079] The extracted DNA stock solution was selected to 10-6 for a total of 6 dilutions, and the extracted DNA was amplified by PCR, and each dilution was tested twice in parallel. Figure 4 , dilution less than 10 -3 When the dilution is greater than 10 -3 When the amplification is not obvious, no visible amplification band can be produced, and the result is negative.

[0080] The sample DNA extraction solution was tested by UV spectrophotometer, and the concentration was 85.23ng / μL. Therefore, this method is effective for DNA with a concentration greater than 85.23×10 -3 ng / μL, β-hemolytic streptococcal DNA can be effectively detected.

[0081] 3.4 Optimization of fluorescence PCR detection system

[0082] 3.4.1 Optimal concentration of primers and probes

[0083] Depend on Figure 5 It can be seen from the amplification curve that when the concentration of primers and probes is 0.2μmol / L, the amplification curve is not obvious; when the concentration of primers and probes is 1.0μmol / L, the amplification is inhibited due to the high primer concentration; when the concentration of primers and probes is 0.4μmol / L, the amplification curve shows an obvious S-shape, and the amplification efficiency meets the requirements. Considering the reagent saving and amplification efficiency, the concentration of primers and probes in the PCR reaction system of this test was selected to be 0.4μmol / L, that is, the amount of primers and probes added to the system was 1.0μL.

[0084] 3.4.2 Optimum annealing temperature

[0085] As can be seen from Table 6, the amplification efficiency varies greatly at different annealing extension temperatures. If the annealing temperature is too low, nonspecific amplification may occur, thereby increasing the risk of false positives. If the annealing temperature is too high, the primer binding efficiency will be reduced, resulting in amplification. In this experiment, when other conditions remain unchanged, when the annealing extension temperature is close to 60°C, the Ct value is the smallest, the amplification curve is the most complete, the amplification efficiency is the highest overall, and it is more stable. Therefore, 60°C is selected as the annealing extension temperature.

[0086] Table 6 Fluorescence quantitative PCR test results at different annealing temperatures

[0087]

[0088]

[0089] 3.5 Fluorescence PCR specificity test

[0090] This method was effective in detecting 30 samples containing β-hemolytic Streptococcus out of 45 samples, and the detection results were consistent with the target results, while non-β-hemolytic Streptococcus could not be amplified, indicating that the established method has good specificity in detecting β-hemolytic Streptococcus.

[0091] 3.6 Fluorescence PCR sensitivity test

[0092] Select the extracted DNA10 -1 Up to 10 -6 A total of 6 dilutions were used for real-time fluorescence PCR amplification, and 4 parallel tests were performed for each dilution. Figure 7 . Dilution less than or equal to 10 -5 The amplification was obvious when Ct < 35 and the dilution was 10 -6 When 35<Ct<40, the result is questionable.

[0093] The sample DNA extraction solution was tested by UV spectrophotometer, and the concentration was 85.23ng / μL. Therefore, this method is effective for DNA with a concentration greater than 85.23×10 -5 ng / μL of target microbial genomic DNA can be effectively detected.

[0094] 4. Discussion

[0095] According to GB4789.11-2014 "National Food Safety Standard Food Microbiology Inspection β-Hemolytic Streptococcus Inspection", SN / T3335-2012 "Inspection Specifications for Microbiological Items of Imported and Exported Textiles", and GB15979-2002 "Sanitary Standards for Disposable Sanitary Products", hemolytic streptococci shall not be detected in textiles. In this study, 45 textile raw material samples were compared with traditional biochemical identification methods using conventional PCR and fluorescent PCR technology. The results showed that the results obtained by conventional PCR identification method, real-time fluorescent PCR identification method and biochemical identification method were completely consistent, and the target β-hemolytic streptococcus could be accurately detected, confirming the stability and reliability of the first two methods.

[0096] The primer concentration in the conventional PCR reaction was 0.4 μmol / L, that is, the amount of primer added to the system was 1.0 μL; the annealing temperature was 56°C; the DNA concentration in the sensitivity test was greater than 85.23×10 -3 ng / μL, β-hemolytic streptococci can be effectively detected;

[0097] The concentration of primers and probes in the fluorescent PCR reaction was 0.4 μmol / L, that is, the amount of primers and probes added to the system was 1.0 μL; the annealing extension temperature was 60°C; the DNA concentration in the sensitive detection was greater than 85.23×10 -5 ng / μL, β-hemolytic streptococci can be effectively detected.

[0098] Conventional PCR identification only takes about 6 hours, the operation process is relatively fixed, and the required instruments are relatively simple, but it is usually necessary to perform subsequent tests such as agarose gel electrophoresis to observe the size of the amplified product. The electrophoresis operation is time-consuming, and toxic nucleic acid dyes (such as ethidium bromide) are required to stain and observe the bands, which poses certain safety risks. In comparison, real-time fluorescence PCR identification is shortened to about 4 hours, with high sensitivity and specificity. Fluorescent PCR does not require subsequent detection steps such as electrophoresis after the reaction like traditional PCR. It can collect data in real time during the reaction. This can obtain results in a shorter time, greatly improve detection efficiency, shorten the identification cycle, and provide a more efficient solution for the rapid and accurate identification of β-hemolytic streptococci.

[0099] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. Specific primers and probes for detecting β-hemolytic streptococci, characterized by: The probe sequence is: 5"FAM-CGAAAAGATGGCAACTCCGCT-3"TAMRA; The specific primers include an upstream primer and a downstream primer; The upstream primer sequence: 5′AGTGAAGGATCTGGGGTCAT 3′; The downstream primer sequence: 5′AGCTCCGTCGATAACATGGT 3′.

2. The specific primer and probe for detecting beta-hemolytic streptococci according to claim 1, characterized in that: The specific primers and probes are used for detecting beta-hemolytic streptococci.

Images