Cell formulations and methods for treating Parkinson's disease

Abstract

The invention belongs to the technical field of biological medicine and neuroscience. Specifically, the present invention provides a cellular formulation for the treatment of Parkinson's disease comprising midbrain dopaminergic nerve precursor cells and a physiologically compatible solution wherein the cellular formulation is formulated as an injectable formulation for administration against the parathalamic nucleus (PF) region. The present invention also provides a method of treating Parkinson's disease comprising administering midbrain dopaminergic nerve precursor cells to a parathalamic nucleus (PF) region of a subject in need thereof.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and neuroscience technology, and specifically relates to a cell preparation and method for treating Parkinson's disease. Background Art

[0002] Parkinson's disease is a progressive neurodegenerative disease. Typical motor symptoms include resting tremor, bradykinesia, rigidity, and postural instability, accompanied by loss of dopaminergic neurons and Lewy pathology. Over time, decreased neurotransmitter levels, oxidative stress, mitochondrial dysfunction, and protein homeostasis disorders all worsen the disease manifestations in the elderly. However, various non-motor symptoms (NMS) often precede motor symptoms. Prodromal symptoms are important as clinical biomarkers to identify patients in the pre-motor stage, especially when fluid and imaging biomarkers are lacking. They include hyposmia, sleep abnormalities, autonomic dysfunction, and psychiatric problems. Some prodromal symptoms such as anxiety / depression, cognitive decline, and drowsiness are more frequent and become problematic in the late stages. These non-motor symptoms should be weighted as prodromal biomarkers based on their prevalence in PD patients, their diagnostic strength in predicting future PD development, the lead time for diagnosing PD, and the feasibility of assessment and screening (Postuma RB, Berg D., Advances in markers of prodromal Parkinson disease. Nat. Rev. Neurol. 2016; 12: 622–634).

[0003] Currently, the treatment strategies for Parkinson's disease are aimed at providing symptom relief and slowing disease progression. However, no pharmacological breakthroughs have been achieved in protecting dopaminergic neurons and related motor circuit components. Since the 1950s, a large number of clinical studies have demonstrated the great potential of cell therapy in the treatment of various neurological diseases, such as neural stem cells for the treatment of spinal cord injury and dopaminergic neurons for the treatment of Parkinson's disease. Cell therapy has the potential to become one of the most promising treatments for neurological diseases.

[0004] There are specific dopaminergic neuron subpopulations in the human substantia nigra compacta (SNc). In primates, the dopaminergic neurons in the dorsal layer of the SNc (dSNc) receive projections from the caudate nucleus and the anterior putamen, and project to the caudate nucleus and the anterior putamen, which are themselves innervated by the associative cortex (Haber SNet al., Journal of Neuroscience 15 March 2000, 20 (6) 2369-2382). On the other hand, the dopaminergic neurons in the ventral layer (vSNc) receive innervation from the caudate nucleus and the anterior putamen, the intermediate putamen, and the posterior putamen, and almost completely innervate the intermediate putamen and the posterior putamen. In PD, significant degeneration of dopaminergic neurons is observed in both substantia nigra subpopulations; however, neuronal loss in the vSNc precedes that observed in the dorsal layer and is relatively much more severe (Gibb WR, Lees AJ, Anatomy, pigmentation, ventral and dorsal subpopulations of the substantia nigra, and differential cell death in Parkinson's disease. J Neurol Neurosurg Psychiatry. 1991 May; 54 (5): 388-96). Determining the etiological factors that distinguish the ventral and dorsal layers of the SNc in PD will greatly facilitate our understanding of the specific spatiotemporal progression of dopaminergic neuron death in this disease. Therefore, in the study of etiology, in cell replacement therapy, people will give priority to considering transplanting cells into the substantia nigra for treatment. However, the substantia nigra is deeper and smaller than other brain regions. Therefore, in terms of surgical difficulty and physical damage to other brain regions in the brain, the risk of cell transplantation into the substantia nigra is very high. The substantia nigra is not the most suitable transplant area.

[0005] The pathological hallmark of Parkinson's disease (PD) is the progressive loss of midbrain dopamine (DA) neurons in the substantia nigra, which leads to depletion of striatal DA fibers. However, the characteristic motor signs of PD only appear after extensive nigrostriatal degeneration has occurred, which is associated with changes in many components of the extrapyramidal motor system. It is therefore speculated that PD only occurs when the extent of striatal dopamine depletion exceeds the tolerance of compensatory or adaptive mechanisms. A large number of experimental studies, including those in nonhuman primates (NHPs), have shown that transplantation of fetal midbrain tissue in the putamen region can improve the motor symptoms of animals. The emergence of human pluripotent stem cells (hPSCs), including induced pluripotent stem cells (iPSCs), has provided a continuous source for the generation of specific cell populations, such as DA neurons. In fact, hPSC-derived DA neurons form connections with host cells after transplantation and improve motor function in rodent and NHP PD models, thus preparing for clinical application.

[0006] Therefore, a large number of studies have chosen to transplant specific cells into the striatum / putamen to treat Parkinson's disease, and have obtained a large number of positive research results, greatly improving the motor symptoms of experimental animals. However, the clinical management of Parkinson's disease needs to focus not only on its motor characteristics, but also on non-motor characteristics. This is because many patients will develop neuropsychiatric disorders during the course of their PD, including depression, anxiety, sleep disorders, psychosis, and behavioral and cognitive changes (Aarsland D. et al., Neuropsychiatric symptoms in Parkinson's disease. MovDisord. 2009; 24: 2175–2186). For patients and their families, these neuropsychiatric disorders are often more problematic and more painful than the motor aspects of PD.

[0007] Currently, there are no cell therapy drugs or treatments that can simultaneously improve both the motor and non-motor symptoms of Parkinson's disease. This situation needs to be changed urgently. Summary of the invention

[0008] In one aspect, the present invention provides a cell preparation comprising midbrain dopaminergic neural precursor cells and a physiologically compatible solution, wherein the cell preparation is formulated as an injectable preparation for administration to the parafascicular nucleus (PF) region of the thalamus, and the content of OTX2+EN1+ cells in the cell preparation is greater than 80%; the content of FOXA2+LMX1A+ cells is greater than 80%; and the content of CD166+Corin+ cells is greater than 80%.

[0009] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared from pluripotent stem cells. In a preferred embodiment, the pluripotent stem cells are induced pluripotent stem cells.

[0010] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps:

[0011] (1) culturing the pluripotent stem cells for a first time with a first culture medium, and then culturing them for a second time with a second culture medium to obtain midbrain floor plate cells;

[0012] (2) culturing the midbrain floor plate cells for a third time using a third culture medium to obtain midbrain dopaminergic neural progenitor cells; and

[0013] (3) culturing the midbrain dopaminergic neural progenitor cells for a fourth time using a fourth culture medium, and then culturing them for a fifth time using a fifth culture medium to obtain the midbrain dopaminergic neural progenitor cells;

[0014] in

[0015] The first culture medium comprises a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist;

[0016] The second culture medium comprises a ROCK inhibitor, a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist;

[0017] The third culture medium comprises a BMP4 inhibitor, a SHH agonist and a growth factor;

[0018] The fourth culture medium comprises a SHH agonist and a growth factor; and

[0019] The fifth culture medium comprises a ROCK inhibitor, a SHH agonist and a growth factor.

[0020] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps:

[0021] (1) culturing human induced pluripotent stem cells in a first culture medium for 6-10 days, and then culturing them in a second culture medium for 1-3 days in suspension to obtain midbrain floor plate cells;

[0022] (2) suspending and culturing the midbrain floor plate cells in a third culture medium for 3-7 days to obtain midbrain dopaminergic neural progenitor cells; and

[0023] (3) culturing the midbrain dopaminergic neural progenitor cells with the fourth culture medium for 5-9 days, and then culturing them in suspension with the fifth culture medium for 0.5-1.5 days to obtain the midbrain dopaminergic neural progenitor cells;

[0024] in

[0025] The first culture medium comprises SB431542, DMH-1, CHIR99021 and SAG;

[0026] The second culture medium comprises Y-27632, SB431542, DMH-1, CHIR99021 and SAG;

[0027] The third culture medium comprises DMH-1, SAG and FGF8b;

[0028] The fourth culture medium comprises SAG and FGF8b; and

[0029] The fifth culture medium contains Y-27632, SAG and FGF8b.

[0030] The present invention also provides use of the cell preparation in preparing a drug for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or diseases induced by Parkinson's disease.

[0031] In another aspect, the present invention provides a method for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases, comprising administering midbrain dopaminergic neural precursor cells to the parafascicular nucleus (PF) region of the thalamus of a subject in need thereof.

[0032] The cell preparation and method of the present invention can improve the motor symptoms and / or non-motor symptoms of Parkinson's disease. In one embodiment, the motor symptoms are selected from: dystonia, chorea, athetosis, motor symptom fluctuations, abnormal posture, speech disorders, bradykinesia, gait freezing, tremor, rigidity, walking and gait difficulties. In one embodiment, the non-motor symptoms are selected from: blood pressure regulation disorders, sleep disorders, sensory disorders, autonomic dysfunction, mood swings, cognitive disorders, hallucinations, delusions, anxiety, dementia and depression. In one embodiment, the Parkinson's disease-induced disease is Parkinson's disease-induced depression or Parkinson's disease-induced anxiety or Parkinson's disease-induced mood disorders. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Schematic diagram of the differentiation of human pluripotent stem cells into dopaminergic neural precursor cells and dopamine neurons.

[0034] Figure 2 The morphology of cells at different stages of iPSC differentiation induced by the method of Example 1.2 is shown: A, D0 (day 0 of differentiation); B, D7; C, D15; D, D20; E, D24; F, D26; G, D40; the scale bar is 200 μm.

[0035] Figure 3The dopaminergic neural precursor cell immunofluorescence staining obtained in Example 1.2 is shown: A, DAPI; B, OTX2; C, EN1; D, merged image of A, B and C; E, DAPI; F, FOXA2; G, LMX1A; H, merged image of E, F and G; the scale bar is 100 μm.

[0036] Figure 4 The expression of markers in dopaminergic neural precursor cells obtained in Example 1.2 analyzed by flow cytometry is shown, wherein Figures A, B, C, D and E are histograms of OTX2, FOXA2, LMX1A, CD166 and Corin staining, respectively, and F is a scatter plot of CD166 and Corin co-staining.

[0037] Figure 5 The graph shows the relative expression levels of anterior, middle and hindbrain neural markers (OTX2, EN1 and HOXA2) in midbrain floor plate cells differentiated by different CHIR99021 concentrations (0, 0.2, 0.4, 0.6, 0.8, 1.0 μM) analyzed by fluorescence quantitative PCR.

[0038] Figure 6 The immunofluorescence staining of the midbrain floor plate cells differentiated under the induction of different SAG concentrations (0, 0.5, 1, 1.25, 1.5, 1.75 μM) is shown: A, 0 μM SAG; B, 0.5 μM SAG; C, 1 μM SAG; D, 1.25 μM SAG; E, 1.5 μM SAG; F, 1.75 μM SAG; red fluorescence indicates the mDAP cell marker FOXA2, blue fluorescence indicates DAPI, and green fluorescence indicates PAX6; the scale bar is 100 μm.

[0039] Figure 7 The relative expression levels of markers (FOXA2 and PAX6) of midbrain floor plate cells differentiated by induction of different SAG concentrations (0, 0.5, 1, 1.25, 1.5, and 1.75 μM) analyzed by fluorescent quantitative PCR are shown.

[0040] Figure 8 The results of the amphetamine-induced rotation test of mice in the vehicle group and the treatment group are shown. *, 2 months after administration in the treatment group vs. before administration, p<0.05; ***, 3 months after administration in the treatment group vs. before administration, p<0.001; #, 2 months after administration in the treatment group vs. 2 months after administration in the vehicle group, p<0.05; #, 3 months after administration in the treatment group vs. 3 months after administration in the vehicle group, p<0.05.

[0041] Fig. 9 The results of the cylinder test for mice in the vehicle group and the treatment group are shown.

[0042] Fig.10 The results of the rotarod test of mice in the vehicle group and the treatment group are shown. #, 1 month after administration in the treatment group vs. before administration, p<0.05; #, 2 months after administration in the treatment group vs. before administration, p<0.05; #, 3 months after administration in the treatment group vs. before administration, p<0.05; 3 months after administration in the treatment group vs. 3 months after administration in the vehicle group, p=0.07.

[0043] Fig.11 The tail suspension test results of mice in the vehicle group and the treatment group are shown. *, 3 months after administration in the treatment group vs. 3 months after administration in the vehicle group, p<0.05.

[0044] Fig.12 The results of the social avoidance test of mice in the vehicle group and the treatment group are shown. ###, 3 months after administration in the treatment group vs. before administration, p<0.001; 3 months after administration in the treatment group vs. 3 months after administration in the vehicle group, p=0.06.

[0045] Fig.13 The results of novelty suppression feeding test of mice in vehicle group and treatment group are shown. Feeding latency unit: seconds (s). *, 3 months after administration vs before administration in treatment group, p<0.05.

[0046] Fig.14 Dopaminergic neuron staining of brain tissues of treated mice is shown; DAPI, DNA; stem101, human nuclear protein Ku80; TH, tyrosine hydroxylase.

[0047] Fig.15 Dopaminergic neuron staining of brain tissues of vehicle group mice is shown; DAPI, DNA; stem101, human nuclear protein Ku80; TH, tyrosine hydroxylase. DETAILED DESCRIPTION

[0048] General Terms and Definitions

[0049] All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, etc., cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such publication.

[0050] Unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, and microbiology used herein are terms widely used in the corresponding fields (see, for example, Molecular Cloning: A Laboratory Manual, 2 ndEdition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Meanwhile, in order to better understand the present invention, the definitions and explanations of relevant terms are provided below.

[0051] As used herein, the expressions "comprises," "comprising," "containing," and "having" are open ended, meaning the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components. The expression "consisting of" excludes any element, step, or component not specified. The expression "consisting essentially of" means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of" are encompassed within the meaning of the expression "comprising."

[0052] As used herein, unless the context indicates otherwise, the singular form of the expression "a", "an" or "the" includes plural references. The term "one (kind) or more (kind)" or "at least one (kind)" encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 (kinds) or more (kinds).

[0053] As used herein, unless otherwise indicated herein or clearly contradicted by context, the expression "selected from" includes any element or any combination of two or more elements from the group of elements listed thereafter.

[0054] Recitation of ranges of values ​​herein is intended merely to serve as a shorthand method of referring individually to each different value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless expressly indicated to the contrary, values ​​or ranges set forth herein are modified by "about", meaning ±20%, ±10%, ±5%, or ±3% of the recited or claimed value or range.

[0055] Unless otherwise stated, all methods described herein can be performed in any suitable order.

[0056] As used herein, the term "ex vivo" means that the cell is removed from a living organism and survives outside the organism (e.g., in a test tube, culture dish, or bioreactor). The cells described herein (e.g., pluripotent stem cells, induced pluripotent stem cells, and midbrain dopamine neural precursor cells) can be isolated. Pluripotent stem cells, induced pluripotent stem cells, and midbrain dopamine neural precursor cells as described herein are commercially available. Ex vivo cells are preferably present in a physiologically compatible solution.

[0057] As used herein, the term "Parkinson's disease (PD)" refers to a neurodegenerative disease, generally associated with progressive degeneration of dopaminergic neurons in the substantia nigra and dopamine deficiency in the basal ganglia. Typically, Parkinson's disease involves dysfunction and death of important nerve cells in a brain region called the substantia nigra. Many of these important nerve cells produce dopamine. Parkinson's disease includes idiopathic or typical Parkinson's disease and Parkinson's superposition syndrome (atypical Parkinson's disease). The cardinal symptoms of Parkinson's disease include resting tremor, rigidity, bradykinesia (extremely slow activity), flexion position, and postural instability. The main motor symptoms of Parkinson's disease include: tremor, bradykinesia or slow movement of the hands, arms, legs, jaws, and face, rigidity or stiffness of limbs and trunk, and postural instability or impaired balance and coordination. The symptoms of Parkinson's disease also include non-motor symptoms, such as anxiety, depression, sleep problems, and mental problems.

[0058] As used herein, the term "treatment" refers to the improvement of a disease / symptom, such as reducing or eliminating the disease / symptom, preventing or slowing the occurrence, progression and / or worsening of the disease / symptom. Therefore, treatment includes prevention, treatment and / or cure.

[0059] As used herein, "therapeutically effective amount" refers to a dose that is sufficient to reduce the severity of disease symptoms, increase the frequency and duration of disease asymptomatic periods, or prevent damage or disability caused by disease pain. "Therapeutically effective amount" refers to the amount required to prevent, cure, improve, block or partially block a disease or symptom. Those skilled in the art can determine the therapeutically effective amount based on factors such as the age, physical condition, sex, severity of symptoms, specific composition or route of administration of the subject. The therapeutically effective amount can be given in one or more administrations. The cell preparation or pharmaceutical composition of the present invention is administered in a therapeutically effective amount.

[0060] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the subject is preferably a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, mice, etc.) or a primate (e.g., monkeys and humans), most preferably a human. In one embodiment, the subject suffers from Parkinson's disease, Parkinson's disease symptoms, Parkinson's disease-induced depression, Parkinson's disease-induced anxiety and / or Parkinson's disease-induced mood disorders. In one embodiment, the subject suffers from motor symptoms of Parkinson's disease. In one embodiment, the subject suffers from non-motor symptoms of Parkinson's disease. In one embodiment, the subject suffers from motor symptoms and non-motor symptoms of Parkinson's disease.

[0061] As used herein, the term "differentiation" is the process by which a less specialized cell forms progeny of at least one new, more specialized cell type.

[0062] As used herein, the term "basal medium" refers to a culture medium with defined chemical compositions, including but not limited to IMDM (Iscove's Modified Dulbecco's Medium) medium, Eagle's Basal Medium (BME) medium, MEM medium, DMEM medium, Ham's F-12 medium, RPMI1640 medium, Fischer's medium, E8 medium, mTESR medium, StemFit Basic 03, StemFit Basic 04, NutriStem hPSC XF medium, StemMACS iPS Brew medium, Stem-Partner ACF medium, TeSR-AOF medium, TeSR2 medium and other basic cell culture media.

[0063] As used herein, the term "SB431542" also includes SB431542 and salts thereof, especially pharmaceutically acceptable salts.

[0064] As used herein, the term "CHIR99021" includes CHIR99021 and salts thereof, especially pharmaceutically acceptable salts.

[0065] As used herein, the term "Y-27632" also includes Y-27632 and its salts, especially pharmaceutically acceptable salts. A preferred pharmaceutically acceptable salt is Y-27632 2HCl.

[0066] Cell preparation

[0067] In one aspect, the present invention provides a cell preparation comprising midbrain dopaminergic neural precursor cells and a physiologically compatible solution. In one embodiment, the cell preparation is formulated as an injectable preparation for administration to the parafascicular nucleus (PF) region of the thalamus.

[0068] The parafascicular nucleus (PF) of the thalamus is an important component of the intralaminar nuclei of the thalamus and is closely connected with the basal motor nuclei. The PF receives excitatory input from the cortex and inhibitory input from the basal ganglia.

[0069] As used herein, the term "floor plate (FP)" refers to the most ventral structure of the midbrain segment of the neural tube, which is located at the mid-ventral midline of the neural tube. Dopaminergic neurons develop from the midbrain floor plate. The term "midbrain floor plate cells" refers to a group of cells found in the midbrain floor plate of a developing embryo, or a group of cells expressing midbrain floor plate cell-specific markers under in vitro conditions.

[0070] As used herein, the term "dopaminergic neural progenitor cells (also known as "midbrain dopaminergic neural progenitor cells")" and the term "dopaminergic neural precursor cells (also known as "midbrain dopaminergic neural precursor cells")" generally refer to cells that can proliferate and / or differentiate into dopaminergic neurons in vitro or in vivo. Dopaminergic neural precursor cells can be obtained by simple culture of dopaminergic neural progenitor cells, and there is little difference in the purity of marker expression before and after conversion between the two. Positive markers for dopaminergic neural progenitor cells / precursor cells may include, for example, ENI, PAX8, OTX2, LMX1A, FOXA2, Corin and CD166. Negative markers for dopaminergic neural progenitor cells / precursor cells may include, for example, iPSCOct4, LIN28, NKX2.1, BARHLl, HOXA2, NKX2.2, FEV and GATA2.

[0071] As used herein, the term "dopaminergic neuron" generally refers to a cell that contains and releases dopamine as a neurotransmitter. Common dopaminergic neuron markers may include tyrosine hydroxylase (TH), dopamine transporter (DAT), transcription activator FOXA2, G-protein regulated potassium channel GIRK2, transcription factor Nurr1, transcription factor EN1, and transcription factor LMX1B.

[0072] Dopaminergic neural precursor cells can be derived from ventral midbrain neural cells, or they can be differentiated from pluripotent stem cells. Dopaminergic neural precursor cells can also be differentiated or reprogrammed from other cell types. As used herein, the term "pluripotent stem cells" generally refers to a class of cells with the potential to differentiate into any cell of the human body. In general, pluripotent stem cells have the potential to differentiate into any of the following three germ layers: endoderm (e.g., gastric connection, gastrointestinal tract, lungs, etc.), mesoderm (e.g., muscle, bone, blood, urogenital tissue, etc.) or ectoderm (e.g., epidermal tissue and nervous system tissue). Pluripotent stem cells can be derived from fertilized eggs or somatic cells. Pluripotent stem cells can be blood cells, urine cells, skin cells or umbilical cord blood cells, but are not limited thereto. Exemplary human pluripotent stem cell lines include H1 human pluripotent stem cell lines and H9 human pluripotent stem cell lines. Additional exemplary pluripotent stem cell lines include those available through the National Institutes of Health Human Embryonic Stem Cell Registry and the Howard Hughes Medical Institute HUES collection (as described by Cowan CA, et al. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25; 350(13): 1353-6.). Pluripotent stem cells can be embryonic stem cells (hESC), tissue stem cells, and induced pluripotent stem cells.

[0073] As used herein, "embryonic stem (ES) cells" are pluripotent stem cells derived from early embryos.

[0074] As used herein, "tissue stem cells" are also referred to as tissue-specific stem cells or somatic stem cells. Unlike ES cells, tissue stem cells have limited differentiation potential. Tissue stem cells can be divided into several categories based on the site from which the cells originate, such as the skin system, digestive system, bone marrow system, nervous system, etc. Tissue stem cells in the skin system include epidermal stem cells, hair follicle stem cells, etc. Tissue stem cells in the digestive system include pancreatic (common) stem cells, liver stem cells, etc. Tissue stem cells in the bone marrow system include hematopoietic stem cells, mesenchymal stem cells, etc. Tissue stem cells in the nervous system include neural stem cells, retinal stem cells, etc.

[0075] As used herein, the term "induced pluripotent stem cell" or "iPSC" refers to a pluripotent stem cell derived from a non-pluripotent cell. For example, iPSC can be obtained by inducing non-pluripotent cells to express one or more genes (e.g., one or more of SOX2, KLF4, cMYC, and NANOG) (reprogramming). In one embodiment, midbrain dopaminergic neural precursor cells are prepared from human pluripotent stem cells (e.g., human iPSC, as shown in Example 1 of the present application). Midbrain dopaminergic neural precursor cells may express specific markers, such as LMX1A, EN1, OTX2, and FOXA2. Methods for preparing induced pluripotent stem cells are known to those skilled in the art.

[0076] As used herein, the term "physiologically compatible solution" refers to a solution that at least partially simulates the liquid environment that cells usually surround when they are in vivo. Physiologically compatible solutions can help maintain cell function, or prevent cells from being damaged when removed from the body or culture environment. Physiologically compatible solutions are typically buffers that contain physiological concentrations of salt. Physiologically compatible solutions can also include proteins such as growth factors. Physiologically compatible solutions can include, for example, cell culture fluids (e.g., Eagle's minimum essential medium), normal saline, phosphate buffered saline, Hanks balanced salt solution, and artificial cerebrospinal fluid (aCSF). In one embodiment, the physiologically compatible solution is artificial cerebrospinal fluid.

[0077] In one embodiment, the cell preparation of the present invention is prepared by a method comprising the following steps:

[0078] (1) culturing the pluripotent stem cells for a first time with a first culture medium, and then culturing them for a second time with a second culture medium to obtain midbrain floor plate cells;

[0079] (2) culturing the midbrain floor plate cells for a third time using a third culture medium to obtain dopaminergic neural progenitor cells; and

[0080] (3) The dopaminergic neural progenitor cells are cultured for a fourth time using a fourth culture medium, and then cultured for a fifth time using a fifth culture medium to obtain the dopaminergic neural progenitor cells.

[0081] The first culture medium is a basal culture medium containing a GSK3β inhibitor, a SHH agonist, and at least one or at least two of the following: a TGFβ / ALK inhibitor, a BMP4 inhibitor. In one embodiment, the first culture medium is a basal culture medium containing a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor, and a SHH agonist.

[0082] The second culture medium is a basal culture medium containing a GSK3β inhibitor, a SHH agonist, and at least one, at least two, or at least three of the following: a ROCK inhibitor, a TGFβ / ALK inhibitor, and a BMP4 inhibitor. In one embodiment, the second culture medium is a basal culture medium containing a ROCK inhibitor, a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor, and a SHH agonist.

[0083] The third culture medium is a basal culture medium containing at least one, at least two or at least three of the following: a BMP4 inhibitor, a SHH agonist, a growth factor. In one embodiment, the third culture medium is a basal culture medium comprising a BMP4 inhibitor, a SHH agonist and a growth factor.

[0084] The fourth culture medium is a basal culture medium containing at least one or at least two of the following: a SHH agonist, a growth factor. In one embodiment, the fourth culture medium is a basal culture medium containing a SHH agonist and a growth factor.

[0085] The fifth culture medium is a basal culture medium containing at least one, at least two or at least three of the following: a ROCK inhibitor, a SHH agonist, a growth factor. In one embodiment, the fifth culture medium is a basal culture medium comprising a ROCK inhibitor, a SHH agonist and a growth factor.

[0086] In one embodiment, the TGFβ / ALK inhibitor in the first culture medium and the second culture medium is independently selected from at least one of SB431542, SB-505, A-83-01, GW6604, IN-1130, Ki26894, LY2157299, LY364947 (HTS-466284), LY550410, LY573636, LY580276, NPC-30345, SB-505124, SD-093, Sm16, SM305, SX-007, Antp-Sm2A, and LY2109761.

[0087] In one embodiment, the TGFβ / ALK inhibitor in the first culture medium comprises SB431542. In one embodiment, the concentration of SB431542 in the first culture medium is 0.2 μM-100 μM; further 1-20 μM; further 10 μM.

[0088] In one embodiment, the TGFβ / ALK inhibitor in the second culture medium comprises SB431542. In one embodiment, the concentration of SB431542 in the second culture medium is 0.2 μM-100 μM; further 1-20 μM; further 10 μM.

[0089] In one embodiment, the BMP4 inhibitor in the first culture medium, the second culture medium and the third culture medium is independently selected from at least one of dorsomorphin, noggin, LDN-193189, follistatin, chordin, gremlin and DMH-1.

[0090] In one embodiment, the BMP4 inhibitor in the first culture medium comprises DMH-1.

[0091] In one embodiment, the concentration of DMH-1 in the first culture medium is 0.2 μM-10 μM; further 1-3 μM; further 2 μM.

[0092] In one embodiment, the BMP4 inhibitor in the second culture medium comprises DMH-1. In one embodiment, the concentration of DMH-1 in the second culture medium is 0.2 μM-10 μM; further 1-3 μM; further 2 μM.

[0093] In one embodiment, the BMP4 inhibitor in the third culture medium comprises DMH-1. In one embodiment, the concentration of DMH-1 in the third culture medium is 0.2 μM-10 μM; further 0.8-1.2 μM; further 1 μM.

[0094] In one embodiment, the GSK3β inhibitor in the first culture medium and the second culture medium is independently selected from: at least one of GSK3β inhibitor IX (6-bromoindirubin 3'-oxime), SB216763, GSK3β inhibitor VII (4-dibromoacetophenone), L803-mts, 6-bromo-indirubin-3'-oxime (BIO), TWS119, AZD2858, AR-A014418, TDZD-8, LY2090314, 2-D08, IM-12, 1-Azakenpaullone, Indirubin, and CHIR99021.

[0095] In one embodiment, the GSK3β inhibitor in the first culture medium comprises CHIR99021. In one embodiment, the concentration of CHIR99021 in the first culture medium is 0.2 μM-3 μM; further 0.2-1 μM; further 0.6 μM.

[0096] In one embodiment, the GSK3β inhibitor in the second culture medium comprises CHIR99021. In one embodiment, the concentration of CHIR99021 in the second culture medium is 0.2 μM-3 μM; further 0.2-1 μM; further 0.6 μM.

[0097] In one embodiment, the SHH agonist in the first culture medium, the second culture medium, the third culture medium, the fourth culture medium and the fifth culture medium is independently selected from at least one of SHH, SHH C25II, Purmorphamine, SAG, SAG 21K, Hh-Ag1.5, 20a-hydroxycholesterol and purmorphamine.

[0098] In one embodiment, the SHH agonist in the first culture medium comprises SAG. In one embodiment, the concentration of SAG in the first culture medium is 0.5 μM-2.5 μM; further 1 μM-1.75 μM; further 1 μM.

[0099] In one embodiment, the SHH agonist in the second culture medium comprises SAG. In one embodiment, the concentration of SAG in the second culture medium is 0.5 μM-2.5 μM; further 1 μM-1.75 μM; further 1 μM.

[0100] In one embodiment, the SHH agonist in the third culture medium comprises SAG. In one embodiment, the concentration of SAG in the third culture medium is 0.1 μM-1 μM; further 0.1-0.5 μM; further 0.2 μM.

[0101] In one embodiment, the SHH agonist in the fourth culture medium comprises SAG. In one embodiment, the concentration of SAG in the fourth culture medium is 0.1 μM-1 μM; further 0.1-0.5 μM; further 0.2 μM.

[0102] In one embodiment, the SHH agonist in the fifth culture medium comprises SAG. In one embodiment, the concentration of SAG in the fifth culture medium is 0.1 μM-1 μM; further 0.1-0.5 μM; further 0.2 μM.

[0103] In one embodiment, the ROCK inhibitor in the second culture medium and the fifth culture medium is independently selected from at least one of Y-27632, HA100, HA1152, Blebbistatin, HA-1077, KD-025, Y-33075, and Narciclasine.

[0104] In one embodiment, the ROCK inhibitor in the second culture medium comprises Y-27632. In one embodiment, the concentration of Y-27632 in the second culture medium is 5-15 μM; further 10 μM.

[0105] In one embodiment, the ROCK inhibitor in the fifth culture medium comprises Y-27632. In one embodiment, the concentration of Y-27632 in the fifth culture medium is 5-15 μM; further 10 μM.

[0106] In one embodiment, the growth factors in the third culture medium, the fourth culture medium and the fifth culture medium are independently selected from at least one of epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor-I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncostatin M (OSM), platelet-derived endothelial cell growth factor (PDECGF), transforming growth factor-α (TGF-α), and vascular endothelial growth factor (VEGF).

[0107] In one embodiment, the growth factor in the third culture medium comprises fibroblast growth factor. In one embodiment, the concentration of fibroblast growth factor in the third culture medium is 10 ng / mL-1 mg / mL; further 80-120 ng / mL; further 100 ng / mL.

[0108] In one embodiment, the growth factor in the fourth culture medium comprises fibroblast growth factor. In one embodiment, the concentration of fibroblast growth factor in the fourth culture medium is 10 ng / mL-1 mg / mL; further 80-120 ng / mL; further 100 ng / mL.

[0109] In one embodiment, the growth factor in the fifth culture medium comprises fibroblast growth factor. In one embodiment, the concentration of fibroblast growth factor in the fifth culture medium is 10 ng / mL-1 mg / mL; further 80-120 ng / mL; further 100 ng / mL. Further preferably, the fibroblast growth factor comprises FGF8b.

[0110] In one embodiment, the basal culture medium in the first culture medium, the second culture medium, the third culture medium, the fourth culture medium and the fifth culture medium is independently selected from at least one of IMDM (Iscove's Modified Dulbecco's Medium) medium, Eagle's Basal Medium (BME) medium, GMEM medium, MEM medium, DMEM medium, Ham's F-12 medium, RPMI1640 medium and Neurobasal medium.

[0111] In one embodiment, the basal culture medium in the first culture medium, the second culture medium, the third culture medium, the fourth culture medium and the fifth culture medium is each independently DMEM / F12.

[0112] In one embodiment, the basal medium in the first culture medium, the second culture medium, the third culture medium, the fourth culture medium and the fifth culture medium is a basal medium containing non-essential amino acids and N2 additives. In one embodiment, the concentration of non-essential amino acids in the basal medium is 0.2-5% (v / v); further 0.5-2% (v / v), and further 1% (v / v). In one embodiment, the concentration of N2 additive in the basal medium is 0.2-5% (v / v); further 0.5-2% (v / v), and further 1% (v / v).

[0113] In one embodiment, the pluripotent stem cells are selected from at least one of embryonic stem cells, parthenogenetic stem cells, induced pluripotent stem cells, mesenchymal stem cells, adipose stem cells, and umbilical cord blood stem cells. In one embodiment, the pluripotent stem cells are induced pluripotent stem cells.

[0114] In one embodiment, the pluripotent stem cells are derived from mammals. In one embodiment, the pluripotent stem cells are derived from primates. In one embodiment, the pluripotent stem cells are derived from humans.

[0115] In one embodiment, the pluripotent stem cells are human embryonic stem cells (hESCs) (e.g., H1, H9). In one embodiment, the pluripotent stem cells are human induced pluripotent stem cells (hiPSCs) (e.g., WC50, IMR90). In one embodiment, the human embryonic stem cells are commercial human embryonic stem cell lines. In one embodiment, the human embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0116] In one embodiment, the first culture time is 6-10 days. In one embodiment, the first culture time is 7-9 days. In one embodiment, the first culture time is 8 days. In one embodiment, the first culture is adherent culture. In one embodiment, the first culture is adherent culture on a culture device coated with Vitronectin.

[0117] In one embodiment, the second culture time is 1-3 days. In one embodiment, the second culture time is 1.5-2.5 days. In one embodiment, the second culture time is 2 days. In one embodiment, a digestion step is also included before the second culture. In one embodiment, the second culture is a suspension culture.

[0118] In one embodiment, the third culture time is 3-7 days. In one embodiment, the third culture time is 4-6 days. In one embodiment, the third culture time is 5 days. In one embodiment, the third culture is a suspension culture.

[0119] In one embodiment, the fourth culture is carried out for 5-9 days. In one embodiment, the fourth culture is carried out for 6-8 days. In one embodiment, the fourth culture is carried out for 7 days. In one embodiment, the fourth culture is adherent culture. In one embodiment, the fourth culture is adherent culture on a culture device coated with Vitronectin.

[0120] In one embodiment, the fifth culture is carried out for 0.5-1.5 days. In one embodiment, the fifth culture is carried out for 1 day. In one embodiment, a digestion step is further included before the fifth culture. In one embodiment, the fifth culture is a suspension culture.

[0121] In one embodiment,

[0122] The first culture time is 6-10 days;

[0123] The second culture time is 1-3 days;

[0124] The third culture time is 3-7 days;

[0125] The fourth culture time is 5-9 days; and

[0126] The fifth culture time is 0.5-1.5 days.

[0127] In one embodiment,

[0128] The first culture medium comprises a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist;

[0129] The second culture medium comprises a ROCK inhibitor, a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist;

[0130] The third culture medium comprises a BMP4 inhibitor, a SHH agonist and a growth factor;

[0131] The fourth culture medium comprises a SHH agonist and a growth factor; and

[0132] The fifth culture medium comprises a ROCK inhibitor, a SHH agonist and a growth factor.

[0133] In one embodiment, the TGFβ / ALK inhibitor is SB431542, the BMP4 inhibitor is DMH-1, the GSK3β inhibitor is CHIR99021, the SHH agonist is SAG, the ROCK inhibitor is Y-27632, and the growth factor is FGF8b.

[0134] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps:

[0135] (1) culturing the pluripotent stem cells for a first time with a first culture medium, and then culturing them for a second time with a second culture medium to obtain midbrain floor plate cells;

[0136] (2) culturing the midbrain floor plate cells for a third time using a third culture medium to obtain midbrain dopaminergic neural progenitor cells; and

[0137] (3) culturing the midbrain dopaminergic neural progenitor cells for a fourth time using a fourth culture medium, and then culturing them for a fifth time using a fifth culture medium to obtain the midbrain dopaminergic neural progenitor cells;

[0138] in

[0139] The first culture medium comprises a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist;

[0140] The second culture medium comprises a ROCK inhibitor, a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist;

[0141] The third culture medium comprises a BMP4 inhibitor, a SHH agonist and a growth factor;

[0142] The fourth culture medium comprises a SHH agonist and a growth factor; and

[0143] The fifth culture medium contains a ROCK inhibitor, a SHH agonist and a growth factor.

[0144] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps:

[0145] (1) culturing human induced pluripotent stem cells in a first culture medium for 6-10 days, and then culturing them in a second culture medium for 1-3 days in suspension to obtain midbrain floor plate cells;

[0146] (2) suspending and culturing the midbrain floor plate cells in a third culture medium for 3-7 days to obtain midbrain dopaminergic neural progenitor cells; and

[0147] (3) culturing the midbrain dopaminergic neural progenitor cells with the fourth culture medium for 5-9 days, and then culturing them in suspension with the fifth culture medium for 0.5-1.5 days to obtain the midbrain dopaminergic neural progenitor cells;

[0148] in

[0149] The first culture medium comprises SB431542, DMH-1, CHIR99021 and SAG;

[0150] The second culture medium comprises Y-27632, SB431542, DMH-1, CHIR99021 and SAG;

[0151] The third culture medium comprises DMH-1, SAG and FGF8b;

[0152] The fourth culture medium comprises SAG and FGF8b; and

[0153] The fifth culture medium contains Y-27632, SAG and FGF8b.

[0154] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps:

[0155] (1) culturing human induced pluripotent stem cells in a first culture medium for 8 days in an adherent manner, and then culturing them in a second culture medium for 2 days in a suspended manner to obtain midbrain floor plate cells;

[0156] (2) culturing the midbrain floor plate cells in a third culture medium for 5 days to obtain midbrain dopaminergic neural progenitor cells; and

[0157] (3) culturing the midbrain dopaminergic neural progenitor cells with the fourth culture medium for 7 days in an adherent manner, and then culturing them in the fifth culture medium for 1 day in a suspended manner to obtain the midbrain dopaminergic neural progenitor cells;

[0158] The first culture medium comprises 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021 and 1 μM SAG;

[0159] The second culture medium comprises 10 μM Y-27632, 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021 and 1 μM SAG;

[0160] The third culture medium contains 1 μM DMH-1, 0.2 μM SAG and 100 ng / mL FGF8b;

[0161] The fourth culture medium comprises 0.2 μM SAG and 100 ng / mL FGF8b; and

[0162] The fifth culture medium contained 10 μM Y-27632, 0.2 μM SAG, and 100 ng / mL FGF8b.

[0163] In one embodiment, the first culture medium, the second culture medium, the third culture medium, the fourth culture medium and the fifth culture medium further comprise a neural basal medium, wherein the neural basal medium comprises 98% (v / v) DMEM / F12, 1% (v / v) non-essential amino acids and 1% (v / v) N2 additive.

[0164] In one embodiment, the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps:

[0165] (1) culturing human induced pluripotent stem cells in a first culture medium for 8 days in an adherent manner, and then culturing them in a second culture medium for 2 days in a suspended manner to obtain midbrain floor plate cells;

[0166] (2) culturing the midbrain floor plate cells in a third culture medium for 5 days to obtain midbrain dopaminergic neural progenitor cells; and

[0167] (3) culturing the midbrain dopaminergic neural progenitor cells with the fourth culture medium for 7 days in an adherent manner, and then culturing them in the fifth culture medium for 1 day in a suspended manner to obtain the midbrain dopaminergic neural progenitor cells;

[0168] in

[0169] The first culture medium is a neurobasal medium containing 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021 and 1 μM SAG;

[0170] The second culture medium is a neurobasal medium containing 10 μM Y-27632, 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021 and 1 μM SAG;

[0171] The third culture medium is a neurobasal medium containing 1 μM DMH-1, 0.2 μM SAG and 100 ng / mL FGF8b;

[0172] The fourth culture medium is a neurobasal medium containing 0.2 μM SAG and 100 ng / mL FGF8b;

[0173] The fifth culture medium is a neurobasal medium containing 10 μM Y-27632, 0.2 μM SAG and 100 ng / mL FGF8b; and

[0174] The neurobasal medium contained 98% (v / v) DMEM / F12, 1% (v / v) non-essential amino acids, and 1% (v / v) N2 supplement.

[0175] In one embodiment, the content of OTX2+EN1+ cells in the cell preparation (especially the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is greater than 80%. In one embodiment, the content of OTX2+EN1+ cells in the cell preparation (especially the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, or 96% or more; further 90.1%.

[0176] In one embodiment, the content of FOXA2+LMX1A+ cells in the cell preparation (especially the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is greater than 80%. In one embodiment, the content of FOXA2+LMX1A+ cells in the cell preparation (especially the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, or 96% or more; further 87.5%.

[0177] In one embodiment, the content of CD166+ cells in the cell preparation (particularly an injectable preparation formulated for administration to the thalamic nucleus parafascicularis region) is greater than 80%. In one embodiment, the content of CD166+ cells in the cell preparation (particularly an injectable preparation formulated for administration to the thalamic nucleus parafascicularis region) is 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, or 96% or more; further 97.07%.

[0178] In one embodiment, the content of Corin+ cells in the cell preparation (especially the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is greater than 80%. In one embodiment, the content of Corin+ cells in the cell preparation (especially the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, or 96% or more; further 87.74%.

[0179] In one embodiment, the content of CD166+Corin+ cells in the cell preparation (particularly an injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is more than 80%, more than 85%, more than 90%, more than 91%, more than 92%, more than 93%, more than 94%, more than 95% or more than 96%.

[0180] In one embodiment, the cell preparation (particularly an injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus)

[0181] The content of OTX2+EN1+ cells was greater than 80%;

[0182] The content of FOXA2+LMX1A+ cells is greater than 80%; and

[0183] The content of CD166+Corin+ cells was greater than 80%.

[0184] The present invention further provides a pharmaceutical composition comprising the cell preparation of the present invention, in particular an injectable preparation for administration to the parafascicular nucleus region of the thalamus. The pharmaceutical composition may further comprise a pharmaceutically acceptable buffer (e.g., phosphate), an emulsifier, a suspending agent, a preservative, an antibacterial agent (e.g., an antibiotic) and / or a stabilizer.

[0185] Treatment of Parkinson's disease

[0186] The present invention further provides the use of the cell preparation of the present invention (especially an injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) in the preparation of a medicament for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases.

[0187] On the other hand, the present invention provides a method for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases, comprising administering midbrain dopaminergic neural precursor cells to the parafascicular nucleus (PF) region of the thalamus of a subject in need thereof. In one embodiment, the midbrain dopaminergic neural precursor cells are formulated as a cell preparation. In a specific embodiment, the midbrain dopaminergic neural precursor cells are formulated as an injectable preparation for administration to the parafascicular nucleus region of the thalamus.

[0188] The administration method as described herein can be transplantation. As used herein, the term "transplantation" refers to the process of implanting or transferring at least one cell to a subject. The term "transplantation" includes, for example, autologous transplantation (removing cells from one location of a subject and transferring them to the same or another location of the same subject), allogeneic transplantation (transplantation between members of the same species), and xenotransplantation (transplantation between members of different species). Transplantation can also include transferring ex vivo cells to a subject.

[0189] In another aspect, the present invention provides a method for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases, comprising administering the cell preparation of the present invention (particularly an injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) to the parafascicular nucleus (PF) region of the thalamus of a subject in need thereof.

[0190] The present invention further provides the cell preparation of the present invention (particularly an injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus), which is used for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases.

[0191] The Parkinson's disease symptoms that the cell preparation of the present invention (particularly the injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) can be used to treat can be motor symptoms and / or non-motor symptoms. In a specific embodiment, the Parkinson's disease symptoms are motor symptoms, and the motor symptoms are selected from: dystonia, chorea, athetosis, motor fluctuations, postural abnormality, speech impairment, bradykinesia, freezing of gait, tremor, rigidity, difficulty with walking and gait. In one embodiment, the Parkinson's disease symptoms are non-motor symptoms, and the non-motor symptoms are selected from: blood pressure regulation disorders (such as orthostatic hypotension), sleep disorders, sensory disorders, autonomic dysfunction, mood swings, cognitive impairment, hallucinations, delusions, anxiety, dementia and depression. In another embodiment, the Parkinson's disease symptoms are motor symptoms and non-motor symptoms, and the motor symptoms are selected from: dystonia, chorea, athetosis, motor symptom fluctuations, abnormal posture, speech disorders, bradykinesia, gait freezing, tremor, rigidity, walking and gait difficulties; and the non-motor symptoms are selected from: blood pressure regulation disorders (such as orthostatic hypotension), sleep disorders, sensory disorders, autonomic dysfunction, mood swings, cognitive impairment, hallucinations, delusions, anxiety, dementia and depression.

[0192] The cell preparation of the present invention can be used to treat Parkinson's disease-induced diseases. In one embodiment, the Parkinson's disease-induced disease is Parkinson's disease-induced depression or Parkinson's disease-induced anxiety or Parkinson's disease-induced dysthymic disorder.

[0193] The cell preparation and / or pharmaceutical composition of the present invention can be co-administered with other therapies for the treatment of Parkinson's disease or disorders. In some embodiments, the cell preparation of the present invention (particularly an injectable preparation formulated for administration to the parafascicular nucleus region of the thalamus) is used in combination with a drug selected from the following: levodopa, dopamine receptor agonists, monoamine oxidase type B inhibitors, catechol-O-methyltransferase inhibitors, anticholinergic drugs, antiglutamatergic drugs, and adenosine A2 receptor antagonists.

[0194] Beneficial Effects

[0195] In the solution of the present invention, midbrain dopaminergic neural precursor cells are administered to the parafascicular nucleus (PF) region of the thalamus. Compared with the traditional treatment method of transplanting dopaminergic neural precursor cells into the substantia nigra region, the method of the present invention reduces the physical damage to the brain caused by the excessive implantation of cells by the traditional method, and can promote the survival and differentiation of cells into dopaminergic neurons at the transplantation site. Midbrain dopamine neural precursor cells transplanted into the PF region can survive for a long time and differentiate into dopaminergic neurons, thereby reversing Parkinson's-like motor symptoms and / or improving non-motor symptoms.

[0196] The solution of the present invention achieves for the first time the therapeutic effect of simultaneously improving the motor and non-motor symptoms of Parkinson's disease, thereby comprehensively solving the various pains suffered by clinical patients after suffering from Parkinson's disease to a greater extent, and has great research application prospects and social significance.

[0197] Example

[0198] The present invention is further described by reference to the following examples. It should be understood that these examples are intended to be illustrative only and are not intended to limit the present invention. Unless otherwise specified, the following materials and instruments are commercially available or prepared according to methods known in the art. Unless otherwise specified, the following experiments are performed according to the manufacturer's instructions or according to methods and procedures known in the art.

[0199] Example 1 Preparation of exogenous cell transplants

[0200] 1.1 Preparation and culture of human induced pluripotent stem cells (iPSCs)

[0201] Preparation of iPSCs

[0202] According to the manufacturer's instructions, use CTS TM CytoTune TM -iPS2.1 Sendai virus reprogramming kit (CTS TM CytoTune TM-iPS2.1Sendai Reprogramming Kit, Catalog No.: A34546) is used to prepare human induced pluripotent stem cells (iPSCs) from human peripheral blood cells (peripheral blood of Chinese people collected from cooperative hospitals).

[0203] Culture of iPSCs

[0204] According to about 1×10 5 iPSCs were plated in the form of clumps on a matrix pre-coated with Laminin at a number of 100 cells per well and cultured using E8 complete medium. The cells were digested and passaged every 4-5 days during the culture process.

[0205] 1.2 Preparation of dopaminergic neural precursor cells

[0206] Dopaminergic neural precursor cells were prepared from the iPSCs of Example 1.1. The specific method is as follows.

[0207] Culture medium:

[0208] The first medium was neurobasal medium containing 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021, and 1 μM SAG;

[0209] The second medium was neurobasal medium containing 10 μM Y-27632, 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021, and 1 μM SAG;

[0210] The third culture medium was neurobasal medium containing 1 μM DMH-1, 0.2 μM SAG, and 100 ng / mL fibroblast growth factor 8b (FGF8b);

[0211] The fourth culture medium was neurobasal medium containing 0.2 μM SAG and 100 ng / mL FGF8b;

[0212] The fifth culture medium was neurobasal medium containing 10 μM Y-27632, 0.2 μM SAG, and 100 ng / mL FGF8b;

[0213] The neurobasal medium consisted of the following components: 98% (v / v) DMEM / F12 (Gibco), 1% (v / v) non-essential amino acids (Non-essential amino acid, Gibco) and 1% (v / v) N2 supplement (N2 supplement, Gibco).

[0214] The specific method for inducing iPSCs to differentiate into midbrain dopaminergic neural progenitor cells is as follows:

[0215] S1: One day before differentiation, iPSCs with a confluence of about 70%-80% were digested into single cells using TrypLE enzyme and then centrifuged at 8000 / cm 2 The cells were seeded at a density of 1.50 μg / cm2 into a 6-well plate pre-coated with Vitronectin (Gibco). The seeding medium was StemFit complete medium, and 10 μM Y-27632 was added to promote stem cell survival.

[0216] S2: After the cells adhered to the wall and grew for 24 h, the culture medium was replaced with the first culture medium (as the 0th day of differentiation, D0), and cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 8 days (the medium was changed every two days);

[0217] S3: On day 9 of differentiation, cells were digested with Accutase (Innovative), then resuspended with the second culture medium, and 1.5 × 10 7 The cells were inoculated into a T75 suspension culture flask, shaken evenly, and then cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 2 days to allow the cells to spontaneously form neurospheres in a suspended state, thereby obtaining midbrain floor plate cells;

[0218] S4: On the 11th day of differentiation, the culture medium was replaced with the third culture medium, and the cells were cultured in a carbon dioxide cell culture incubator at 37° C. and 5% CO 2 for 5 days (the medium was changed every 2.5 days) to obtain dopaminergic neural progenitor cells;

[0219] S5: On the 16th day of differentiation, the medium was changed to the fourth medium and 5×10 6 The neurosphere cells were subjected to the adhesion treatment (attached to the T75 culture flask pre-coated with Vitrovectin (Gibco) and continued to be cultured), and cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 7 days (the medium was changed every 2.5 days);

[0220] S6: On the 23rd day of differentiation, the cells were digested with Accutase (Innovative), and then resuspended with the fifth culture medium. 1.5×10 7 The cells were inoculated into a T75 suspension culture flask, shaken evenly, and cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for one day to allow the cells to spontaneously form neurospheres in a suspended state to obtain dopaminergic neural precursor cells (mDAP cells). Dopaminergic neural precursor cells were harvested in the form of neurospheres in artificial cerebrospinal fluid (Maokang Biotechnology, MX0951) for transplantation.

[0221] Example 2 Characterization of mDAP cells prepared using the method of Example 1

[0222] 2.1 Cell morphology

[0223] The cells differentiated to different stages in Example 1.2 were taken out of the incubator, observed under a microscope and photographed for record.

[0224] Figure 2 AG respectively show the induced cell morphology of D0 (day 0), the induced cell morphology of D7, the induced cell morphology of D15, the induced cell morphology of D20, the induced cell morphology of D24, the induced cell morphology of D26, and the induced cell morphology of D40. The morphological characteristics of the midbrain floor plate cell stage (D7), dopaminergic neural progenitor cell stage (D15), dopaminergic neural precursor cell stage (D24), and dopamine neuron stage (D40) are consistent with the expected.

[0225] 2.2 Immunofluorescence staining

[0226] The dopaminergic neural precursor cells obtained in Example 1.2 were taken, the supernatant was discarded, and the cells were washed twice with PBS, and paraformaldehyde was added for fixation at room temperature for 15 minutes; after washing three times with PBS, they were permeabilized with PBST (0.2% Triton + PBS) for 10 minutes, washed once with PBS, and then blocking solution (PBST + 3% donkey serum) was added for 30 minutes at room temperature, and then anti-OTX2 antibody (1:500; R&D), anti-FOXA2 antibody (1:500, Santa Cruz), anti-EN1 antibody or anti-LMX1A antibody were added and incubated overnight at 4°C; then washed three times with PBS, a secondary antibody (1:500; Jackson Lab) was added, and incubated at 37°C in the dark for 1 hour; after washing three times with PBS, DAPI was added to stain the nucleus for 5 minutes, and after washing three times with PBS, fluorescence microscopy observation and light-proof photography were performed.

[0227] The results are as follows Figure 3 As shown: It can be seen that cell stemness indicators such as OTX2, EN1, FOXA2 and LMX1A are highly expressed on the surface of the prepared mDAP cells, and about 90.1% of the cells co-express OTX2 and EN1, and about 87.5% of the cells co-express FOXA2 and LMX1A.

[0228] 2.3 FACS detection

[0229] Transfer the mDAP cells obtained in Example 1.2 to a 1.5 mL centrifuge tube, centrifuge and discard the supernatant. Resuspend with staining solution (PBS buffer containing 0.5% BSA) and evenly distribute to 7 new centrifuge tubes. Add Isotype, OTX2, FOXA2, LMX1A, CD166 or Corin antibodies or CD166 and Corin mixed antibodies to each tube, mix well and incubate for 20-30 minutes. Add staining solution to wash once, centrifuge and discard the supernatant, and detect by flow cytometry.

[0230] The results of the expression ratio of the cell population represented by cell stemness indicators such as OTX2, FOXA2, LMX1A, CD166 and / or Corin in the dopaminergic neural precursor cells obtained in Example 1.2 are as follows: Figure 4 As shown: the cell population specifically expressing the OTX2 marker expressed 97.47% of the total cell population, the cell population specifically expressing the FOXA2 marker expressed 86.96% of the total cell population, the cell population specifically expressing the LMX1A marker expressed 99.66% of the total cell population, the cell population specifically expressing the CD166 marker expressed 97.07% of the total cell population, the cell population specifically expressing the Corin marker expressed 87.74% of the total cell population, and the cell population specifically co-expressing the CD166 and Corin markers expressed 82.42% of the total cell population.

[0231] From the experimental data: It can be seen that the proportion of CD166-positive cells on the surface of mDAP cells prepared by the method of Example 1.2 is significantly higher than the proportion of CD166-positive cells in the midbrain dopaminergic neural progenitor cells prepared in the patent application US20220333071A1, which is 39.12%. The dopaminergic neural progenitor cells defined in US20220333071A1 are equivalent to the dopaminergic neural precursor cells in the present invention. The results show that the dopaminergic neural precursor cell group prepared by the method of Example 1.2 has a higher purity and a lower proportion of impurity cells, and has advantages in being used for cell transplantation and the treatment of related diseases.

[0232] Similarly, the proportion of the cell population that specifically co-expresses CD166 and Corin markers in the mDAP cells prepared by the method of Example 1.2 in the total cell population is higher than that of the midbrain dopaminergic neural progenitor cells prepared in patent application US20220333071A1. The results show that the dopaminergic neural progenitor cell population prepared by the method of Example 1.2 has a higher purity and has advantages in being used for cell transplantation and the treatment of related diseases.

[0233] Example 3 Effect of CHIR99021 concentration on cell differentiation

[0234] The effect of the concentration of CHIR99021 in the first culture medium and the second culture medium on iPSC differentiation was analyzed. Under the condition that the concentration of CHIR99021 in the first culture medium and the second culture medium was 0 μM, 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM or 1.0 μM, iPSC (prepared as in Example 1.1) was induced to differentiate into midbrain floor plate cells (see steps S1-S3 of Example 1.2). Midbrain floor plate cells were collected at D11 and the expression of markers therein was analyzed by real-time fluorescence quantitative PCR (RT-QPCR). The results are as follows Figure 5 shown. Figure 5 In the figure, the ordinate is the relative value of the expression level of each target gene relative to the internal reference gene GAPDH (the gene expression value of the internal reference gene GAPDH is "1"), and the abscissa is the concentration of CHIR99021 in the first culture medium and the second culture medium.

[0235] The specific operation method is as follows: 5×10 iPSC cells without induction and induced midbrain floor plate cells were taken respectively. 5 , extract RNA( Cell / Tissue Total RNA Isolation Kit V2), reverse transcribed into cDNA, and detected and calculated (2-△△CT method, GAPDH as internal reference gene) by qPCR method (HiScriptⅢRT SuperMix for qPCR (+gDNA wiper) kit). The expression levels of markers OTX2, EN1, and HOXA2 were calculated. OTX2 is a forebrain / midbrain marker (high expression level indicates that the cells belong to the forebrain stage; decreased expression level indicates that the cells gradually differentiate from the forebrain to the midbrain during development). EN1 is a midbrain marker. HOXA2 is a hindbrain marker. The primer sequences of each gene are shown in Table 1.

[0236] Table 1 PCR primer sequences of each gene

[0237] Primer sequence OTX2-F1 AGA GGA GGT GGC ACT GAA AA(SEQ ID NO.1) OTX2-R1 GCT GTT GTT GCT GTT GTT GG(SEQ ID NO.2) GAPDH-F2 ATGTTCGTCATGGGTGTGAA(SEQ ID NO.3) GAPDH-R2 AGGGGTGCTAAGCAGTTGGT(SEQ ID NO.4) FOXA2-F CCGTTCTCCATCAACAACCT(SEQ ID NO.5) FOXA2-R GGGGTAGTGCATCACCTGTT(SEQ ID NO.6) HOXA2-F CGTCGCTCGCTGAGTGCCTG(SEQ ID NO.7) HOXA2-R TGTCGAGTGTGAAAGCGTCGAGG(SEQ ID NO.8) EN1-F1 CGTGGCTTACTCCCCATTTA(SEQ ID NO.9) EN1-R1 TCTCGCTGTCTCTCCCTCTC(SEQ ID NO.10) PAX6-F1 TGGTATTCTCTCCCTCCT(SEQ ID NO.11) PAX6-R1 TAAGGATGTTGAACGGGCAG(SEQ ID NO.12)

[0238] Figure 5The relative expression levels of RNA of anterior, midbrain and hindbrain markers of a single batch of 3 independent repeated experiments are shown. The results of three repeated experiments showed that when the CHIR99021 concentration was 0 μM, the expression of OTX2 was the highest; when the addition amount was 1 μM, the relative expression of HOXA2 was the highest. With the increase of the concentration of CHIR99021 (0-1 μM), the expression of OTX2 showed a downward trend, the expression of HOXA2 showed an upward trend, and the expression of EN1 first increased and then decreased, which means that with the addition of CHIR99021, the cell fate gradually became posteriorized. When the CHIR99021 concentration was 0.6 μM, the relative expression of EN1 reached a peak. The results showed that when the CHIR99021 concentration was 0.6 μM, the relative expression of the midbrain marker EN1 was the highest, while the forebrain marker OTX2 and the hindbrain marker HOXA2 were both at a lower level of expression. Therefore, the optimal concentration of CHIR99021 is 0.6 μM.

[0239] Example 4 Effect of SAG concentration on cell differentiation

[0240] The effect of the concentration of SAG in the first culture medium and the second culture medium on iPSC differentiation was analyzed. Under the condition that the concentration of SAG in the first culture medium and the second culture medium was 0 μM, 0.5 μM, 1 μM, 1.25 μM, 1.5 μM or 1.75 μM, iPSC (prepared as in Example 1.1) was induced to differentiate into midbrain floor plate cells (see steps S1-S3 of Example 1.2). The expression of markers in midbrain floor plate cells was analyzed by immunofluorescence staining and real-time fluorescence quantitative PCR.

[0241] 4.1 Immunofluorescence staining

[0242] The method is the same as in Example 2.

[0243] Results and Analysis: Figure 6 The immunofluorescence staining of the midbrain floor plate cells differentiated under different SAG concentrations is shown: without SAG induction, the expression of PAX6 is very high, and after SAG induction, the expression of PAX6 decreases rapidly; at the same time, the expression of FOXA2 gradually increases with the increase of SAG concentration, until the SAG concentration is 1μM, the expression of FOXA2 reaches the maximum; when the SAG concentration is 1μM-1.75μM, the proportion of FOXA2 positive cells can reach more than 83%. It can be seen that the induction effect can be achieved at a SAG concentration of 1μM-1.75μM, and the best effect is achieved when the concentration is 1μM (the proportion of FOXA2 positive cells is about 85%).

[0244] 4.2 Fluorescence quantitative PCR

[0245] The method is the same as Example 3.

[0246] The results are as follows Figure 7 As shown: SAG concentration in the range of 1μM-1.75μM can play a good inducing role, and the differentiated cells highly express FOXA2 and lowly express PAX6.

[0247] Example 5 Construction of PD model

[0248] SPF Nod Scid mice (immunodeficient mice) (Scid beige strain) with similar weight were selected as model animals, and 6-hydroxydopamine (6-OHDA) was used as a modeling agent to construct a PD model. The specific method is as follows: anesthetize the mice with isoflurane gas anesthesia machine; fix the anesthetized mice on a mouse brain stereotaxic instrument. Make a midline incision on the top of the head to expose the periosteum and anterior fontanelle. 2 μL 6-OHDA (sigma, H4381-100mg) (model group, 3 mg / mL, solvent 1% VC (L-ascorbic acid, Sigma-Aldrich, A92902-100G, prepared by dissolving L-ascorbic acid in saline) and 2 μL 1% VC (control group) were slowly injected into the substantia nigra of the left brain of mice in stereotaxic manner. Behavioral testing was performed 4 weeks after surgery, which showed that the number of rotations of PD mice in the rotation experiment was significantly higher than that of the control group, the number of times the affected side forelimbs hit the wall in the cylinder experiment was significantly lower than that of the healthy side, and the time spent on the rotating rod in the rotating rod experiment was significantly lower than the standard of the control group, indicating that the PD mouse model was successfully established.

[0249] Example 6 Administration of PD mice

[0250] Twenty-four PD mice constructed as in Example 5 were divided into a vehicle group (12 mice in total) and a treatment group (12 mice in total). The treatment method of the treatment group was as follows: the mice were anesthetized with an isoflurane gas anesthesia machine; the anesthetized mice were fixed on a mouse brain stereotaxic instrument, and a midline incision was made on the top of the head to expose the periosteum and the anterior fontanelle. The cell preparation prepared in Example 1 (2×10 5 cells / 2μL, single-point injection) into the PF area of ​​the left brain of mice, PF area coordinates: anterior-posterior (AP) -2.18mm, medial (ML) + / -0.7mm, dorsal-ventral (DV) -3.25mm. The skin was sutured after injection, and the mice were fed normally after recovery. The treatment method of the vehicle group was the same as that of the treatment group, with the only difference being that the drug was a solvent (i.e., artificial cerebrospinal fluid, Maokang Bio, MX0951). During each treatment process, the mice carried out normal activities, drank water, and ate. Drug administration (transplantation) was performed once one month after modeling.

[0251] Example 7 Amphetamine-induced rotation experiment

[0252] The rotation experiment was performed before and 1, 2, and 3 months after administration. Specifically, 5 mg / kg of amphetamine was injected into the mouse intraperitoneally, and the mouse was filmed for 30 minutes 5-10 minutes later, and the total number of rotations of the mouse within 30 minutes was recorded (nut rotation / 30 minutes). The number of rotations of the mouse in 30 minutes was normalized and plotted, using the linear proportional transformation method, and the transformation formula was y i =x i / x 给药前 × 100%, that is, the normalized number of rotations is equal to the actual number of rotations divided by the number of rotations before drug administration.

[0253] The results are as follows Figure 8 As shown: the total number of rotations within 30 minutes after administration of the vehicle group mice was generally unchanged compared with that before administration, indicating that the vehicle had no effect on treating the Parkinson's-like condition in mice; in the treatment group mice, starting from 2 months after administration, the total number of rotations within 30 minutes was significantly increased compared with that before administration (p<0.05), and it was also significantly improved compared with the vehicle group at the same time (p<0.05), indicating that the treatment group mice showed improvement in Parkinson's disease-like lateral rotation behavioral symptoms starting from 2 months after transplantation. The results show that dopaminergic neural precursor cells transplanted in the PF area improve Parkinson's-like motor symptoms in mice.

[0254] Example 8 Cylinder Experiment

[0255] The cylinder test was performed before administration and 1, 2, and 3 months after administration. Specifically: Place the mouse in a glass bottle and record with a video camera for 3 minutes. Record the number of times the affected paw (the drug was administered to the left brain, so the affected forepaw is the right forelimb, recorded as R) and the healthy paw (the drug was administered to the left brain, so the healthy forepaw is the left forelimb, recorded as L) touched the cylinder wall. The affected paw will touch less. Calculate the proportion of the affected paw touching the wall (the formula is R / (L+R)*100%; contralateral touches). The proportion of the affected paw touching the wall of the mouse was normalized and plotted using the linear proportional transformation method, and the transformation formula is y i =x i / x 给药前 × 100%, that is, the normalized affected-side paw-wall-touching ratio is equal to the actual affected-side paw-wall-touching ratio divided by the affected-side paw-wall-touching ratio before drug administration.

[0256] The results are as follows Fig. 9As shown: The proportion of the affected side paw touching the wall in the vehicle group mice 1, 2, and 3 months after administration did not change significantly compared with before administration, indicating that the vehicle had no effect on treating Parkinson's-like symptoms in mice. The proportion of the affected side paw touching the wall in the treatment group mice 3 months after administration increased significantly compared with before administration, and compared with the vehicle group mice at the same period, it also showed a higher proportion of the affected side paw touching the wall, indicating that the treatment group mice began to show improvement in Parkinson's-like resting tremor behavioral symptoms 3 months after transplantation. The results show that dopaminergic neural precursor cells transplanted in the PF area improve Parkinson's-like motor symptoms in mice.

[0257] Example 9 Rotarod experiment

[0258] The rotarod test (accelerating rotarod test of motor coordination) was performed before and 1, 2 and 3 months after drug administration. The specific method is as follows: In order to achieve stable performance, all mice need to undergo two days of pre-training: on the first day, the mice are trained with a rotarod, which accelerates from 2 per minute (2rpm) to 20rpm, with an acceleration time of 10s, and runs 3 times within 300s; on the second day, the mice are trained with the acceleration rod twice from 3rpm to 30rpm with an acceleration time of 20s, and once from 4rpm to 40rpm with an acceleration time of 30s within 300s. The formal test started on the third day, with the rotarod speed from 4rpm to 40rpm with an acceleration time of 30s. The mouse's residence time on the rod (retension time) was monitored. The mouse's residence time on the rod was normalized and plotted, using the linear proportional transformation method, and the transformation formula was y i =x i / x 给药前 × 100%, that is, the normalized residence time is equal to the actual residence time divided by the residence time before administration.

[0259] The results are as follows Fig.10 As shown: the time that the mice in the vehicle group stayed on the rotarod at 1, 2, and 3 months after administration did not change significantly compared with that before administration, indicating that the vehicle had no effect on treating the Parkinson's-like condition in mice; in the mice in the treatment group, the time that they stayed on the rotarod increased significantly compared with that before administration from 1 month after administration (p<0.05), and the time that they stayed on the rotarod also increased significantly compared with that of the mice in the vehicle group at the same time 3 months after administration (p=0.07), indicating that the mice in the treatment group showed improvement in the behavioral symptoms of Parkinson's-like posture and gait disorders from 1 month after transplantation. The results showed that dopaminergic neural precursor cells transplanted in the PF area significantly improved the Parkinson's-like motor symptoms of mice.

[0260] Example 10 Mouse Behavior Despair Experiment - Tail Suspension Experiment

[0261] The tail suspension test was performed before and 1, 2, and 3 months after drug administration. The specific method is as follows: take out the mouse cage and stand it upright. Use medical tape to stick the mouse to the upper end of the cage 1 / 3 of the distance from the tail end, so that the mouse is in an upright and suspended state. Record the movement trajectory of the mouse within 6 minutes by video, and count the immobility time of the mouse within 6 minutes. The immobility time of the mouse after suspension was normalized and plotted. The linear proportional transformation method was used, and the transformation formula was y i =x i / x 给药前 × 100%, that is, the normalized immobility time is equal to the actual immobility time divided by the immobility time before drug administration.

[0262] The results are as follows Fig.11 As shown: the immobility time of the mice in the vehicle group after administration did not change significantly compared with that before administration, indicating that the vehicle had no effect on treating Parkinson's-like symptoms in mice; the immobility time of the mice in the treatment group after 3 months of administration decreased to a certain extent compared with that before administration, and compared with the mice in the vehicle group at the same time, they also showed a shorter immobility time (p<0.05), indicating that the mice in the treatment group began to show behavioral improvement of depression-like symptoms 3 months after transplantation. The results show that dopaminergic neural precursor cells transplanted into the PF brain region alleviate Parkinson's-like non-motor symptoms in mice.

[0263] Example 11 Social approach and avoidance experiment in mice

[0264] Social approach and avoidance experiments were performed before and after drug administration (see Apelin-13 improves learning and memory impairment and depressive-like behavior in rats induced by chronic social frustration stress, Gui Shujia, Master's thesis of University of South China, 2016). The specific method is as follows: a plastic box with holes is placed on each side of a 50cm×50cm×50cm spontaneous activity box, a social mouse is placed in one of the plastic boxes with holes, and no mouse is placed in the other plastic box with holes. The interaction zone is defined as the 2 cm on both sides and in front of the plastic box with holes, the corner zone is defined as a 10 cm×10 cm square area on the opposite corner of the plastic box with holes, and the remaining area is the neutral zone. The experimental mouse is placed at the midpoint of the line connecting the two plastic boxes with holes in the neutral zone and the time is recorded as t0. A video recording device is used to track the movement trajectory of the experimental mouse within 10 minutes, and the time when the experimental mouse first enters the interaction zone on the social mouse side is recorded as t s , calculate the social latency t of the experimental mice: t = t s -t0. The social latency of mice was normalized and plotted using the linear proportional transformation method. The transformation formula is y i =x i / x 给药前 × 100%, that is, the normalized social latency is equal to the actual social latency divided by the social latency before drug administration.

[0265] The results are as follows Fig.12 As shown: 1 month after administration, the social latency of mice in the vehicle group and the treatment group was significantly increased compared with that before administration, which may indicate that under the PD model of Example 5, the anxiety-like symptoms of PD mice showed a faster progression in the early stage. Compared with 1 month after each administration, the social latency of mice in the vehicle group and the treatment group decreased at 2 months and 3 months after administration, which may indicate that under the PD model of Example 5, the anxiety-like symptoms of PD mice began to ease in the later stage. Compared with the mice in the vehicle group at the same time, the social latency of mice in the treatment group was shorter at 1 month, 2 months and 3 months after administration (3 months after administration of the treatment group vs. 3 months after administration of the vehicle group, p = 0.06), indicating that the anxiety-like symptoms in the mice in the treatment group were milder. In particular, the social latency of mice in the vehicle group did not decrease significantly 3 months after administration compared with before administration, indicating that the vehicle had no effect on treating Parkinson's-like symptoms in mice; the social latency of mice in the treatment group decreased significantly 3 months after administration compared with before administration (p<0.001), indicating that mice in the treatment group began to show behavioral improvement of anxiety-like symptoms 3 months after transplantation. The results showed that dopaminergic neural precursor cells transplanted into the PF brain region alleviated Parkinson's-like non-motor symptoms in mice.

[0266] Example 12 Novelty Suppression of Food Intake Experiment

[0267] Novelty suppression of food intake experiments were performed before and after drug administration. The specific method is as follows: before the experiment, mice were fasted but not watered overnight, and other feeding conditions remained unchanged. At the beginning of the experiment, 6 pieces of food with regular shapes were placed in the center of the activity box, and the mouse was slowly placed in the corner area of ​​the opening device with its back facing the food. After 10 minutes of collection, the mouse was gently pinched by the tail to remove it from the opening device, and the feeding latency of the mouse (i.e. the time when it first started to eat) was recorded, the activity box was cleaned, and the mouse odor was removed with alcohol, and the mouse was put back into the cage for regular feeding.

[0268] The results are as follows Fig.13As shown: One month after administration, the feeding latency of the mice in the vehicle group and the treatment group was significantly increased compared with that before administration, which may indicate that under the PD model of Example 5, the depressive-like symptoms of PD mice showed a faster progression in the early stage. Compared with 1 month after each administration, the feeding latency of the mice in the vehicle group and the treatment group was reduced at 2 months and 3 months after administration, which may indicate that under the PD model of Example 5, the depressive-like symptoms of PD mice began to ease in the later stage. Compared with the mice in the vehicle group at the same time, the feeding latency of the mice in the treatment group was shorter at 1 month and 3 months after administration, indicating that the depressive-like symptoms in the mice in the treatment group were milder. In particular, the feeding latency of the mice in the vehicle group 3 months after administration was not significantly reduced compared with that before administration, indicating that the vehicle had no effect on treating Parkinson's disease in mice; the feeding latency of the mice in the treatment group 3 months after administration was significantly reduced compared with that before administration (p<0.05), indicating that the mice in the treatment group began to show behavioral improvement of depressive-like symptoms 3 months after transplantation. The results showed that dopaminergic neural precursor cells transplanted into the PF brain region alleviated Parkinson's-like non-motor symptoms in mice.

[0269] Example 13 Immunofluorescence staining of frozen sections of mouse brain tissue

[0270] Immerse the brain tissue obtained by perfusing paraformaldehyde (PFA, biosharp, BL539A-500ml) in 20% sucrose until the tissue sinks to the bottom (2-3 days). Immerse the brain tissue in 30% sucrose until the tissue sinks to the bottom (2-3 days). Take out the dehydrated brain tissue, fix it on the sample holder with OCT glue, and quickly freeze it at -80℃ for storage. Cut the required part, thickness: 40μM. Wash once with 1×PBS buffer, place in a 96-well plate filled with 150μl preservation solution (50% glycerol + 50% 1×PBS buffer), 1 piece / well, and store at -20℃. Take out the brain slices (bleaching slices) from the -20℃ refrigerator, rinse with 1×PBS buffer 3 times, 5min / time in a 96-well plate; add 5% donkey serum to block at room temperature for 1h; add anti-tyrosine hydroxylase (TH) primary antibody (Millipore, AB152) and stem101 (anti-human nuclear protein Ku80 monoclonal antibody) (Takara, Y40400), and incubate at 4℃ overnight. Take out the brain slices incubated at 4℃ overnight, rinse with 1×PBS buffer 3 times, 5min / time; add fluorescent secondary antibody, incubate at room temperature for 1h; rinse with 1×PBS buffer 3 times, 5min / time; add 4',6-diamidino-2-phenylindole (DAPI) to seal the slices. Take a picture.

[0271] The staining results are as follows Fig.14 and Fig.15 As shown. The dopaminergic neuron loss was obvious on the modeling side (left side) of the mice in the vehicle group, and the TH staining area was greatly reduced, indicating that the vehicle had no effect on treating the Parkinson's disease in mice ( Fig.15). Three months after administration, a large number of transplanted cells survived in the PF region of the brain tissue sections of the mice in the treatment group (red, Fig.14 ), and generate many dopaminergic neurons that connect to each other to exert therapeutic effects.

[0272] The results of the above examples show that midbrain dopaminergic neural precursor cells transplanted into the PF region have a significant therapeutic effect on Parkinson's disease in mice.

[0273] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A cell preparation comprising midbrain dopaminergic neural precursor cells and a physiologically compatible solution, wherein the cell preparation is formulated as an injectable preparation for administration to the parafascicular nucleus (PF) region of the thalamus, wherein The content of OTX2+EN1+ cells was greater than 80%; The content of FOXA2+LMX1A+ cells is greater than 80%; and The content of CD166+Corin+ cells was greater than 80%.

2. The cell preparation of claim 1, wherein the midbrain dopaminergic neural precursor cells are prepared from pluripotent stem cells; preferably, the pluripotent stem cells are induced pluripotent stem cells.

3. The cell preparation of claim 1 or 2, wherein the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps: (1) culturing the pluripotent stem cells for a first time with a first culture medium, and then culturing them for a second time with a second culture medium to obtain midbrain floor plate cells; (2) culturing the midbrain floor plate cells for a third time using a third culture medium to obtain midbrain dopaminergic neural progenitor cells; as well as (3) culturing the midbrain dopaminergic neural progenitor cells for a fourth time using a fourth culture medium, and then culturing them for a fifth time using a fifth culture medium to obtain the midbrain dopaminergic neural progenitor cells; in The first culture medium comprises a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist; The second culture medium comprises a ROCK inhibitor, a TGFβ / ALK inhibitor, a BMP4 inhibitor, a GSK3β inhibitor and a SHH agonist; The third culture medium comprises a BMP4 inhibitor, a SHH agonist and a growth factor; The fourth culture medium comprises a SHH agonist and a growth factor; and The fifth culture medium comprises a ROCK inhibitor, a SHH agonist and a growth factor.

4. The cell preparation of claim 3, wherein The TGFβ / ALK inhibitor is SB431542; The BMP4 inhibitor is DMH-1; The GSK3β inhibitor is CHIR99021; The SHH agonist is SAG; The ROCK inhibitor is Y-27632; and The growth factor is FGF8b.

5. The cell preparation according to claim 3 or 4, wherein The first culture time is 6-10 days; The second culture time is 1-3 days; The third culture time is 3-7 days; The fourth culture time is 5-9 days; and The fifth culture time is 0.5-1.5 days.

6. The cell preparation of claim 1 or 2, wherein the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps: (1) culturing human induced pluripotent stem cells in a first culture medium for 6-10 days, and then culturing them in a second culture medium for 1-3 days in suspension to obtain midbrain floor plate cells; (2) suspending and culturing the midbrain floor plate cells in a third culture medium for 3-7 days to obtain midbrain dopaminergic neural progenitor cells; as well as (3) culturing the midbrain dopaminergic neural progenitor cells with the fourth culture medium for 5-9 days, and then culturing them in suspension with the fifth culture medium for 0.5-1.5 days to obtain the midbrain dopaminergic neural progenitor cells; in The first culture medium comprises SB431542, DMH-1, CHIR99021 and SAG; The second culture medium comprises Y-27632, SB431542, DMH-1, CHIR99021 and SAG; The third culture medium comprises DMH-1, SAG and FGF8b; The fourth culture medium comprises SAG and FGF8b; and The fifth culture medium contains Y-27632, SAG and FGF8b.

7. The cell preparation of claim 1 or 2, wherein the midbrain dopaminergic neural precursor cells are prepared by a method comprising the following steps: (1) culturing human induced pluripotent stem cells in a first culture medium for 8 days in an adherent manner, and then culturing them in a second culture medium for 2 days in a suspended manner to obtain midbrain floor plate cells; (2) suspending and culturing the midbrain floor plate cells in a third culture medium for 5 days to obtain midbrain dopaminergic neural progenitor cells; as well as (3) culturing the midbrain dopaminergic neural progenitor cells with the fourth culture medium for 7 days in an adherent manner, and then culturing them in the fifth culture medium for 1 day in a suspended manner to obtain the midbrain dopaminergic neural progenitor cells; in The first culture medium is a neurobasal medium containing 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021 and 1 μM SAG; The second culture medium is a neurobasal medium containing 10 μM Y-27632, 10 μM SB431542, 2 μM DMH-1, 0.6 μM CHIR99021 and 1 μM SAG; The third culture medium is a neurobasal medium containing 1 μM DMH-1, 0.2 μM SAG and 100 ng / mL FGF8b; The fourth culture medium is a neurobasal medium containing 0.2 μM SAG and 100 ng / mL FGF8b; The fifth culture medium is a neurobasal medium containing 10 μM Y-27632, 0.2 μM SAG and 100 ng / mL FGF8b; and The neurobasal medium contained 98% (v / v) DMEM / F12, 1% (v / v) non-essential amino acids, and 1% (v / v) N2 supplement.

8. Use of the cell preparation according to any one of claims 1 to 7 in the preparation of a medicament for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases.

9. A method for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases, comprising administering midbrain dopaminergic neural precursor cells to the parafascicular nucleus (PF) region of the thalamus of a subject in need thereof.

10. The method of claim 9, wherein the midbrain dopaminergic neural precursor cells are formulated into an injectable preparation comprising the midbrain dopaminergic neural precursor cells and a physiologically compatible solution.

11. The method of claim 10, wherein the injectable formulation The content of OTX2+EN1+ cells was greater than 80%; The content of FOXA2+LMX1A+ cells is greater than 80%; and The content of CD166+Corin+ cells was greater than 80%.

12. The method according to any one of claims 9 to 11, wherein the midbrain dopaminergic neural precursor cells are prepared from pluripotent stem cells; preferably, the pluripotent stem cells are induced pluripotent stem cells.

13. The method according to any one of claims 9 to 12, wherein the midbrain dopaminergic neural precursor cells are prepared by the method defined in any one of claims 3 to 7.

14. The cell preparation according to any one of claims 1 to 7, which is used for treating, alleviating, preventing and / or delaying Parkinson's disease or its symptoms or Parkinson's disease-induced diseases.

15. The use of claim 8, the method of any one of claims 9 to 13, or the cell preparation of claim 14, wherein the symptoms of Parkinson's disease are motor symptoms or non-motor symptoms.

16. The use of claim 8, the method of any one of claims 9 to 13, or the cell preparation of claim 14, wherein the symptoms of Parkinson's disease are motor symptoms and non-motor symptoms.

17. The use, method or cell preparation of claim 15, wherein the motor symptoms are selected from the group consisting of dystonia, chorea, athetosis, motor fluctuations, abnormal posture, speech disorders, bradykinesia, freezing of gait, tremor, rigidity, walking and gait difficulties.

18. The use, method or cell preparation of claim 15, wherein the non-motor symptoms are selected from the group consisting of: blood pressure regulation disorders, sleep disorders, sensory disorders, autonomic dysfunction, mood swings, cognitive disorders, hallucinations, delusions, anxiety, dementia and depression.

19. The use, method or cell preparation of claim 16, wherein The motor symptoms are selected from the group consisting of dystonia, chorea, athetosis, motor fluctuations, abnormal posture, speech disorders, bradykinesia, freezing of gait, tremor, rigidity, difficulty walking and gait; and / or The non-motor symptoms are selected from the group consisting of: blood pressure regulation disorders, sleep disorders, sensory disorders, autonomic dysfunction, mood swings, cognitive disorders, hallucinations, delusions, anxiety, dementia and depression.

20. The use of claim 8, the method of any one of claims 9 to 13, or the cell preparation of claim 14, wherein the Parkinson's disease-induced disease is Parkinson's disease-induced depression or Parkinson's disease-induced anxiety or Parkinson's disease-induced mood disorder.

Images