CsChr5-GW molecular marker for identifying Gangxi navel oranges and application of CsChr5-GW molecular marker

Abstract

The invention belongs to the technical field of plant breeding, and particularly relates to a CsChr5-GW molecular marker for identifying Gangxi navel oranges and application of the CsChr5-GW molecular marker. The CsChr5-GW molecular marker disclosed by the invention has deletion or insertion polymorphism of nucleotide as shown in SEQ ID NO. 1. A specific band with the length of about 296bp can be amplified in the Jiangxi navel orange by utilizing the primer, and corresponding bands do not exist in other varieties of navel oranges. The specific strip can be used as a molecular marker, the navel oranges and other navel orange varieties can be accurately and rapidly distinguished, and the molecular marker has the advantages that the detection is simple and convenient, the detection result is accurate and reliable, and the sample is easy to obtain.

Description

Technical Field

[0001] The invention belongs to the technical field of plant breeding, and particularly relates to a CsChr5-GW molecular marker for identifying Ganwan navel orange and an application thereof. Background Art

[0002] As the main production area of ​​navel orange industry in my country, southern Jiangxi has stable navel orange quality and rich variety structure, but the imbalance of navel orange maturity period is a key factor restricting the development of the industry. Navel oranges in some areas failed to mature within the best market window period, unable to meet the needs of consumers, and then there was a phenomenon of unsalable products. Therefore, in order to avoid the supply gap of fresh citrus fruits on the market, it is an effective way to improve the overall benefits of the citrus industry to explore new citrus varieties with different maturity periods, reasonably adjust the distribution of maturity periods, and extend the sales period of citrus. In order to select and create more excellent citrus germplasms, in the early experiments, the inventor selected an excellent single plant from the bud mutation material of "Lunwan" navel orange. The germplasm matures more than 15 days earlier than the Lunwan navel orange, the flesh is crisp and tender, the fruit shape is longer than the Lunwan, the fruit top is more convex, and the yield is high and stable. It is named Ganwan navel orange. However, the juvenile period of citrus is long, and it is difficult to identify fruit traits during the juvenile period. Therefore, how to distinguish Ganwan navel orange from other navel orange varieties has become a difficulty in the breeding process of Ganwan navel orange.

[0003] At present, a variety of molecular markers have been applied to the evaluation of genetic diversity of Chinese citrus resources, mining and analysis of germplasm resources, identification of kinship and molecular marker-assisted breeding. However, there is still a lack of a method that can identify Ganwan navel oranges at an early stage and distinguish them from other navel orange varieties. Therefore, how to screen a molecular marker that can specifically identify Ganwan navel oranges and can be used to quickly identify the "Ganwan" variety has become an urgent problem to be solved in this field. Summary of the invention

[0004] In order to solve the problem that multiple pairs of primers are usually required to identify citrus varieties in the prior art, the present invention provides a molecular marker that can quickly identify the "Ganwan" navel orange variety. Only one pair of primers can be used to identify the "Ganwan" variety, and specifically includes the following technical solutions:

[0005] A CsChr5-GW molecular marker for identifying Ganwan navel orange, wherein the CsChr5-GW molecular marker has a deletion or insertion polymorphism of a nucleotide as shown in SEQ ID NO.1.

[0006] The present invention also provides a primer for amplifying the CsChr5-GW molecular marker as described above, comprising a forward primer as shown in SEQ ID NO.4 and a reverse primer as shown in SEQ ID NO.5.

[0007] The present invention also provides a kit for identifying Ganwan navel orange, comprising the forward primer and reverse primer as described above.

[0008] Preferably, the kit further comprises a PCR amplification reagent.

[0009] Preferably, the PCR amplification reagents include: 1 μl of 100 ng / μl genomic DNA, 5 μl of 2×PhantaFlashMasterMix, 0.4 μl of upstream primer, 0.4 μl of downstream primer and 3.2 μl of ddH2O.

[0010] Preferably, the kit also includes a Ganwan navel orange amplified fragment standard.

[0011] Preferably, the Ganwan navel orange amplified fragment standard comprises a DNA fragment with a sequence as shown in SEQ ID NO.1.

[0012] The present invention also provides a method for identifying Ganwan navel orange based on CsChr5-GW molecular marker, comprising the following steps:

[0013] Extracting genomic DNA from the sample to be tested;

[0014] Using the genomic DNA as a template, performing PCR amplification on the genomic DNA using the primers described above to obtain a PCR amplification product;

[0015] Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result;

[0016] Identify the sample to be tested according to the electrophoresis detection result and judge the result;

[0017] When the electrophoresis test results show a 296bp PCR amplification band, it is Ganwan navel orange;

[0018] When the electrophoresis test results show that there is no 296bp PCR amplification band, it is not Ganwan navel orange.

[0019] Preferably, the reaction system for PCR amplification includes the following components: 1 μl of 100 ng / μl genomic DNA, 5 μl of 2×PhantaFlashMasterMix, 0.4 μl of upstream primer, 0.4 μl of downstream primer and 3.2 μl of ddH2O.

[0020] Preferably, the reaction procedure of the PCR amplification is as follows:

[0021] Denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 35°C for 5 s, extension at 72°C for 15 s, 35 cycles; extension at 72°C for 1 min.

[0022] The beneficial effects of the present invention are:

[0023] The present invention provides a CsChr5-GW molecular marker for identifying Ganwan navel orange, wherein the CsChr5-GW molecular marker has a deletion or insertion polymorphism of nucleotides as shown in SEQ ID NO. 1. The present invention firstly identifies a structural variation site formed by a base sequence deletion on a Chr5 chromosome in a late-maturing navel orange germplasm "Ganwan", and designs a CsChr5-GW molecular marker through the variation site. The CsChr5-GW molecular marker can be used to quickly identify Ganwan navel orange varieties, and the present invention lays a foundation for the detection of Ganwan navel orange seedlings and molecular marker-assisted citrus germplasm screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0025] Figure 1 The fruit morphology of Ganwan and Lunwan navel oranges in Example 1 is compared;

[0026] Figure 2 This is a schematic diagram of the difference in chromosome sequence of Chr5 between Ganwan and Lunwan navel oranges in Example 1;

[0027] Figure 3 The detection results of the molecular marker CsChr5-GW in Example 1 for detecting Ganwan navel orange and Lunwan navel orange;

[0028] Among them, M is DL-5000 Marker, GW is Ganwan navel orange, LW is Lunwan navel orange, lane 1 is CsChr3-GW to detect the band type of Ganwan navel orange, and lane 2 is CsChr3-LW to detect the band type of Lunwan navel orange;

[0029] Figure 4 The detection results of the molecular marker CsChr5-GW in Example 2 for Ganwan and other navel orange varieties in southern Jiangxi;

[0030] Among them, lane 1 is M for DL-5000Marker, lane 2 is GW for CsChr3-GW to detect Ganwan band type, lane 3 is LW for CsChr3-LW to detect Lunwan navel orange band type, lanes 4 to 14 are lanes marked 1 to 11, and the corresponding navel orange varieties are Newhall, Qingjia, Gannan Early, Pumpkin Navel Orange, Lunwan, Fukumoto, IH Navel Orange, Caracara, Navel Blood Orange, Baogong Orange's Newhall bud mutation material, and Newhall. DETAILED DESCRIPTION

[0031] The invention provides a CsChr5-GW molecular marker for identifying Ganwan navel orange. The CsChr5-GW molecular marker has a deletion or insertion polymorphism of a nucleotide as shown in SEQ ID NO.1.

[0032] SEQ ID NO.1: 5'-TATATATATATATATATATATATATATATATATATATATA-3';

[0033] The sequence including the CsChr5-GW molecular marker is shown in SEQ ID NO.2.

[0034] SEQ ID NO.2: 5'-ACAAATAAACTGAAGGTGGCTAGCTAATTAATTAT CTTTTATTTTATATTAGTATGTTAAATATCTAAATTACTCTTGTAACTTAATAATGATACATATTGTAAATTTAGGGTAGATGAATGATGCAATTTAAAAGTATTGTAGTTATATATATATATATATATAT ATATATATATATATATATATATATATATATATATATAGCAAGACAATTCAAAAGTATATGATTAATAATTTCTCATTATATTTTTATGTAGTTATATAGATTCACACGAATATGATCATATGTAAGT-3';

[0035] The sequence of the missing CsChr5-GW molecular marker polymorphism is shown in SEQ ID NO.3.

[0036] SEQ ID NO.3: 5'-ACAAATAAACTGAAGGTGGCTAGCTAATTAATTATCT TTTATTTTATATTTAGTATGTTAAATATCTAAATTACTCTTGTAACTTAATAAT GATACATATTGTAAATTTAGGGTAGATGAATGATGCAATTTAAAAGTATTGTA GTTA (missing 40 bp) TATATATATATATATATAGCAAGACAATTCAAAAGTATAT GATTAATAATTTCTCATTATATTTTTATGTAGTTATATAGATTCACACGAATAT GATCATATGTAAGT-3';

[0037] The present invention also provides a primer for amplifying the CsChr5-GW molecular marker, comprising a forward primer as shown in SEQ ID NO.4 and a reverse primer as shown in SEQ ID NO.5.

[0038] CsChr5-GW-F (SEQ ID NO.4): 5'-ACAAATAAACTGAAGGTGGCTAG C-3';

[0039] CsChr5-GW-R (SEQ ID NO.5): 5'-ACTTACATATGATCATATTCGTGT GAAC-3';

[0040] The invention provides a kit for identifying Ganwan navel orange, comprising the forward primer and reverse primer as described above.

[0041] As an embodiment, the kit of the present invention further comprises a PCR amplification reagent. As an embodiment, the kit of the present invention further comprises a Ganwan navel orange amplified fragment standard. As an embodiment, the Ganwan navel orange amplified fragment standard comprises a DNA fragment with a sequence as shown in SEQ ID NO.1.

[0042] The present invention also provides the use of the CsChr5-GW molecular marker, primer or the kit described above in identifying Ganwan navel orange.

[0043] The present invention also provides a method for identifying Ganwan navel orange based on CsChr5-GW molecular marker, comprising the following steps:

[0044] Extract genomic DNA of the sample to be tested; use the genomic DNA as a template and perform PCR amplification on the genomic DNA using the primers as described above to obtain PCR amplification products; perform electrophoresis detection on the PCR amplification products to obtain electrophoresis detection results; identify the sample to be tested based on the electrophoresis detection results: when the electrophoresis detection results show a 296bp PCR amplification band, it is Ganwan navel orange; when the electrophoresis detection results show no 296bp PCR amplification band, it is not Ganwan navel orange.

[0045] As an embodiment, the present invention uses the CTAB method to extract the genomic DNA of the sample to be tested. As an embodiment, the reaction system of PCR amplification in the present invention includes the following components: 1μl of 100ng / μl genomic DNA, 5μl of 2×PhantaFlashMasterMix, 0.4μl of upstream primer, 0.4μl of downstream primer and 3.2μl of ddH2O. As an embodiment, the reaction procedure of PCR amplification in the present invention is as follows: denaturation at 98℃ for 30s; denaturation at 98℃ for 10s, annealing at 35℃ for 5s, extension at 72℃ for 15s, 35 cycles; extension at 72℃ for 1min.

[0046] To further illustrate the present invention, the CsChr5-GW molecular marker for identifying Ganwan navel orange provided by the present invention is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1 Identification of differential sites and development of molecular markers

[0048] (1) Identification of differential sites

[0049] The material samples of Ganwan navel orange and Lunwan navel orange used in the present invention were taken from the navel orange nursery of Ganzhou Huachun Nursery Engineering Co., Ltd. The appearance of the fruits of Ganwan navel orange and Lunwan navel orange are compared as follows: Figure 1 In this example, three biological replicates were performed on the material samples of Ganwan navel orange and Lunwan navel orange respectively.

[0050] The DNA of Ganwan navel orange leaves and Lunwan navel orange leaves was extracted by CTAB method and then library was constructed. The next generation sequencing was performed at a depth of 30×. The sweet orange genome was used as a reference (http: / / citrus.hzau.edu.cn), and the sequencing data was analyzed on a Linux server. Through alignment, a fragment deletion was identified at the 9801549 site of Chr5 chromosome.

[0051] (2) Differential site sequence cloning analysis

[0052] In order to further clarify the sequence variation characteristics, primers were designed based on the reference genome, namely the Chr5 chromosome 9801401-9801696 sequence of the sweet orange genome. The primer sequences are shown in SEQ ID NO.4 and SEQ ID NO.5;

[0053] Using Ganwan and Lunwan navel orange DNA as templates, the variant sequences were cloned. The results showed that the sequence of the 9801549 site of the Lunwan navel orange Chr5 chromosome was consistent with the reference genome, while the 9801549 site of the Ganwan Chr5 chromosome was missing a 40bp sequence. The chromosome sequence differences were as follows: Figure 2 shown.

[0054] (3) Molecular marker design

[0055] In this embodiment, a molecular marker primer pair is designed according to the characteristics of the deletion sequence. The molecular marker primer pair is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0056] (4) Molecular marker identification of Ganwan and Lunwan navel orange materials

[0057] The CTAB method was used to extract DNA from leaves of Ganwan navel orange and Lunwan navel orange materials for molecular marker identification.

[0058] In molecular marker identification, the PCR reaction system used was 10 μl in total, and the raw materials were as follows:

[0059] 1 μl of 100 ng / μl DNA, 5 μl of 2×PhantaFlashMasterMix (Nanjing Novezan Co., Ltd.), 0.4 μl of upstream primer (SEQ ID NO.4), 0.4 μl of downstream primer (SEQ ID NO.5), and 3.2 μl of ddH2O.

[0060] The PCR reaction procedure is as follows:

[0061] Denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 53°C for 5s and extension at 72°C for 15s, repeated for 35 cycles; extension at 72°C for 1min; storage at 10°C to obtain the PCR amplification product.

[0062] The PCR amplification product was electrophoresed on 2% agarose gel and imaged and analyzed using a gel imaging system. Figure 3 shown.

[0063] (5) Results and analysis

[0064] Depend on Figure 3 It can be seen that the molecular marker CsChr5-GW can distinguish between Ganwan navel orange and Lunwan navel orange. In the gel image of the identification, CsChr5-GW is a linear marker with two band types, with band sizes of 296bp and no band. The one with a 296bp band is Ganwan navel orange, and the one without a band is Lunwan navel orange.

[0065] Example 2 Identification of Ganwan and other navel orange germplasms by CsChr5-GW

[0066] (1) Detection of Ganwan and other navel orange germplasms using CsChr5-GW molecular markers

[0067] The CTAB method was used to extract leaf DNA of Ganwan and other navel orange materials for molecular marker identification. The other navel orange materials were Newhall, Qingjia, Gannan Zao, Pumpkin Navel Orange, Lunwan, Fukumoto, IH Navel Orange, Cara Cara, Navel Blood Orange, Newhall bud mutation material of Baogong Orange, and Newhall. The experiment was repeated 3 times for each material.

[0068] PCR reaction system 10μl, raw materials are as follows:

[0069] 1 μl of 100 ng / μl DNA, 5 μl of 2×PhantaFlashMasterMix (Nanjing Novezan Co., Ltd.), 0.4 μl of upstream primer (SEQ ID NO.4), 0.4 μl of downstream primer (SEQ ID NO.5), and 3.2 μl of ddH2O.

[0070] The PCR reaction procedure is as follows:

[0071] Denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 53°C for 5s, extension at 72°C for 15s, repeated for 35 cycles; extension at 72°C for 1min; storage at 10°C to obtain the PCR amplification product.

[0072] The PCR amplification product was electrophoresed on 2% agarose gel, and the image was collected and analyzed using a gel imaging system. The result of one of the repeated experiments was randomly selected for display. The results are shown in the figure. Figure 4 shown.

[0073] (2) Results and analysis

[0074] Depend on Figure 4 It can be seen that the molecular marker CsChr5-GW can distinguish Ganwan navel orange from other navel orange germplasms. In the gel image of the identification, the linear markers obtained after electrophoresis of different samples using the molecular marker CsChr5-GW have two types of bands, with a band size of 296bp and a band without 296bp. The one with a 296bp band is Ganwan navel orange, and the other navel orange germplasms have no band. The results are as follows Figure 4 shown.

[0075] In summary, the present invention provides a CsChr5-GW molecular marker that can be used to distinguish Ganwan navel orange from other navel orange germplasms. The CsChr5-GW molecular marker can be used to quickly and accurately identify Ganwan navel orange varieties. The present invention lays a foundation for the detection of Ganwan navel orange seedlings and molecular marker-assisted citrus germplasm screening.

[0076] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments like this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A CsChr5-GW molecular marker for identifying Ganwan navel orange, characterized in that: The CsChr5-GW molecular marker has a deletion or insertion polymorphism of the nucleotides shown in SEQ ID NO.

1.

2. A primer for amplifying the CsChr5-GW molecular marker according to claim 1, characterized in that: It includes a forward primer as shown in SEQ ID NO.4 and a reverse primer as shown in SEQ ID NO.

5.

3. A kit for identifying Ganwan navel orange, characterized in that: Comprising a forward primer and a reverse primer as described in claim 2.

4. The kit according to claim 3, characterized in that The kit also includes PCR amplification reagents.

5. The kit according to claim 4, characterized in that The PCR amplification reagents include: 1 μl of 100 ng / μl genomic DNA, 5 μl of 2×PhantaFlashMasterMix, 0.4 μl of upstream primer, 0.4 μl of downstream primer and 3.2 μl of ddH2O.

6. The kit according to any one of claims 3 to 5, characterized in that The kit also includes a Ganwan navel orange amplified fragment standard.

7. The kit according to claim 6, characterized in that The Ganwan navel orange amplified fragment standard comprises a DNA fragment whose sequence is shown in SEQ ID NO.

1.

8. A method for identifying Ganwan navel orange based on CsChr5-GW molecular marker, characterized in that: The following steps are involved: Extracting genomic DNA from the sample to be tested; Using the genomic DNA as a template, performing PCR amplification on the genomic DNA using the primers described in claim 2 to obtain a PCR amplification product; Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result; Identify the sample to be tested according to the electrophoresis detection result and judge the result; When the electrophoresis test results show a 296bp PCR amplification band, it is Ganwan navel orange; When the electrophoresis test results show that there is no 296bp PCR amplification band, it is not Ganwan navel orange.

9. The method according to claim 8, characterized in that The PCR amplification reaction system includes the following components: 1 μl of 100 ng / μl genomic DNA, 5 μl of 2×PhantaFlashMasterMix, 0.4 μl of upstream primer, 0.4 μl of downstream primer and 3.2 μl of ddH2O.

10. The method according to claim 9, characterized in that The reaction procedure of the PCR amplification is as follows: Denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 35°C for 5 s, extension at 72°C for 15 s, 35 cycles; extension at 72°C for 1 min.

Images