A cell line stably expressing an orthogonal aminoacyl tRNA synthetase / tRNA pair
By integrating EcTyr aminoacyl-tRNA synthetase and BsTyr tRNA genes into HEK293T cells, the problems of cross-reactivity and low expression levels in existing systems were solved, and a cell line that stably expresses the EcTyr aminoacyl-tRNA synthetase/BsTyr tRNA pair was constructed. This achieved efficient and stable introduction of non-natural amino acids and protein modification, providing a reliable research platform.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-18
- Publication Date
- 2026-03-17
AI Technical Summary
Existing orthocyanin-tRNA synthetase/tRNA systems suffer from cross-reactivity, low expression levels, and inconsistent stop codon readout efficiency in host cells, resulting in low efficiency in introducing non-natural amino acids and making it difficult to construct stable and efficient orthocyanin-tRNA synthetase/tRNA systems.
By integrating the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene into HEK293T cells, utilizing the PiggyBac transposon system, and combining it with the 191TAG-mutated green fluorescent protein gene, a cell line stably expressing the EcTyr aminoacyl-tRNA synthetase/BsTyr tRNA pair was constructed, achieving stable expression and efficient recognition of the TAG codon.
This study achieved efficient and stable introduction of non-natural amino acids into HEK293T cells, providing a reliable cell model for precise protein labeling and functional protein synthesis, and improving the incorporation efficiency and system specificity of non-natural amino acids.
Smart Images

Figure CN119842625B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of chemical biology, and in particular to a cell line that stably expresses orthocyanin-tRNA synthetase / tRNA pairs. Background Technology
[0002] In the field of modern chemical biology, genetic code expansion technology is a revolutionary advancement that expands the chemical diversity of biosynthesized proteins by introducing non-natural amino acids into organisms. The core of this technology lies in the orthogonal tRNA synthetase / tRNA pair, which can specifically recognize and insert non-natural amino acids without affecting the host cell's endogenous protein translation system. This orthogonality is key to achieving genetic code expansion because the orthogonal tRNA synthetase / tRNA pair ensures that the insertion of non-natural amino acids does not interfere with normal intracellular protein synthesis processes.
[0003] The discovery and design of orthocyanin-tRNA synthetase / tRNA pairs have provided new tools for studying the relationship between protein structure and function, exploring life phenomena, and developing novel biomaterials and drugs. For example, by introducing non-natural amino acids at specific sites in proteins, it is possible to study protein localization, stability, folding, and interactions, and even endow proteins with new catalytic activities or biophysical properties. Furthermore, this technology shows great potential in the biopharmaceutical field, such as the synthesis of antibody-drug conjugates, the encoding of post-translational modifications of proteins, and the capture of protein-protein interactions.
[0004] Currently available orthogonal systems, such as pyrrolysine aminoacyl-tRNA synthetase / tRNA pairs, exhibit high orthogonality and efficient amber codon suppression in both prokaryotes and eukaryotes. To further enhance the recognition ability of pyrrolysine translation systems for other types of non-natural amino acids, Lin et al. previously developed various chimeric aminoacyl-tRNA synthetase / chimeric tRNA pairs through chimeric design and directed evolution. These systems can recognize and insert different types of non-natural amino acids. For example, the chimeric phenylalanine aminoacyl-tRNA synthetase system (chPheRS / chPheT) gained the ability to recognize multiple phenylalanine analogs through mutation of the catalytic domain and exhibited good orthogonality in both eukaryotic and prokaryotic systems.
[0005] Regarding the aforementioned technologies, the inventors believe that the following drawbacks exist: The orthogonal aminoacyl-tRNA synthetase / tRNA system currently suffers from several major problems. In some host cells, orthogonal aminoacyl-tRNA synthetase may cross-react with the host's endogenous tRNA or aminoacyl-tRNA synthetase, affecting the system's specificity. Particularly in eukaryotic cells, prokaryotic orthogonal tRNAs typically exhibit low expression levels, requiring specific eukaryotic promoters to improve their transcription efficiency. Furthermore, the reading efficiency of stop codons may vary across different cell types, leading to lower efficiency in the introduction of non-natural amino acids. These drawbacks make constructing a stable, efficient, orthogonal aminoacyl-tRNA synthetase / tRNA system in different host cells challenging. Summary of the Invention
[0006] To address the issue that orthocyanin-tRNA synthetase may cross-react with the host's endogenous tRNA or aminoacyl-tRNA synthetase, or that the introduction of non-natural amino acids may be inefficient, this application provides a cell line that stably expresses an orthocyanin-tRNA synthetase / tRNA pair.
[0007] The cell line stably expressing orthocyanin-tRNA synthetase / tRNA pairs provided in this application adopts the following technical solution:
[0008] A cell line stably expressing orthogonal aminoacyl-tRNA synthetase / tRNA, said cell line carrying EcTyr aminoacyl-tRNA synthetase / tRNA. tRNA synthase gene and BsTyr tRNA Gene Cell lines can be used to introduce non-natural amino acids at any site in a protein.
[0009] By employing the above-mentioned technical solution, the EcTyr orthocyanin-tRNA synthetase gene (its gene sequence is shown in SEQ ID NO:1) and the BsTyr tRNA gene (its gene sequence is shown in SEQ ID NO:2) were integrated into the genome of HEK293T cells using the PiggyBac transposon system. A green fluorescent protein gene with a 191TAG mutation was used as a reporter gene for cell line screening and detection of non-natural amino acid insertions. Ultimately, a HEK293T cell line stably expressing the EcTyr orthocyanin-tRNA synthetase / BsTyr tRNA pair was obtained. The integration sites of the EcTyr orthocyanin-tRNA synthetase gene and the BsTyr tRNA gene were identified by whole-genome sequencing.
[0010] Preferably, the cell line is constructed through the following steps:
[0011] S1. The EcTyr aminoacyl-tRNA synthetase gene, the green fluorescent protein gene with the 191TAG mutation, and the puromycin resistance gene were linked to the plasmid pUC19-PB carrying the PiggyBac transposon element to obtain the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro.
[0012] S2. Plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro and plasmid pB-Transposon carrying the PiggyBac transposase gene were co-transformed into HEK293T cells. Stable cell lines integrating the EcTyr aminoacyl-tRNA synthetase gene were obtained by puromycin resistance selection.
[0013] S3. Link 12 copies of the BsTyr tRNA gene and the hygromycin resistance gene to the plasmid pUC19-PB carrying the PiggyBac transposon element to obtain the plasmid pUC19-PB-12*BSTyrT-Hygro.
[0014] S4. Plasmid pUC19-PB-12*BSTyrT-Hygro and plasmid pB-Transposon carrying the PiggyBac transposase gene were co-transformed into a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene. After hygromycin resistance selection, single clones with green fluorescence were sorted by flow cytometry and expanded culture to obtain a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene.
[0015] S5. The integration sites of the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene were identified by whole-genome sequencing.
[0016] By employing the above-mentioned technical approach, the EcTyr aminoacyl-tRNA synthetase gene and multiple copies of the BsTyr tRNA gene were efficiently integrated and stably expressed in HEK293T cells via the PiggyBac transposon system. Simultaneously, the specific expression of the 191TAG mutant green fluorescent protein gene was achieved, enabling the precise encoding and efficient incorporation of non-natural amino acids. This constructed a stable genetically modified cell line with fluorescent labeling function, providing a reproducible and reliable cell model for studying the functional applications of non-natural amino acids and protein synthesis.
[0017] Preferably, the cell line is HEK293T.
[0018] By adopting the above technical solution, the EcTyr aminoacyl-tRNA synthetase gene, BsTyr tRNA gene, and green fluorescent protein gene carrying the 191TAG mutation were stably integrated and efficiently expressed in HEK293T cells, thus constructing a cell line that can specifically incorporate non-natural amino acids, providing an efficient and reliable platform for precise protein labeling, non-natural amino acid research, and functional protein synthesis.
[0019] Preferably, the aminoacyl-tRNA synthetase is the EcTyr aminoacyl synthetase gene, the sequence of which is shown in SEQ ID NO:1.
[0020] By adopting the above technical solution, the EcTyr aminoacyl-tRNA synthetase gene and related gene elements shown in SEQ ID NO:1 were precisely integrated into HEK293T cells, and a cell line capable of specifically recognizing TAG codons and incorporating non-natural amino acids was successfully constructed, providing a stable and efficient platform for precise protein labeling, functional expansion and non-natural amino acid research.
[0021] Preferably, the insertion sites of the aminoacyl-tRNA synthetase gene are Chr1:195962277, Chr1:49891692, Chr1:63286698 and Chr13:66690728.
[0022] By employing the above technical solution, the EcTyr aminoacyl-tRNA synthetase gene was precisely inserted into four sites in HEK293T cells: Chr1:195962277, Chr1:49891692, Chr1:63286698, and Chr13:66690728. This constructed a stable expression system with specific gene integration sites, which can efficiently recognize TAG codons and incorporate non-natural amino acids, providing a reliable cell model for targeted protein modification and functional studies of non-natural amino acids.
[0023] Preferably, the tRNA is BsTyr tRNA, with the sequence shown in SEQ ID NO:2.
[0024] By employing the above-mentioned technical solution, the BsTyr tRNA gene (SEQ ID NO:2) was introduced into HEK293T cells and stably expressed. In synergy with EcTyr aminoacyl-tRNA synthetase, it accurately recognizes the TAG stop codon and incorporates non-natural amino acids, thus constructing a stable cell line with specific gene integration and functional optimization. This provides an efficient tool and platform for protein-directed modification, non-natural amino acid incorporation, and synthetic biology research.
[0025] Preferably, the tRNA copy number is 12.
[0026] By adopting the above technical solution, 12 copies of BsTyr tRNA were stably expressed in HEK293T cells. In synergy with EcTyr aminoacyl-tRNA synthetase, the recognition efficiency of TAG stop codon and the incorporation efficiency of non-natural amino acids were effectively improved, and a stable cell line capable of efficiently synthesizing specific modified proteins was constructed.
[0027] Preferably, the insertion sites of the tRNA gene are ChrX:809749, Chr1:87795827 and Chr1:189472218.
[0028] By employing the above technical solution, 12 copies of the BsTyr tRNA gene were stably integrated into specific sites at ChrX:809749, Chr1:87795827, and Chr1:189472218 in HEK293T cells, ensuring efficient expression and functional stability of the tRNA gene. In synergy with EcTyr aminoacyl-tRNA synthetase, it significantly enhances the accurate recognition and efficient incorporation of non-natural amino acids into the TAG stop codon.
[0029] Preferably, the codon encoding non-natural amino acids is UAG.
[0030] By adopting the above technical solution, the EcTyr aminoacyl-tRNA synthetase and BsTyr tRNA system were used in HEK293T cells to specifically recognize the UAG stop codon and insert non-natural amino acids, thus achieving precise modification and functionalization of the target protein.
[0031] Preferably, the encoded non-natural amino acid is O-methyl-L-tyrosine (OmeY).
[0032] By adopting the above technical solution, the UAG stop codon was specifically translated into O-methyl-L-tyrosine (OmeY) in HEK293T cells through EcTyr aminoacyl-tRNA synthetase and BsTyr tRNA system, thereby achieving site-specific modification and precise functionalization of the target protein.
[0033] In summary, this application includes at least one of the following beneficial technical effects:
[0034] 1. A stable HEK293T cell line expressing the EcTyr orthocyanin tRNA synthetase / BsTyr tRNA pair provides a highly stable mammalian cell model for the efficient introduction of non-natural amino acids at specific sites in proteins. It also lays a certain experimental foundation for simulating protein post-translational modifications in vivo and has broad application potential in the fields of exploring and developing new protein functions and drug screening.
[0035] 2. A HEK293T cell line stably expressing the EcTyr orthocyanin tRNA synthetase / BsTyr tRNA pair was developed. The integration sites of the aminoacyl tRNA synthetase gene and the tRNA gene in this cell line were identified by whole-genome sequencing. This provides important reference value for the subsequent construction of various cell lines stably expressing other orthocyanin tRNA synthetase / tRNA pairs. Attached Figure Description
[0036] Figure 1 This is a schematic diagram of the HEK293T cell line that stably expresses the EcTyr orthocyanin tRNA synthetase / BsTyr tRNA pair according to this application;
[0037] Figure 2 The plasmid map used in this application;
[0038] Figure 3 A schematic diagram illustrating the process for constructing and screening cell lines that stably express orthocyanin-tRNA synthetase / tRNA pairs;
[0039] Figure 4 The structural formula of the non-natural amino acid used in this invention;
[0040] Figure 5 To sort cells that efficiently express green fluorescent protein using flow cytometry;
[0041] Figure 6 To identify and validate cell lines stably expressing orthocyanin-tRNA synthetase / tRNA, Figure A shows gel electrophoresis images of EcTyr orthocyanin-tRNA synthetase and BsTyr tRNA genes amplified by PCR; Figure B shows sequence alignment images of EcTyr orthocyanin-tRNA synthetase and BsTyr tRNA genes amplified by PCR; and Figure C shows the succinate inhibition activity of cells under conditions of addition / subtraction of non-natural amino acids detected by flow cytometry.
[0042] Figure 7 To identify the integration sites of the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene for whole-genome sequencing. Detailed Implementation
[0043] The following is in conjunction with the appendix Figure 1-7 This application will be described in further detail.
[0044] In this application, unless otherwise specified, all percentages are in units of weight, and the equipment and raw materials used are commercially available or commonly used in the field. Unless otherwise specified, all methods in the embodiments are conventional methods in the field.
[0045] This application discloses a cell line that stably expresses orthocyanin-tRNA synthetase / tRNA pairs, referring to... Figures 1-7 The primer sequences used in constructing the vector in this application are shown in Table 1:
[0046] Table 1: Primer sequences for constructing the vector
[0047]
[0048]
[0049] Reference Figure 2 All plasmid maps in this application are used in this application.
[0050] The invention strategy for constructing a cell line stably expressing orthocyanin-tRNA synthetase / tRNA pairs in this application refers to... Figure 3 As shown in the figure, the following examples illustrate the specific methods.
[0051] Example 1
[0052] Construction of plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro carrying EcTyr orthocyanin tRNA synthetase gene, green fluorescent protein gene with 191TAG mutation and puromycin resistance gene;
[0053] In this embodiment, the sequence of the EcTyr acrylamide tRNA synthetase gene is shown in SEQ ID NO: 1:
[0054] (1) Design primers OMeYRS-F and OMeYRS-R, and use existing plasmids containing the EcTyr orthogonal tRNA synthase gene as templates to amplify the EcTyr orthogonal tRNA synthase gene fragment.
[0055] (2) Design primers Puro-F and Puro-R, and use existing plasmids containing the puromycin resistance gene as templates to amplify the puromycin resistance gene fragment;
[0056] (3) Design primers EGFP-191TAG-F and EGFP-191TAG-R, and use existing plasmids containing the 191TAG mutant green fluorescent protein gene as templates to amplify the green fluorescent protein gene fragment with the 191TAG mutation.
[0057] (4) The plasmid carrying the PiggyBac transposon element was digested with restriction endonucleases EcoRI and NotI to obtain the vector;
[0058] (5) The EcTyr orthocyanin-tRNA synthetase gene fragment, puromycin resistance gene fragment, green fluorescent protein gene fragment with 191TAG mutation, and vector were recovered from agarose gel and assembled using Gibson chromatography. The resulting fragments were transformed into DH5α competent cells, and single clones were selected and sequenced to obtain the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro. The plasmid map is shown below. Figure 2 As shown in A;
[0059] The implementation principle of Example 1 is as follows: Using molecular cloning technology, the EcTyr orthocyanin tRNA synthetase gene, the green fluorescent protein gene with the 191TAG mutation, and the puromycin resistance gene were amplified by PCR, and then digested, assembled, and ligated with a plasmid backbone carrying the PiggyBac transposon element to construct the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro. This achieved the integration of the target gene and the selection marker gene on the same expression vector, which can be used for subsequent precise insertion and functionalization studies of specific non-natural amino acids in HEK293T cells.
[0060] Example 2
[0061] This example demonstrates the construction of a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene:
[0062] (1) Transfection of cells: The experimental group was transfected with plasmids pUC19-PB-EGFP-191TAG-OMeYRS-Puro and pB-Transposon at a ratio of 2:1 according to the standard transient plasmid transfection procedure. The control group was transfected with HEK293T cells according to the standard transient plasmid transfection procedure but without adding any plasmids.
[0063] (2) Remove the culture medium 24 h after cell transfection and add complete culture medium containing 2 μg / mL puromycin;
[0064] (3) After all the control group cells that were not transfected with plasmid died, the surviving cells in the experimental group were collected as a stable cell line that integrates the EcTyr aminoacyl-tRNA synthetase gene. The cell line was then cultured in a complete medium containing 1 μg / mL puromycin.
[0065] The implementation principle of Example 2 is as follows: Based on plasmid co-transfection technology, the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro, which contains the EcTyr aminoacyl-tRNA synthetase gene, green fluorescent protein gene, and puromycin resistance gene, is co-transfected with the plasmid pB-Transposon, which carries the PiggyBac transposase gene, into HEK293T cells. Puromycin resistance selection is used to ensure the survival of successfully transfected cells during culture and the establishment of stable cell lines. After removing the culture medium 24 hours post-transfection and selecting with puromycin-containing medium, HEK293T cells integrating the EcTyr aminoacyl-tRNA synthetase gene are finally selected. These cell lines can be further analyzed and applied in subsequent experiments.
[0066] Example 3
[0067] This example describes the construction of plasmid pUC19-PB-12*BSTyrT-Hygro, which carries 12 copies of the BsTyr tRNA gene and the hygromycin resistance gene.
[0068] The sequence of the BsTyr tRNA gene in this embodiment is shown in SEQ ID NO: 2:
[0069] (1) The existing plasmid containing 12 copies of the BsTyr tRNA gene was digested with restriction endonucleases EcoRI and XhoI to obtain a 12-copy BsTyr tRNA gene fragment.
[0070] (2) Design primers Hygro-F and Hygro-R, and use existing plasmids containing hygromycin resistance genes as templates to amplify hygromycin resistance gene fragments;
[0071] (3) The plasmid carrying the PiggyBac transposon element was digested with restriction endonucleases EcoRI and NotI to obtain the vector;
[0072] (4) The BsTyr tRNA gene fragment containing 12 copies, the hygromycin resistance gene fragment, and the vector were recovered from the agarose gel and assembled using Gibson chromatography. The resulting fragments were transformed into DH5α competent cells, and single clones were selected and sequenced to obtain the plasmid pUC19-PB-12*BSTyrT-Hygro. The plasmid map is shown below. Figure 2 As shown in B.
[0073] The implementation principle of Example 3 is as follows: Using molecular cloning technology, restriction endonuclease digestion and Gibson assembly, a plasmid containing 12 copies of the BsTyr tRNA gene, the hygromycin resistance gene, and the PiggyBac transposon element was constructed into the target plasmid pUC19-PB-12.* BSTyrT-Hygro;
[0074] First, the plasmid containing 12 copies of the BsTyr tRNA gene was digested with EcoRI and XhoI to obtain the target gene fragment;
[0075] Next, specific primers were designed to amplify the hygromycin resistance gene, and it was cloned with a vector containing PiggyBac transposon elements to ensure that each component could bind effectively.
[0076] All fragments were precisely assembled using the Gibson assembly method to construct a complete plasmid;
[0077] Finally, the plasmid was transformed into DH5α competent cells, and after screening and sequencing verification, the constructed plasmid pUC19-PB-12 was obtained. * BSTyrT-Hygro provides the necessary plasmid vector for the subsequent construction of stable cell lines.
[0078] Example 4
[0079] This embodiment describes the construction of a cell line integrating the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene;
[0080] (1) Transfection of cells: The experimental group was transfected with plasmids pUC19-PB-12*BSTyrT-Hygro and pB-Transposon at a ratio of 2:1 into a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene according to the standard transient plasmid transfection procedure. The control group was transfected with stable cell lines integrating the EcTyr aminoacyl-tRNA synthetase gene according to the standard transient plasmid transfection procedure but without adding any plasmids.
[0081] (2) After 24 hours of cell transfection, the culture medium was removed and a complete culture medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin was added.
[0082] (3) After all the control group cells that were not transfected with plasmids died, the surviving cells in the experimental group were collected as cell lines that integrated EcTyr aminoacyl-tRNA synthetase gene and BsTyr tRNA gene. The cell lines were then cultured in complete medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin.
[0083] The implementation principle of Example 4 is as follows: A stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene was constructed through plasmid transfection and dual antibiotic selection. First, plasmids pUC19-PB-12*BSTyrT-Hygro and pB-Transposon were transfected into the stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene at a ratio of 2:1. A standard transient plasmid transfection procedure was used to ensure efficient plasmid introduction during transfection. Twenty-four hours after transfection, the culture medium was removed and replaced with a complete culture medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin. Dual antibiotic selection was implemented to ensure that only cells successfully integrating the BsTyr tRNA gene survived. After the control group cells died completely due to the lack of plasmid transfection, surviving cells were selected from the experimental group. These cells successfully integrated the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene. After screening and validation, the resulting cell lines were continuously grown in antibiotic-containing culture media, eventually establishing stable gene-integrated cell lines. This provided a reliable cell model for further experiments. Through precise resistance screening and transfection techniques, the effective integration and stable expression of the target gene were ensured.
[0084] Example 5
[0085] This embodiment describes the screening of stable cell lines that integrate the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene and can efficiently introduce non-natural amino acids.
[0086] (1) Add 0.5 mM of O-methyl-L-tyrosine to the culture medium of the cell line obtained in Example 4 that integrates the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene. The structural formula of O-methyl-L-tyrosine is as follows: Figure 4 As shown;
[0087] (2) After culturing for 36 hours, remove the culture medium and add 1x PBS to wash away the residual culture medium;
[0088] (3) Remove the 1x PBS solution, digest with trypsin, neutralize with DMEM, centrifuge (200g, 2min), discard the supernatant, and resuspend the cells in 1x PBS solution containing 2% FBS;
[0089] (4) Use HEK293T cells to set the forward scattering and side scattering gates of the flow cytometer, and use cells expressing green fluorescent protein to set the parameters and gates of the FITC channel;
[0090] (5) Single-clonal FITC channel-positive cells were sorted by flow cytometry and cultured in complete medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin.
[0091] Experimental results of Example 5: Figure 5 The diagram shows a flowchart of the sorting of cells that efficiently express green fluorescent protein by flow cytometry. The experimental results show that the sorted cells all have obvious green fluorescent signals.
[0092] Example 6
[0093] This example is a verification of the EcTyr orthocyanin-tRNA synthetase gene and BsTyr tRNA gene sequences in a stable cell line;
[0094] (1) The genome of the cell line that integrates the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene, which was screened in Example 5, was extracted using a mammalian cell whole genome extraction kit;
[0095] (2) Design primers pUC19-RS-F and pUC19-RS-R to amplify the EcTyr aminoacyl-tRNA synthetase gene fragment using the genome extracted in step (1) as a template.
[0096] (3) Design primers pUC19-tRNA-F and pUC19-tRNA-R to amplify the BsTyr tRNA gene fragment using the genome extracted in step (1) as a template;
[0097] (4) The fragments amplified in steps (2) and (3) were identified by agarose gel electrophoresis to determine the fragment size, and the gene sequence was identified by sequencing after agarose gel recovery.
[0098] Experimental results: Experimental data are as follows Figure 6 A and 6B indicate that the fragments amplified by primers pUC19-RS-F and pUC19-RS-R have the target band at approximately 900 bp. Figure 6 A), which matches the size of the EcTyr aminoacyl-tRNA synthetase gene fragment, and the sequencing results completely match the EcTyr aminoacyl-tRNA synthetase gene sequence. Figure 6 B), the fragments amplified by primers pUC19-tRNA-F and pUC19-tRNA-R showed the target band at approximately 300 bp. Figure 6 A), which matches the size of the BsTyr tRNA gene fragment, and the sequencing results completely match the BsTyr tRNA gene sequence. Figure 6 B).
[0099] Example 7
[0100] Validation of amber-inhibiting activity in cell lines integrating EcTyr aminoacyl-tRNA synthetase gene and BsTyr tRNA gene;
[0101] (1) The cell lines that integrate EcTyr aminoacyl-tRNA synthetase gene and BsTyr tRNA gene screened in Example 5 were divided into two groups. The experimental group was cultured in a complete medium containing 0.5 mM O-methyl-L-tyrosine, 1 μg / mL puromycin and 400 μg / mL hygromycin, while the control group was cultured in a complete medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin.
[0102] (2) After culturing for 36 hours, remove the culture medium and add 1x PBS to wash away the residual culture medium;
[0103] (3) Remove 1x PBS solution, digest with trypsin, neutralize with DMEM, centrifuge (200g, 2min), discard the supernatant, and resuspend the cells with 1x PBS solution;
[0104] (4) Use HEK293T cells to set the forward scattering and side scattering gates of the flow cytometer, and use cells expressing green fluorescent protein to set the parameters and gates of the FITC channel;
[0105] (5) The cells in the experimental and control groups were measured, with 50,000 cells collected for each sample. The data were analyzed using the software FlowJo.
[0106] Experimental results: Experimental data are as follows Figure 6 C indicates that full-length green fluorescent protein can only be detected after the addition of non-natural amino acids, indicating that the obtained cell line has good amber inhibition activity.
[0107] Example 8
[0108] Identification of integration sites of EcTyr aminoacyl-tRNA synthetase gene and BsTyr tRNA gene
[0109] (1) Take the cells that integrate the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene screened in Example 5 and extract whole genome DNA;
[0110] (2) Select high-quality DNA samples that have passed the test (main band > 30kb);
[0111] (3) The fragments were randomly broken into segments (15-18kb) using a Covaris ultrasonic disruptor;
[0112] (4) Enriching and purifying large DNA fragments using magnetic beads;
[0113] (5) DNA fragmentation, damage repair, and end repair;
[0114] (6) Connect stem-circle sequencing adapters to both ends of the DNA fragments and remove the fragments that failed to connect using exonucleases;
[0115] (7) The constructed library was sequenced using the Pacbio Sequel II / Pacbio Sequel IIe platform;
[0116] (8) Perform bioinformatics analysis on the sequencing results.
[0117] Experimental results: Experimental data are as follows Figure 7 Tables A and B indicate that the EcTyr aminoacyl-tRNA synthetase gene is inserted near 195962277 of Chr1, with 2 supported reads; inserted near 49891692 of Chr1, with 5 supported reads; inserted near 63286698 of Chr1, with 2 supported reads; and inserted near 66690728 of Chr13, with 7 supported reads. The BsTyr tRNA gene is inserted near 809749 of ChrX, with 10 supported reads; inserted near 87795827 of Chr1, with 3 supported reads; and inserted near 189472218 of Chr1, with 12 supported reads. Figure 7 S1 is the EcTyr aminoacyl-tRNA synthetase gene fragment, and S2 is the BsTyr tRNA gene fragment.
[0118] sequence list
[0119] SEQ ID NO:1
[0120] DNA
[0121] ATGGACTACAAGGACGACGACGACAAGGCAAGCAGTAACTTGATTAAACAATTGCAAGAGCGGGGGCTG
[0122] GTAGCCCAGGTGACGGACGAGGAAGCGTTAGCAGAGCGACTGGCGCAAGGCCCGATCGCGCTCGTGTGC
[0123] GGCTTCGATCCTACCGCTGACAGCTTGCATTTGGGGCATCTTGTTCCATTGTTATGCCTGAAACGCTTC
[0124] CAGCAGGCGGGCCACAAGCCGGTTGCGCTGGTAGGCGGCGCGACGGGTCTGATTGGCGACCCGAGCTTC
[0125] AAAGCTGCCGAGCGTAAGCTGAACACCGAAGAAACTGTTCAGGAGTGGGTGGACAAAATCCGTAAGCAG
[0126] GTTGCCCCGTTCCTCGATTTCGACTGTGGAGAAAACTCTGCTATCGCGGCGAACAACTATGACTGGTTC
[0127] GGCAATATGAATGTGCTGACCTTCCTGCGCGATATTGGCAAACACTTCTCCGTTAACCAGATGATCAAC
[0128] AAAGAAGCGGTTAAGCAGCGTCTCAACCGTGAAGATCAGGGGATTTCGTTCACTGAGTTTTCCTACAAC
[0129] CTGTTGCAGGGTTATAGCATGGCCTGTCTGAACAAACAGTACGGTGTGGTGCTGCAAATTGGTGGTTCT
[0130] GACCAGTGGGGTAACATCACTTCTGGTATCGACCTGACCCGTCGTCTGCATCAGAATCAGGTGTTTGGC
[0131] CTGACCGTTCCGCTGATCACTAAAGCAGATGGCACCAAATTTGGTAAAACTGAAGGCGGCGCAGTCTGG
[0132] TTGGATCCGAAGAAAACCAGCCCGTACAAATTCTACCAGTTCTGGATCAACACTGCGCGTGCCGACGTT
[0133] TACCGCTTCCTGAAGTTCTTCACCTTTATGAGCATTGAAGAGATCAACGCCCTGGAAGAAGAAGATAAA
[0134] AACAGCGGTAAAGCACCGCGCGCCCAGTATGTACTGGCGGAGCAGGTGACTCGTCTGGTTCACGGTGAA
[0135] GAAGGTTTACAGGCGGCAAAACGTATTACCGAATGCCTGTTCAGCGGTTCTTTGAGTGCGCTGAGTGAA
[0136] GCGGACTTCGAACAGCTGGCGCAGGACGGCGTACCGATGGTTGAGATGGAAAAGGGCGCAGACCTGATG
[0137] CAGGCACTGGTCGATTCTGAACTGCAACCTTCCCGTGGTCAGGCACGTAAAACTATCGCCTCCAATGCC
[0138] ATCACCATTAACGGTGAAAAACAGTCCGATCCTGAATACTTCTTTAAAGAAGAAGATCGTCTGTTTGGT
[0139] CGTTTTACCTTACTGCGTCGCGGTAAAAAGAATTACTGTCTGATTTGCTGGAAAGGGCCCGTTTAA
[0140] SEQ ID NO:2
[0141] DNA
[0142] GGTGGGGTAGCGAAGTGGCTAAACGCGGCGGACTCTAAATCCGCTCCCTTTGGGTTTCGGCGGTTCGAAT
[0143] CCGTCCCCCACCA
[0144] The above are all preferred embodiments of this application, and are not intended to limit the scope of protection of this application. Therefore, all equivalent changes made in accordance with the structure, shape and principle of this application should be covered within the scope of protection of this application.
Claims
1. A cell line stably expressing an orthogonal aminoacyl tRNA synthetase / tRNA, characterized in that: The cell line has stably integrated in the genome: (a) an EcTyr aminoacyl tRNA synthetase gene as shown in SEQ ID NO: 1; (b) a BsTyr tRNA gene as shown in SEQ ID NO: 2; The cell line is used to introduce an unnatural amino acid O-methyl-L-tyrosine (OmeY) at any site of a target protein.
2. A cell line stably expressing an orthogonal aminoacyl tRNA synthetase / tRNA of claim 1, wherein: The cell line is constructed by the following steps: S1, ligate an EcTyr aminoacyl tRNA synthetase gene, a green fluorescent protein gene with a 191TAG mutation, and a puromycin resistance gene on plasmid pUC19-PB carrying a PiggyBac transposon element to obtain plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro; S2, co-transfect plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro and plasmid pB-Transposon carrying a PiggyBac transposase gene into HEK293T cells, and obtain a stable cell line integrating an EcTyr aminoacyl tRNA synthetase gene by puromycin resistance screening; S3, ligate 12 copies of a BsTyr tRNA gene and a hygromycin resistance gene on plasmid pUC19-PB carrying a PiggyBac transposon element to obtain plasmid pUC19-PB-12*BSTyrT-Hygro; S4, co-transfect plasmid pUC19-PB-12*BSTyrT-Hygro and plasmid pB-Transposon carrying a PiggyBac transposase gene into the stable cell line integrating an EcTyr aminoacyl tRNA synthetase gene, and obtain a stable cell line integrating an EcTyr aminoacyl tRNA synthetase gene and a BsTyr tRNA gene by hygromycin resistance screening and then sorting green fluorescent monoclonal cells by flow cytometry and expanding culture; S5, identify the integration site of the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene by whole genome sequencing.
3. The stable cell line expressing orthogonal aminoacyl tRNA synthetase / tRNA of claim 2, wherein: The cell line is HEK293T.
4. The stable cell line expressing orthogonal aminoacyl tRNA synthetase / tRNA of claim 2, wherein: The aminoacyl tRNA synthetase is an EcTyr aminoacyl synthetase gene, the sequence of which is shown in SEQ ID NO:
1.
5. The stable cell line expressing orthogonal aminoacyl tRNA synthetase / tRNA of claim 2, wherein: The tRNA is a BsTyr tRNA, the sequence of which is shown in SEQ ID NO:
2.
6. The stable cell line expressing orthogonal aminoacyl tRNA synthetase / tRNA of claim 2, wherein: The tRNA copy number is 12.
7. The cell line stably expressing orthocyanin-tRNA synthetase / tRNA as described in claim 1, characterized in that: The cell line can efficiently recognize a UAG codon.
8. A cell line stably expressing orthocyanin-tRNA synthetase / tRNA as described in claim 1, characterized in that: The encoded unnatural amino acid is O-methyl-L-tyrosine (OmeY). The cell line is HEK293T. The aminoacyl tRNA synthetase is an EcTyr aminoacyl synthetase gene, the sequence of which is shown in SEQ ID NO:
1. The tRNA is a BsTyr tRNA, the sequence of which is shown in SEQ ID NO:
2. The tRNA copy number is 12. The cell line can efficiently recognize a UAG codon. The encoded unnatural amino acid is O-methyl-L-tyrosine (OmeY).
Citation Information
Patent Citations
Orthogonal translation system and application of orthogonal translation system in functional protein expression aspect of redistribution codon recovery PTC (Positive Temperature Coefficient) disease
CN114908066A
Expression system and method of unnatural amino acid
CN120310832A