EccDNA molecule related to disease progress of type 2 diabetes mellitus model mouse and application of eccDNA molecule

Abstract

The invention provides an eccDNA molecule related to the disease progress of a type 2 diabetes model mouse and application of the eccDNA molecule, and belongs to the technical field of molecular markers, and the nucleotide sequence of the eccDNA molecule is as shown in SEQ ID NO.1. The eccDNA molecule is highly expressed in the late stage of a mouse with type 2 diabetes mellitus. The compound can be used for preparing a type 2 diabetes mellitus model mouse disease progress diagnosis preparation.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and specifically is an eccDNA molecule related to the disease progression of type 2 diabetes model mice and its application. Background Art

[0002] Type 2 diabetes mellitus (T2DM) is a complex metabolic disease characterized by insulin resistance and impaired insulin secretion, leading to elevated blood glucose levels. The global prevalence of T2DM has reached epidemic proportions, affecting approximately one-tenth of the population aged 20-79 years, and the number of people with diabetes worldwide is expected to reach 1.31 billion by 2050. Due to multiple factors such as genetic factors, obesity, and insulin resistance, clinical diagnosis and treatment of T2DM face even greater challenges. On the one hand, complications of T2DM such as cardiovascular disease, renal dysfunction, and retinopathy make its diagnosis even more difficult; on the other hand, T2DM also has genetic heterogeneity, coupled with complex environmental factors, which aggravates the management and treatment of clinical diseases.

[0003] Extrachromosomal circular DNA (eccDNA) is defined as double-stranded circular DNA molecules present in the cell nucleus, distinct from linear chromosomal DNA. These molecules range in size from small non-coding repetitive sequences to large fragments containing functional genes and have been identified in various eukaryotic organisms and human tissues. The biogenesis of eccDNA depends on many mechanisms, including rolling circular replication, break-induced replication, and recombination events. eccDNA plays a role in regulating gene expression and has the potential to affect the pathogenesis of the disease. The presence of eccDNA in genes related to metabolic regulation may serve as new diagnostic markers for the clinical diagnosis of T2DM and may affect disease progression.

[0004] At present, with the application of multi-omics technology, many scholars collect specimens at different stages of T2DM and detect various biological indicators for disease diagnosis. At present, the judgment of T2DM disease progression is mainly based on clinical information and biochemical indicators, and there are also studies based on microRNA, protein molecules, metabolites and exosomes in various omics technologies. However, there is no very clear biological indicator that can indicate the disease process. In addition, RNA molecules and proteins are easily degraded in vitro, and their repeatability and reliability still need further study. EccDNA has a closed circular structure and is resistant to exonuclease digestion, so they may be an ideal source of potential biomarkers. Due to its unique genetic background and pathological characteristics, db / db mice have become an ideal model for studying type 2 diabetes (T2D). These mice show naturally occurring obesity and diabetes symptoms due to leptin receptor gene mutations, including hyperglycemia, insulin resistance, abnormal sugar and lipid metabolism, and typical diabetic nephropathy. However, distinguishing the early and late disease states of T2DM has always been a challenge. The present invention has made a breakthrough through circular RNA sequencing technology and successfully identified specific eccDNA molecules that can accurately distinguish the early and late stages of the disease. This discovery not only provides a molecular basis for the staging of diabetes, but also points out the direction for future treatment strategies and drug development. Summary of the invention

[0005] To solve the problems in the prior art, an eccDNA molecule related to the disease progression of type 2 diabetes model mice and its application are disclosed.

[0006] The primary purpose of the present invention is to provide an eccDNA molecule associated with the disease progression of type 2 diabetes model mice. The molecule is a novel eccDNA abnormally expressed in late stage of type 2 diabetes model mice identified by circle-seq sequencing chr4:155354872-155355306 The molecule was identified and reverse PCR (quantitative polymerase chain reaction, PCR) combined with Sanger sequencing was used to verify its circular properties. Finally, the sample was expanded to verify that the eccDNA molecule was mainly present in the late specimens of type 2 diabetes model mice.

[0007] eccDNA chr4:155354872-155355306 The nucleotide sequence is shown in SEQ ID NO.1, specifically:

[0008] AATGTAAATAAATAATTTAATAAAGAAAAAGAAAAAAAAAGCAGAGCCATTAAAGGGAAGCTAGCCAGTTCTCATTAGTATTGTAACTCAGAAATAAGAAAGGACAGCCGCCGGGCGATGGTGGCGCACGCCTTTAATCCCAACACTTGGAAGGCAGAGGCAGGTGGATCTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAAGACCCCTG TCTGGCCTCAAACTTGCAGAGATTCGCCTGCCTCTGGCTCCAGAGTTCTGAGATTTTAAAGGCGAGTGCTACCACCACCCAGCTGAGGACCCTGGAAGACATTCCCCAGCAGAAACTCAAAGCCCAACCATTTCCATGTCAAACCCCATGTGTGTGTGAAGAACTCTGGGAGGGGACGTTGGGAATGGGGGATACATTTAG.

[0009] The eccDNA molecule is used to distinguish the early and late stages of type 2 diabetic mice, and the eccDNA molecule is highly expressed in the late stage of type 2 diabetic mice.

[0010] The second object of the present invention is to provide a method for detecting the eccDNA chr4:155354872-155355306 Application of molecules in the preparation of diagnostic preparations for the disease progression of type 2 diabetes model mice.

[0011] Furthermore, the disease progression diagnostic preparation for type 2 diabetes model mice contains a reagent for detecting the eccDNA molecule.

[0012] Furthermore, the reagent for detecting the eccDNA molecule includes a PCR detection reagent or an in situ hybridization detection reagent.

[0013] Furthermore, the PCR detection reagent includes an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0014] The upstream primer shown in SEQ ID NO.2: AATGTAAATAAATAATTTAATAAAG;

[0015] The downstream primer shown in SEQ ID NO.3: CTAAATGTATCCCCCATTCCCAA.

[0016] Beneficial effect: The present invention uses type 2 diabetes model mice to identify eccDNA that can indicate the progression of type 2 diabetes disease with the help of circle-seq chr4:155354872-155355306 The molecule was tested and its existence was verified by expanding the sample. The verification results also suggested that it has the ability to distinguish the early and late stages of type 2 diabetes. The molecule is abnormally expressed in the late stage of type 2 diabetes. The present invention also verified its ring-forming properties by reverse PCR and Sanger sequencing, and finally verified its effect by specimens. According to the results of agarose gel electrophoresis, the molecule can distinguish the early and late stages of type 2 diabetic mice. The molecule provides a certain molecular basis for the staging of type 2 diabetes and also provides a new direction for the study of markers of the disease process of type 2 diabetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a flow chart of eccDNA detection in an embodiment of the present invention.

[0018] Figure 2 Characteristics of eccDNA identified in early (8 weeks) and late (24 weeks) stages of type 2 diabetes model mice in the examples of the present invention.

[0019] Figure 3 In the embodiments of the present invention, eccDNA chr4:155354872-155355306 Annotation results of the source genes and proteins of the molecules.

[0020] Figure 4 For the eccDNA in the embodiment of the present invention chr4:155354872-155355306 The results of molecular application of inverse PCR and Sanger sequencing to verify the junction site;

[0021] Figure 5 PCR verification of eccDNA in the embodiment of the present invention chr4:155354872-155355306 Electrophoresis results of the expression levels of molecules in early and late specimens of type 2 diabetes model mice. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is described in detail below through embodiments, but the protection scope of the present invention is not limited to the embodiments.

[0023] Currently, the research tools and methods for eccDNA are mature and feasible. Through circle-seq sequencing combined with bioinformatics algorithms, eccDNA can be detected and analyzed, and the detected eccDNA can be verified using reverse PCR and Sanger sequencing.

[0024] The reagents or instruments used in the examples of the present invention without indicating the manufacturer are all conventional products that can be obtained through commercial purchase or other channels.

[0025] Example 1

[0026] 1. Model construction and specimen collection

[0027] The db / db knockout mice were used to construct a type 2 diabetes model, and early (8 weeks) and late (24 weeks) pancreatic islet tissue cells were isolated and then circle-seq sequencing was performed. Next, the type 2 diabetes disease model was reconstructed and the abnormally expressed eccDNA molecules were verified.

[0028] 2. eccDNA extraction method, the specific steps are as follows:

[0029] 1) Add proteinase K buffer to cells and resuspend them.

[0030] 2) Digestion at 50°C overnight;

[0031] 3) The digested samples were treated with alkali and purified by column according to the Plasmid MiniAX kit.

[0032] Transfer to A&A Plasmid MiniAX kit was used for extraction according to the instructions:

[0033] 1) Centrifuge at 500×g for 5 min, discard the supernatant and collect the precipitate.

[0034] 2) Add 600 μl of L1 cell suspension to suspend the cells.

[0035] 3) Add 600 μl of L2 lysis buffer and mix gently, then let stand at room temperature for 3 min.

[0036] 4) Add 600 μl of L3T neutralizing solution and mix gently until the color of the lysate disappears.

[0037] 5) Centrifuge at 12000×g for 5 min.

[0038] 6) Place the Plasmid 20 column into a 20 ml centrifuge tube.

[0039] 7) Add 1 ml of K1 equilibration solution to the Plasmid 20 column, let stand, and centrifuge briefly.

[0040] 8) Add the supernatant of the lysate obtained in step 5 to the Plasmid 20 column equilibrated in step 7, let stand, and centrifuge briefly.

[0041] 9) Add 4 ml of K2P washing solution to the Plasmid 20 column, let stand, and centrifuge briefly.

[0042] 10) Add 200 μl of K3 eluate to the Plasmid 20 column membrane, let stand, and centrifuge briefly.

[0043] 11) Transfer the Plasmid 20 column to a new 2 ml centrifuge tube.

[0044] 12) Add 1 ml of K3 eluent, let stand, centrifuge briefly and discard the Plasmid 20 column.

[0045] 13) Add 800 μl of PM precipitate to the eluted DNA.

[0046] 14) Invert the tube to mix the sample and centrifuge at 10,000 × g for 10 min.

[0047] 15) Discard the supernatant and retain the DNA pellet at the bottom of the tube.

[0048] 16) Add 500 μl of 70% ethanol, mix by gentle pipetting, and centrifuge at 10,000 × g for 5 min.

[0049] 17) Discard the supernatant and retain the DNA pellet at the bottom of the tube.

[0050] 18) Allow the DNA pellet to dry at room temperature for 5 minutes.

[0051] 19) Dissolve the dried DNA in 50-150 μl TE buffer.

[0052] 20) Store the dissolved DNA at -20°C until use.

[0053] The column-purified DNA was digested with FastDigest MssI (ThermoFisher) at 37°C for 16 hours to remove mitochondrial circular DNA. Plasmid-SafeATP-dependent DNase (Epicentre) was then added and incubated at 37°C. 30U of enzyme and the corresponding proportion of ATP were added to the sample every 24 hours for a total of 1 week to completely remove the remaining linear DNA. The treated sample was used as a template to amplify eccDNA using phi29 polymerase, and finally eccDNA that could be used for the next step of sequencing was obtained.

[0054] 3. Circle-seq sequencing method

[0055] The amplified DNA was fragmented using a Bioruptor sonicator. The library was constructed using UltraIIDNA Library Prep Kit and the library was sequenced on an Illumina NovaSeq sequencer using a 150 bp paired-end mode for high-throughput sequencing.

[0056] 4. PCR reaction

[0057] 1) Design eccDNA using Oligo 7 software chr4:155354872-155355306 Primers for molecular PCR reactions.

[0058] 2) Primer sequence:

[0059] SEQ ID NO.2, F: AATGTAAATAAATAATTTAATAAAG;

[0060] SEQ ID NO. 3, R: CTAAATGTATCCCCATTCCCAA.

[0061] 3) Amplification was performed using 2×PCR Master Mix (GenSeq Biotech, Inc.). PCR amplification system:

[0062]

[0063] 4) PCR reaction conditions: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, denaturation-annealing-extension for 30 cycles, then 72°C for 5 min and then transferred to 4°C for storage.

[0064] 5) 2% agarose gel to detect the target eccDNA molecules.

[0065] 5. Sanger sequencing verification

[0066] 1) Excise the agarose gel containing the target band of DNA under UV light (use Tiangen Biogel Recovery Kit DP214 to recover the PCR amplified DNA fragment).

[0067] 2) Weigh the gel block and calculate its volume (1 mg = 1 μl).

[0068] 3) Add 5 times the volume of Buffer GM to the gel.

[0069] 4) After uniform mixing, dissolve the rubber block at room temperature (15-25℃).

[0070] 5) Add isopropanol to the upward solution to a final concentration of 20%.

[0071] 6) Place the Spin Column in the kit on the Collection Tube.

[0072] 7) Transfer the solution from step 5 to the Spin Column, centrifuge at 12000×g for 1 min, and discard the filtrate.

[0073] 8) Add 700 μl of Buffer WB, centrifuge at 12,000 × g for 1 min at room temperature, and discard the filtrate (add the specified volume of anhydrous ethanol before use).

[0074] 9) Repeat step 8.

[0075] 10) Place the Spin Column on the Collection Tube and centrifuge at 12000×g for 2 min at room temperature.

[0076] 11) Place the Spin Column in a new 1.5 ml centrifuge tube, add 30 μl of sterile Elution Buffer to the center of the Spin Column membrane, and let stand at room temperature for 1 min.

[0077] 12) Centrifuge at 12000×g for 1 min to elute DNA for Sanger sequencing.

[0078] 6. Results

[0079] In this example, normal control mice and db / db mice that can spontaneously develop type 2 diabetes were raised to 8 weeks and 24 weeks of age, respectively, and pancreatic islet tissue was isolated for circle-seq sequencing. The sample preparation and analysis process is shown in Figure 1 After Circle-seq sequencing, a large number of eccDNA molecules were detected. A total of 1538 eccDNA molecules were detected in the 8-week-old group and 20804 eccDNA molecules were detected in the 24-week-old group. The distribution of all eccDNA on the chromosome is shown in Figure 2 From the results, it can be seen that the number of eccDNA molecules in the pancreatic islets of type 2 diabetic mice in the late stage, that is, 24 weeks of age, increased significantly, indicating that the large increase in eccDNA molecules is related to the development of the disease. Through further analysis, it was found that the eccDNA derived from the gene Prkcz, which is closely related to the progression of diabetes, chr4:155354872-155355306 The expression level was significantly increased ( Figure 3 Based on this, the eccDNA was subjected to inverse PCR and Sanger sequencing, and the results showed that it had a circular structure and the nucleotide sequence of the junction site was ACCC ( Figure 4 Finally, the type 2 diabetes mouse model was reconstructed and the abnormally expressed eccDNA chr4 :155354872-155355306 The results showed that the eccDNA molecule was only expressed in 24-week-old type 2 diabetic mice ( Figure 5 ), suggesting that this molecule can be used as a marker molecule to judge the disease progression of type 2 diabetes model mice and that this molecule is abnormally expressed in the late stage of type 2 diabetes.

[0080] As described above, although the present invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the present invention itself. Various changes in form and details may be made without departing from the spirit and scope of the present invention.

Claims

1. An eccDNA molecule associated with the disease progression of type 2 diabetes model mice, characterized in that: The nucleotide sequence of the eccDNA molecule is shown in SEQ ID NO.

1.

2. The eccDNA molecule according to claim 1, characterized in that The eccDNA molecule is used to distinguish the early and late stages of type 2 diabetic mice, and the eccDNA molecule is highly expressed in the late stage of type 2 diabetic mice.

3. Use of the eccDNA molecule according to claim 1 or 2 in preparing a disease progression diagnostic preparation for type 2 diabetes model mice.

4. The use according to claim 3, characterized in that: The disease progression diagnostic preparation for type 2 diabetes model mice contains a reagent for detecting the eccDNA molecule.

5. The use according to claim 4, characterized in that: The reagents for detecting the eccDNA molecules include PCR detection reagents or in situ hybridization detection reagents.

6. The use according to claim 5, characterized in that: The PCR detection reagent includes an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

Images