Use of linc-znf25-1 gene inhibitors
By using linc-ZNF25-1 gene inhibitors, especially CRISPR/Cas9 technology to silence the linc-ZNF25-1 gene in pancreatic cancer cells, the problem of unsatisfactory chemotherapy effects in pancreatic cancer has been solved, chemotherapy resistance and proliferation have been reduced, and new therapeutic targets have been provided.
Patent Information
- Application Number
- CN202411861664.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-17
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-12-17
AI Technical Summary
Current chemotherapy for pancreatic cancer is not very effective, and the role of lncRNA in extracellular vesicles derived from pancreatic cancer cells is unclear, resulting in a lack of effective treatment methods.
Using linc-ZNF25-1 gene inhibitors, including linc-ZNF25-1 gene knockout reagents or interfering RNA, the linc-ZNF25-1 gene in pancreatic cancer cells was silenced using CRISPR/Cas9 technology, to prepare a product for reducing chemotherapy resistance and proliferation of pancreatic cancer cells.
Silencing the linc-ZNF25-1 gene reduces the clonogenic and proliferative capacity of pancreatic cancer cells and weakens their resistance to chemotherapy drugs, providing a new mechanism for pancreatic cancer development and a therapeutic target.
Smart Images

Figure CN119818677B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of linc-ZNF25-1 gene inhibitor. BACKGROUND
[0002] Pancreatic cancer is a malignant tumor with insidious onset, rapid progression and extremely poor prognosis, and is one of the most challenging diseases in the digestive system tumors. In the past two decades, the number of patients has significantly increased. Due to the lack of early symptoms and the limitations of screening methods, most pancreatic cancers are discovered in the advanced stage, and only a small number of people have surgical opportunities. Although great progress has been made in surgical techniques and adjuvant drug therapy, the effects of chemotherapy, radiotherapy and immunotherapy are still unsatisfactory, and the prognosis of pancreatic cancer patients is still not optimistic. Therefore, although chemotherapy is one of the important treatment methods for patients with advanced pancreatic cancer, its efficacy is still unsatisfactory.
[0003] Extracellular vesicles are abbreviated as EVs, and EVs are an important part of signal transduction between cells and play an important role in the progression and chemotherapy resistance of various tumors. There are many long non-coding RNAs (lncRNAs) in the vesicles, and these lncRNAs have physiological activity, but the role of lncRNAs in pancreatic cancer derived from extracellular vesicles is unclear. SUMMARY
[0004] To solve the above technical problems, the present application provides application of linc-ZNF25-1 gene inhibitor.
[0005] The present application adopts the following technical solutions.
[0006] The present application provides application of linc-ZNF25-1 gene inhibitor in preparation of a drug for treating pancreatic cancer.
[0007]
[0008] The LNCipedia gene ID of the linc-ZNF25-1 gene is lnc-BMS1-15.
[0009] In some embodiments of the present application, the linc-ZNF25-1 gene inhibitor comprises: a linc-ZNF25-1 gene knockout reagent or an interfering RNA of the linc-ZNF25-1 gene.
[0010] In some embodiments of the present application, the linc-ZNF25-1 gene knockout reagent comprises: a reagent used in CRISPR / Cas9 technology.
[0011] The interfering RNA of the linc-ZNF25-1 gene is any one of antisense oligonucleotide (ASO), small interfering RNA (siRNA) and Smart Silencer (a mixture of ASO and siRNA).
[0012] In some embodiments of the present application, the interfering RNA of the linc-ZNF25-1 gene consists of a sequence as shown in SEQ ID NO. 2-7.
[0013] In some embodiments of the present application, the drug is an extracellular vesicle comprising the linc-ZNF25-1 gene knockout reagent.
[0014] In some embodiments of the present application, the drug is used to reduce the tolerance of pancreatic cancer cells to chemotherapeutic drugs.
[0015] In some embodiments of the present application, the drug is used to reduce the clonogenicity of pancreatic cancer cells.
[0016] In some embodiments of the present application, the drug is used to reduce the proliferation of pancreatic cancer cells.
[0017] The linc-ZNF25-1 gene inhibitor is used for reducing the tolerance of pancreatic cancer cells to chemotherapeutic drugs.
[0018] In some embodiments of the present application, the chemotherapeutic drug for pancreatic cancer is gemcitabine.
[0019] Compared with the prior art, the present application has the following beneficial effects:
[0020] The present application finds that the lncRNA in the pancreatic cancer cell EVs is significantly different from the parent pancreatic cancer cell, wherein the linc-ZNF25-1 is significantly highly expressed in the EVs, which indicates that the EVs-mediated linc-ZNF25-1 may be related to the progression of pancreatic cancer, and the linc-ZNF25-1 gene is found to be highly expressed in the pancreatic cancer cell, thereby proposing the application of the linc-ZNF25-1 gene inhibitor in the preparation of a drug for treating pancreatic cancer.
[0021] The present application also finds that the linc-ZNF25-1 gene is highly expressed in the gemcitabine-resistant pancreatic cancer cell, thereby proposing the application of the linc-ZNF25-1 gene inhibitor in the preparation of a drug for reducing the tolerance of the pancreatic cancer chemotherapy drug.
[0022] The present application finds that the silencing of the linc-ZNF25-1 gene in the pancreatic cancer cell can reduce the clonogenicity of the pancreatic cancer cell and weaken the proliferation ability of the pancreatic cancer cell by silencing the expression of the linc-ZNF25-1 gene in the pancreatic cancer cell, finds a new mechanism of pancreatic cancer development, and finds that the EVs-mediated linc-ZNF25-1 is a new target for treating pancreatic cancer, thereby providing an important scientific basis for further diagnosing and treating pancreatic cancer.
[0023] The present application proves that the pancreatic cancer cell-derived EVs-mediated linc-ZNF25-1 gene plays an important role in the progression and drug resistance of pancreatic cancer. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 The figure is a volcano plot of the sequencing of the long non-coding RNA in the gemcitabine-resistant pancreatic cancer cell and the parent pancreatic cancer cell EVs.
[0025] Figure 2 The figure is a qRT-PCR determination of the relative expression level of linc-ZNF25-1 in the gemcitabine-resistant pancreatic cancer cell and the parent pancreatic cancer cell.
[0026] Figure 3 The figure is a qRT-PCR determination of the relative expression level of linc-ZNF25-1 in the gemcitabine-resistant pancreatic cancer cell and the parent pancreatic cancer cell EVs.
[0027] Figure 4 The figure is a qRT-PCR detection of the relative expression level of linc-ZNF25-1 in the nucleus and the cytoplasm of the pancreatic cancer cell; wherein, Figure 4 A in the figure indicates the relative expression level of linc-ZNF25-1 in the nucleus and the cytoplasm of the MIA PaCa-2 cell; Figure 4 B in the figure indicates the relative expression level of linc-ZNF25-1 in the nucleus and the cytoplasm of the PANC-1 cell.
[0028] Figure 5 The efficiency of qRT-PCR detection of linc-ZNF25-1 overexpressed in pancreatic cancer cells by plasmid and the level of linc-ZNF25-1 in the corresponding EVs; wherein, Figure 5 A in the above-mentioned indicates the relative expression level of linc-ZNF25-1 in the cells after overexpression of linc-ZNF25-1 in pancreatic cancer cells by qRT-PCR detection; Figure 5 B in the above-mentioned indicates the relative expression level of linc-ZNF25-1 in the EVs after overexpression of linc-ZNF25-1 in pancreatic cancer cells by qRT-PCR detection.
[0029] Figure 6 The cell activity of pancreatic cancer cells transfected or not transfected with linc-ZNF25-1 overexpressing plasmid after treatment with different concentrations of gemcitabine for 72 hours; wherein, Figure 6 A in the above-mentioned indicates the cell activity of MIAPaCa-2 after overexpression of linc-ZNF25-1 and treatment with different concentrations of gemcitabine for 72 hours; Figure 6 B in the above-mentioned indicates the cell activity of PANC-1 after overexpression of linc-ZNF25-1 and treatment with different concentrations of gemcitabine for 72 hours.
[0030] Figure 7 The plate cloning of pancreatic cancer cells transfected or not transfected with linc-ZNF25-1 overexpressing plasmid; wherein A is a plate cloning graph; B is a plate cloning count statistical graph.
[0031] Figure 8 The Edu proliferation graph of pancreatic cancer cells after overexpression of linc-ZNF25-1; wherein, Figure 8 A in the above-mentioned indicates the Edu proliferation graph of pancreatic cancer cells, and the scale is 50 μm; Figure 8 B in the above-mentioned indicates the statistical graph of Edu proliferation of pancreatic cancer cells.
[0032] Figure 9 The efficiency of qRT-PCR detection of linc-ZNF25-1 silenced in pancreatic cancer cells by smart silencer and the level of linc-ZNF25-1 in the corresponding EVs; wherein, Figure 9 A in the above-mentioned indicates the relative expression level of linc-ZNF25-1 in the cells after silencing of linc-ZNF25-1 in pancreatic cancer cells by qRT-PCR detection; Figure 9 B in the above-mentioned indicates the relative expression level of linc-ZNF25-1 in the EVs after silencing of linc-ZNF25-1 in pancreatic cancer cells by qRT-PCR detection.
[0033] Figure 10Cell viability after silencing linc-ZNF25-1 in pancreatic cancer cells and treating with different concentrations of gemcitabine for 72 hours; wherein, Figure 10 A in the figure indicates cell viability after silencing linc-ZNF25-1 in MIAPaCa-2 and treating with different concentrations of gemcitabine for 72 hours; Figure 10 B in the figure indicates cell viability after silencing linc-ZNF25-1 in PANC-1 and treating with different concentrations of gemcitabine for 72 hours.
[0034] Figure 11 Edu proliferation graph after silencing linc-ZNF25-1 in pancreatic cancer cells; wherein, Figure 11 A in the figure indicates Edu proliferation graph of pancreatic cancer cells, the scale is 50 μm; Figure 11 B in the figure indicates the statistical graph of Edu proliferation of pancreatic cancer cells.
[0035] Figure 12 Plate cloning after silencing linc-ZNF25-1 in pancreatic cancer cells; wherein A is plate cloning graph; B is the count statistical graph of plate cloning.
[0036] Figure 13 In vivo experiment of linc-ZNF25-1 promoting pancreatic cancer progression; wherein, Figure 13 A in the figure indicates representative bioluminescence images of orthotopic pancreatic cancer mice constructed by MIAPaCa-2 cells transfected with control or overexpressing linc-ZNF25-1 lentivirus at a specific time; Figure 13 B in the figure indicates images of mice and tumor at the end of the experiment.
[0037] Figure 14 Statistical graph of average radiation of tumor of pancreatic cancer mice in control group and overexpressing linc-ZNF25-1 group.
[0038] Figure 15 Statistical graph of tumor weight and tumor volume of mice; wherein, Figure 15 A in the figure indicates tumor weight graph of mice; Figure 15 B in the figure indicates tumor volume graph of mice.
[0039] Figure 16 Immunohistochemical graph of ki-67, BAX and Bcl2 of tumor of pancreatic cancer mice in control group and overexpressing linc-ZNF25-1 group.
[0040] Figure 17 Map of linc-ZNF25-1 overexpression plasmid. DETAILED DESCRIPTION
[0041] The application will be described in detail below with specific examples, but should not be understood as limiting the application. If not specifically stated, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained from commercial channels.
[0042] Experimental materials:
[0043] 1. The human pancreatic cancer cell lines MIA PaCa-2 and PANC-1 used in the application were purchased from the American Type Culture Collection (ATCC).
[0044] 2. Drug-resistant pancreatic cancer cells MIA PaCa-2 R and PANC-1 R Construction:
[0045] First, the IC50 value of the parent cells MIA PaCa-2 and PANC-1 for gemcitabine (GEM) was determined. A GEM concentration less than the IC50 (1 nM) was used as the initial drug concentration, and after the cells adapted to the drug concentration, they were continuously subcultured, and the drug concentration was gradually increased to 500 nM-1 μM, until the cells reached a drug-resistant state to gemcitabine, and the drug-resistant pancreatic cancer cell lines MIA PaCa-2 R and PANC-1 R were successfully constructed.
[0046] Example 1
[0047] 1. Drug-resistant pancreatic cancer cells MIA PaCa-2 R and EVs derived from the parent pancreatic cancer cell MIA PaCa-2 were sequenced for long non-coding RNA (lncRNA)
[0048] The application first sequenced the long non-coding RNA (lncRNA) in the gemcitabine-resistant pancreatic cancer cells MIA PaCa-2 R and EVs derived from the parent pancreatic cancer cell MIA PaCa-2.
[0049] The sequencing results are shown in Figure 1 , and it was found that the lncRNA in the EVs of the gemcitabine-resistant pancreatic cancer cells was significantly different from that in the parent pancreatic cancer cells, and the linc-ZNF25-1 gene was significantly highly expressed in the EVs derived from MIA PaCa-2 R , which suggests that the EV-mediated linc-ZNF25-1 gene may be related to the progression of pancreatic cancer and chemotherapy resistance.
[0050] 2. linc-ZNF25-1 gene detection
[0051] For further verification, the linc-ZNF25-1 gene in parent pancreatic cancer cells MIAPaCa-2, PANC-1 and gemcitabine-resistant cells MIAPaCa-2 R and PANC-1 R is detected.
[0052] Total RNA is extracted using an RNA purification kit (B0004D, EZ Bioscience). The specific method is as follows:
[0053] (1) Sample lysis: for adherent cell samples with cell number ≤ 3 x 10 6 , discard the culture medium, wash the cells with PBS, then add 500 μL lysis solution, and place on a shaker at room temperature at 120 rmp-150 rmp for 1-2 minutes, or blow with a pipette for about 30 times to fully lyse the cells;
[0054] (2) Add an equal volume of absolute ethanol to the above cell lysate and mix well. If a precipitate appears after adding ethanol, use a pipette to blow it until the precipitate is no longer visible, then add it to a spin column, centrifuge at 4000g (equivalent to 7000 rpm of a laboratory commonly used Eppendorf, Thermo or Beckman centrifuge) for 1 minute (if there is liquid remaining in the column after centrifugation, centrifuge at 12000g for 1 minute again), and discard the liquid;
[0055] (3) DNAase treatment: according to the ratio of 2 μL DNAase (gDNARemover) per sample and 10 μL ddH2O (sterilized), take the corresponding volume of DNAase and ddH2O according to the number of samples, mix well with a pipette; take 12 μL and add to the center of the membrane of each column, and place at room temperature for 5 minutes to remove the small amount of genomic DNA that may remain (after DNAase treatment, do not centrifuge, directly add the next step of washing liquid for washing operation).
[0056] (4) Add 500 μL of washing liquid (Wash Buffer) to the spin column and centrifuge at 12000g for 1 minute. Note: When removing the spin column from the collection tube, it should be handled carefully to prevent the bottom of the spin column from touching the liquid (recommended operation: after pouring out the liquid, the collection tube can be inverted on a water-absorbing paper, and gently tapped twice, then the spin column is placed back into the collection tube, and the empty column is centrifuged at 12000g for 1 minute);
[0057] (5) Without discarding the waste liquid, transfer the centrifuge column directly to an RNase-free 1.5 mL EP tube and leave it to air-dry for 2 minutes with the lid open.
[0058] (6) Add 30 μL of elution buffer to the membrane in the center of the centrifuge column and let it stand at room temperature for 2 minutes.
[0059] (7) Centrifuge at 12000g for 1 minute (Optional: After the initial elution and centrifugation, the liquid can be added back to the centrifuge column and allowed to stand for another 3 minutes to allow the RNA to fully dissolve before centrifugation again, which can increase RNA yield). Discard the centrifuge column and the resulting RNA should be quickly transferred to ice for concentration determination before subsequent experiments or stored at -80°C for later use.
[0060] The concentration and purity of the RNA extracted by the above extraction method were measured using a spectrophotometer.Then, the total RNA was reverse transcribed into cDNA using PrimeScript RT MasterMix (RR036A, TaKaRa).
[0061] Reverse transcription:
[0062] Prepare the RT reaction solution according to the following composition (total system 10 μL, the reaction solution is prepared on ice):
[0063] 5X PrimeScript RT MasterMix 2μL, RNA 500ng, RNase Free dH2O up to10μL;
[0064] After gentle mixing, proceed with the reverse transcription reaction using the following conditions:
[0065] 37°C for 15 minutes (reverse transcription reaction), 85°C for 5 seconds (reverse transcriptase inactivation reaction).
[0066] Quantitative PCR was performed at 4°C using SYBR Green PCR Master Mix with GAPDH as the control gene. The relative expression level was estimated by the method.
[0067] like Figure 2 As shown, the results showed that gemcitabine-resistant pancreatic cancer cells highly expressed the linc-ZNF25-1 gene.
[0068] 3. Parental pancreatic cancer cells MIA PaCa-2, PANC-1 and gemcitabine-resistant cells MIA PaCa-2 R and PANC-1 R Extraction of cell-derived EVs
[0069] (1) EVs extraction method:
[0070] Cells were cultured using complete medium, and when the cell confluency reached 80%, the complete medium was discarded, washed with PBS three times, and replaced with serum-free medium. After 48 h of culture, the supernatant was collected. The collected supernatant was used to extract EVs using a differential ultracentrifugation method, i.e., after centrifugation at 500 x g for 15 min, the EVs were separated by ultracentrifugation at 110,000 x g for 70 min, and washed in PBS under the same ultracentrifugation conditions. The extracted EVs (derived from MIA PaCa-2 / MIAPaCa-2 R and PANC-1 / PANC-1 R were dissolved in PBS and stored at -80°C. The concentration of EVs was determined using the BCA method. m / EV mR and EV P / EV PR ) were dissolved in PBS and stored at -80°C. The concentration of EVs was determined using the BCA method.
[0071] (2) Extraction of RNA from EVs, reverse transcription, and qRT-PCR
[0072] Extraction of RNA from EVs was performed using a kit (EZB-exo-RN1, EZ Bioscience). The specific method is described as follows:
[0073] 1) 10 μL of EVs were placed in a 1.5 mL centrifuge tube, and 500 μL of lysis buffer was added.
[0074] 2) The EVs were dissolved up and down 20 times using a pipette. Incubation was performed at room temperature for 5 min.
[0075] 3) 150 μL of buffer A was added to the EV lysis solution, and it was vigorously shaken for 15 s to mix well. Incubation was performed at room temperature for 3 min.
[0076] 4) Centrifugation was performed at 15,000 x g for 3 min at 4°C. Then, the mixture was separated into three phases. The upper supernatant (about 300 μL) was transferred to a new RNase-free 1.5 mL centrifuge tube (note that the middle or bottom layers should not be stirred).
[0077] 5) 10 μL of a supplement reagent was added to each volume of supernatant, and it was mixed well. Then, 1.6 times the volume of 100% ethanol was added to each volume of the above solution.
[0078] 6) The centrifuge tube was inverted several times, or moved up and down 10 times using a pipette, and it was mixed well. Then, the sample was transferred to a centrifuge column. Centrifugation was performed at 4000 x g at 4°C for 1 min. The liquid was discarded.
[0079] 7) Add 500 μL Wash Buffer 1 to the spin column. Centrifuge at 12,000 x g for 1 minute at 4°C (be careful not to touch the bottom of the spin column to the liquid when removing the spin column from the microfuge). Discard the flow-through.
[0080] 8) Add 500 μL Wash Buffer 2 to the spin column. Centrifuge at 12,000 x g for 1 minute at 4°C.
[0081] 9) Discard the flow-through and remove any remaining liquid with a paper towel. Place the spin column in a new RNase-free 1.5 mL microfuge tube and centrifuge at 12,000 x g for 1 minute at 4°C.
[0082] 10) Discard the flow-through and place the spin column in a new RNase-free 1.5 mL microfuge tube. Open the lid and leave it in the air for 10 minutes. Open the lid and leave it in the air for 2 minutes.
[0083] 11) Pre-warm the elution buffer to 60°C and add 20 μL of elution buffer to the center of the membrane. Then place the EP tube containing the spin column in a 60°C water bath or metal bath for 3 minutes to dissolve the RNA.
[0084] 12) Centrifuge at 12,000 x g for 1 minute at 4°C (transfer the eluate back to the spin column and centrifuge at 12,000 x g for 1 minute at 4°C).
[0085] 13) Discard the spin column and determine the concentration of the RNA. Use the purified RNA for subsequent experiments or store the RNA at -80°C until needed.
[0086] The concentration and purity of the RNA were measured using a spectrophotometer.
[0087] The total RNA was then reverse transcribed into cDNA using PrimeScript RT Master Mix (RR036A, TaKaRa). Quantitative PCR was performed using SYBR Green PCR Master Mix with GAPDH as a control gene and the relative expression was estimated using the method.
[0088] (3) Nuclear / Cytoplasmic Fractionation:
[0089] NE-PER TMNuclear and cytoplasmic extraction reagent (78833, Thermo Fisher Scientific) was used for nuclear-cytoplasmic fractionation. Briefly, the collected cells were incubated in cell dissociation buffer on ice for 10 minutes. After centrifugation at 500xg for 5 minutes, the supernatant was collected as the cytoplasmic fraction. The nuclear pellet was resuspended in cell dissociation buffer and incubated at 4°C for 30 minutes. After centrifugation at 12,000xg for 10 minutes, the nuclear fraction was obtained after removing the insoluble membrane fragments. Then, the expression levels of GAPDH, U6 and lincZNF25-1 genes in the cytoplasm or nucleus of pancreatic cancer cells were detected by qRT-PCR.
[0090] The qRT-PCR results showed that MIA PaCa-2 R and PANC-1 R derived EVs had more linc-ZNF25-1 genes (as shown in Figure 3 ). The nuclear-cytoplasmic fractionation experiment showed that the linc-ZNF25-1 gene was distributed in the nucleus and cytoplasm of pancreatic cancer cells, and the content in the cytoplasm was more, which was consistent with its transmission through EVs (as shown in A and B of Figure 4 ).
[0091] Example 2
[0092] 1. Construction of linc-ZNF25-1 overexpression plasmid:
[0093] The map of linc-ZNF25-1 overexpression plasmid is shown in Figure 17 .
[0094] 2. In order to clarify the role of linc-ZNF25-1 mediated by EVs derived from pancreatic cancer cells in the progression of pancreatic cancer, the present application overexpressed the linc-ZNF25-1 gene in pancreatic cancer cells MIA PaCa-2 and PANC-1 using linc-ZNF25-1 overexpression plasmid.
[0095] Experimental method:
[0096] (1) Cell culture: 1-2x10 5 cells / well were inoculated into a six-well plate, and the density was cultured to 40%-60% in a 37°C, 5% CO2 incubator.
[0097] (2) Preparation of transfection solution: the following two solutions were prepared in an EP tube (the amount used for transfection of each well of cells)
[0098] A solution: dilute 2 μg linc-ZNF25-1 overexpression plasmid DNA with serum-free medium.
[0099] B solution: dilute 5 μl liposome with serum-free medium.
[0100] (3) Pipette Solution B into Solution A and gently tap to mix. Let stand at room temperature for 10 minutes.
[0101] (4) Transfection: Slowly add the A / B complex to the culture medium, shake well, and place in a 37°C incubator for 12 hours. Aspirate the serum-free transfection medium and replace it with normal culture medium to continue culturing.
[0102] (5) After transient transfection, the cells can be grown to full size and then RNA can be extracted to verify the overexpression efficiency.
[0103] Experimental results:
[0104] qRT-PCR confirmed its overexpression effect in pancreatic cancer cells ( Figure 5 We then extracted EVs from pancreatic cancer cells overexpressing linc-ZNF25-1 and corresponding control pancreatic cancer cells and detected the expression level of linc-ZNF25-1. The results showed that EVs from pancreatic cancer cells overexpressing linc-ZNF25-1 contained more linc-ZNF25-1 ( Figure 5 (as shown in B in the figure).
[0105] 3. Furthermore, the present invention adopted IC50 experiments, clone formation, and EdU experimental studies to explore the effect of linc-ZNF25-1 on the function of pancreatic cancer cells.
[0106] Experimental methods:
[0107] (1)IC50:
[0108] The control group and pancreatic cancer cells overexpressing linc-ZNF25-1 gene were inoculated at 1×10 4 Cells were seeded into 96-well plates. After cell adhesion, different concentrations of gemcitabine (1 nM, 10 nM, 100 nM, 1 μM, and 10 μM) were added to each group. After incubation for 72 hours, the cells were rinsed with PBS, and cell viability was determined using CCK-8 (K1018-5, APExBIO) reagent. OD450 values were measured spectrophotometrically 2 hours after addition of CCK-8 reagent.
[0109] (2) Clone formation:
[0110] Pancreatic cancer cells in the control group and those overexpressing linc-ZNF25-1 were seeded at 500 cells per well in 6-well plates. The culture medium was changed every three days for two weeks. The culture medium was then discarded, the cells were rinsed with PBS, and fixed with 4% paraformaldehyde. The fixative was discarded, the cells were washed once with PBS, and then stained with 0.4% crystal violet. Finally, the colonies on the plates were photographed and counted.
[0111] (3) EdU proliferation:
[0112] Use UELandy according to the manufacturer's instructions. TM EdU staining was performed using an EdU cell proliferation kit. First, 10 μM EdU was added to control and linc-ZNF25-1-overexpressing pancreatic cancer cells and incubated for 2 hours. After rinsing with PBS, cells were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and treated with Click-iT working solution for 30 minutes. Finally, after incubation with DAPI solution, cells were observed under a fluorescence microscope (Nikon, Japan).
[0113] Experimental results:
[0114] (1)IC50:
[0115] First, we added different concentrations of gemcitabine (1nM, 10nM, 100nM, 1μM, 10μM) to the control group and pancreatic cancer cells overexpressing linc-ZNF25-1. After 72 hours, CCK-8 results showed that overexpression of linc-ZNF25-1 promoted gemcitabine resistance in pancreatic cancer cells ( Figure 6 AB in the figure).
[0116] (2) Clone formation:
[0117] The results of the clone formation experiment showed that overexpression of linc-ZNF25-1 in pancreatic cancer cells could increase the clone formation ability of pancreatic cancer cells (such as Figure 7 AB).
[0118] (2) EdU proliferation:
[0119] Similarly, after EdU incubation of the above-treated pancreatic cancer cells, immunofluorescence showed that the pancreatic cancer cell group overexpressing linc-ZNF25-1 had a stronger proliferation ability ( Figure 8 A and B in FIG.
[0120] Example 3
[0121] Effects of inhibiting the linc-ZNF25-1 gene on pancreatic cancer cells
[0122] 1. Construction of linc-ZNF25-1 Smart Silencer:
[0123] The linc-ZNF25-1 Smart Silencer is composed of GACGATTCCATTCAATTCCT, denoted as SEQ ID NO. 2, CCATTCTATTCCATTTGAGG, denoted as SEQ ID NO. 3, CCATTCCATTCCATTCGATG, denoted as SEQ ID NO. 4, TCCTTTCACTTCCATTCGA, denoted as SEQ ID NO. 5, CCATTCCTTTCCATTTGAT, denoted as SEQ ID NO. 6, CCATTCCATTCCATTCGAT, denoted as SEQ ID NO. 7.
[0124] To further clarify the inhibitory effect of silencing linc-ZNF25-1 in pancreatic cancer cells on the progression and drug resistance of pancreatic cancer, the present application uses Smart Silencer to silence linc-ZNF25-1 in pancreatic cancer cells MIAPaCa-2 and PANC-1, and then uses qRT-RCR to verify the silencing effect in pancreatic cancer cells.
[0125] The specific silencing method is as follows:
[0126] (1) Cell culture: 1-2 x 10 5 cells per hole are inoculated into a six-hole plate, and the culture density is 40%-60% in a 37°C, 5% CO2 incubator.
[0127] (2) Transfection solution preparation: the following two solutions are prepared in an EP tube (the amount used for transfecting each hole of cells)
[0128] A solution: dilute 5 μL of Smart Silencer diluent with serum-free culture medium.
[0129] B solution: dilute 5 μL of liposome with serum-free culture medium.
[0130] (3) Take B solution and add it to A solution, mix gently. Place in room temperature for 10 minutes.
[0131] (4) Transfection: slowly add the A / B complex to the culture solution, shake well, and place in a 37°C incubator for 12 hours. Remove the serum-free transfection solution and replace it with normal culture solution for continued culture.
[0132] (5) After transient transfection, cell RNA can be extracted after the cells are fully grown to verify the silencing efficiency.
[0133] For example, Figure 9As shown in Figure A, qRT-RCR confirmed its silencing effect in pancreatic cancer cells. Subsequently, EVs from pancreatic cancer cells with silenced linc-ZNF25-1 gene and corresponding control pancreatic cancer cells were extracted and the expression level of linc-ZNF25-1 gene was detected. The results showed that the expression of linc-ZNF25-1 gene in EVs derived from pancreatic cancer cells with silenced linc-ZNF25-1 gene was reduced ( Figure 9 (as shown in B in the figure).
[0134] 2. The present invention subsequently explored the effect of silencing the linc-ZNF25-1 gene on the function of pancreatic cancer cells.
[0135] Experimental methods:
[0136] (1)IC50:
[0137] The pancreatic cancer cells of the control group and the linc-ZNF25-1 gene silenced group were cultured at 1×10 4 Cells were seeded into 96-well plates. After cell adhesion, different concentrations of gemcitabine (1 nM, 10 nM, 100 nM, 1 μM, and 10 μM) were added to each group. After incubation for 72 hours, the cells were rinsed with PBS, and cell viability was determined using CCK-8 (K1018-5, APExBIO) reagent. OD450 values were measured spectrophotometrically 2 hours after addition of CCK-8 reagent.
[0138] (2) Clone formation:
[0139] Pancreatic cancer cells in the control group and those with linc-ZNF25-1 gene silenced were seeded at 500 cells per well in 6-well plates. The culture medium was changed every three days for two weeks. The cells were then decanted, rinsed with PBS, and fixed with 4% paraformaldehyde. The fixative was discarded, the cells were washed once with PBS, and stained with 0.4% crystal violet. Colonies on the plates were photographed and counted.
[0140] (3) EdU proliferation:
[0141] Use UELandy according to the manufacturer's instructions. TM EdU staining was performed using an EdU cell proliferation kit. First, 10 μM EdU was added to control and linc-ZNF25-1-silenced pancreatic cancer cells and incubated for 2 hours. After rinsing with PBS, cells were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and treated with Click-iT working solution for 30 minutes. Finally, cells were incubated with DAPI solution and observed under a fluorescence microscope (Nikon, Japan).
[0142] Experimental results:
[0143] CCK-8 results showed that silencing the linc-ZNF25-1 gene reduced the resistance of pancreatic cancer cells to gemcitabine ( Figure 10 After incubating the pancreatic cancer cells treated with EdU, immunofluorescence showed that the proliferation ability of the pancreatic cancer cells in which the linc-ZNF25-1 gene was silenced was weakened ( Figure 11 Consistent with this, the results of the clone formation experiment showed that silencing the linc-ZNF25-1 gene in pancreatic cancer cells could reduce the clone formation ability of pancreatic cancer cells ( Figure 12 AB).
[0144] Example 4:
[0145] In vivo experiments verified the role of the linc-ZNF25-1 gene
[0146] 1. Experimental animals:
[0147] Sixteen BALB / c nude mice, 6 weeks old, female, weighing 14-16 g, were used.
[0148] 2. Experimental methods:
[0149] 2×10 6 MIA PaCa-2 cells transfected with either the LV17 blank vector or the LV17-linc-ZNF25-1 overexpressing lentivirus (D020011, Genentech) were injected into the pancreas of 6-week-old female BALB / c nude mice. Fluorescent images of tumor-bearing mice were captured using a small animal in vivo fluorescence imaging system (Maestro 3.0.0, USA). Once tumors were visible on in vivo fluorescence imaging (approximately 3 weeks after cell implantation), weekly in vivo fluorescence imaging was performed to monitor tumor progression. Tumors were harvested after 6 weeks for immunohistochemistry and other assays.
[0150] 3. Experimental results:
[0151] The LV17 blank vector virus was introduced into MIAPaCa-2 and injected into the pancreas of nude mice to establish an orthotopic xenograft tumor model as the control group. The LV17-linc-ZNF25-1 overexpression lentivirus was introduced into MIAPaCa-2 and injected into the pancreas of nude mice to establish an orthotopic xenograft tumor model as the experimental group. Small animal live imaging was used to show tumor growth. Bioluminescence images showed that the tumors in the OE-linc-ZNF25-1 group grew faster ( Figure 13 After reaching the end of the experiment, the mouse tumor was obtained ( Figure 14 The results showed that the average radiation value, tumor volume and tumor weight of the OE-linc-ZNF25-1 group were significantly greater than those of the control group (as shown in B).Figure 15 A and B in Formula (I) and Figure 16 The results showed that the OE-linc-ZNF25-1 group had more positive staining of Ki-67 and Bcl2, while the pro-apoptotic protein Bax was relatively less (as shown in FIG. 6). It was proved that overexpression of linc-ZNF25-1 indeed played a role in promoting the progression of pancreatic cancer.
[0152] The present application discovers a new mechanism of pancreatic cancer development, and EVs-mediated linc-ZNF25-1 is a new target for treating pancreatic cancer, which provides an important scientific basis for further diagnosis and treatment of pancreatic cancer.
[0153] Although preferred embodiments of the application have been described, those skilled in the art will recognize that additional modifications and variations can be made thereto without departing from the spirit and scope of the application. It is therefore intended that the appended claims encompass all such modifications and variations as fall within the scope of the application.
[0154] Obviously, various modifications and changes can be made to the present application by those skilled in the art without departing from the spirit and scope of the present application. Thus, it is intended that the present application encompass all such modifications and changes as fall within the scope of the claims and their equivalents.
Claims
1. linc-ZNF25-1 The use of a gene inhibitor in the preparation of a drug for treating pancreatic cancer is characterized in that: described linc-ZNF25-1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1; linc-ZNF25-1 Gene inhibitors are linc-ZNF25-1 Gene interfering RNA, linc-ZNF25-1 The interfering RNA of the gene consists of the sequence shown in SEQ ID NO. 2-7.
2. The use according to claim 1, characterized in that The drug comprises linc-ZNF25-1 Extracellular vesicles as gene knockout reagents; The knockout reagent is linc-ZNF25-1 Gene interfering RNA, linc-ZNF25-1 The interfering RNA of the gene consists of the sequence shown in SEQ ID NO. 2-7.
3. The use according to claim 1, characterized in that The drug is used to reduce the clonogenicity of pancreatic cancer cells.
4. The use according to claim 1, wherein The drug is used to reduce the proliferation of pancreatic cancer cells.
5. The use according to claim 1, characterized in that The drug is used to reduce the resistance of pancreatic cancer cells to chemotherapy drugs.
6. The method according to claim 1 linc-ZNF25-1 The use of gene inhibitors in the preparation of drugs that reduce the resistance of pancreatic cancer to chemotherapy drugs; The pancreatic cancer chemotherapy drug is gemcitabine.
Citation Information
Patent Citations
SiRNA of targeting transcription factor ZNF25 and application thereof
CN118599838A
Application of IL-15 inhibitor in preparation of medicine for treating pancreatic cancer
CN118750496A