Rotary seat and rotary seat subsystem

Abstract

According to the invention, inverted repetitive sequences at the tail ends of the two sides of a Passer (PS) transposon are transformed, and a molecular biology method is adopted to construct and design to reduce CpG and ITR without CpG, reduce the immunogenicity of the transposon and improve the transposon efficiency. The present invention provides polynucleotides of engineered ITR sequences, polynucleotides comprising transposons of ITR sequences, and transposons systems.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a transposon and a transposon system. Background Art

[0002] Transposon is a DNA fragment that can change its position in the genome by moving freely or jumping. It is also called jumping gene. It was first discovered by American scientist Barbara McClintock. It plays many roles in the genome of eukaryotes, such as providing new proteins as domestication genes, expressing in the process of reproductive-somatic cell differentiation, and playing a role in the rearrangement of offspring DNA. According to the different transposition mechanisms of transposons, they can be divided into RNA transposons and DNA transposons. RNA transposons transpose through RNA intermediates, transcribe their own DNA into RNA, and then reverse transcribe RNA to form DNA and insert it into a new position. It uses a copy and paste mechanism and is also called a reverse transcription transposon. DNA transposons do not need RNA as an intermediate for transposition. Currently, three main types of DNA transposons have been discovered, namely cut-and-paste, peel-and-paste, and self-replicating transposons. The family of DNA transposons with the cut-and-paste mechanism is widely distributed. Its transposition reaction requires transposase to recognize two ITRs, cut and release the DNA transposon from the original site, and then integrate the cut transposon into the new location. Due to their inherent ability to insert DNA, the application of cut-and-paste transposons in gene therapy has been widely reported and shows great potential in tumor immunotherapy.

[0003] Passer (PS) is a highly active transposon from the fish genome, widely distributed in vertebrates and invertebrates, and a member of the pogo superfamily. It has the characteristics of simple structure, short ITR (<30bp), and a single ORF encoding 400-500 amino acids. Its transposase has a highly conserved catalytic motif (DD35D) and a short inverted terminal repeat sequence (ITR). It shows high transposition activity in mammalian cells. The PS transposon is an alternative and powerful genetic tool for transgenic and insertional mutagenesis in vertebrates.

[0004] Non-viral gene vectors have been shown to have therapeutic effects in animal models of various inherited and acquired diseases. However, CpG-induced inflammation often leads to immune-mediated destruction of transgenic cells, which blocks transgene expression and prolongs inflammation, leading to the occurrence of autoimmunity. CpG dinucleotides are usually methylated in mammalian genomes in a specific sequence context (PuPuCGPyPy). DNA containing unmethylated CG motifs can activate mouse bone marrow cell B lymphocytes and stimulate immune defense. Toll-like receptor 9 (TLR9) recognizes non-methylated CpG-containing DNA fragments as foreign DNA and induces acute inflammatory responses accordingly. Summary of the invention

[0005] The present invention transforms the inverted terminal repeat sequences (ITR, also called TIR) on both sides of the Passer (PS) transposon, and uses molecular biology methods to construct ITRs with reduced CpG and without CpG, thereby reducing the immunogenicity of the transposon and improving the transposition efficiency.

[0006] The first aspect of the present invention provides a polynucleotide of an ITR sequence, wherein the ITR sequence is a mutant of the inverted terminal repeat sequence of the Passer (PS) transposon, and compared with the inverted terminal repeat sequence of the Passer (PS) transposon, the inverted terminal repeat sequence contains reduced or no CpG motif.

[0007] Preferably, the ITR sequence of the Passer (PS) transposon can be an ITR sequence of a wild-type PS transposon or an ITR sequence containing other mutations. In some embodiments, the ITR sequence of the Passer (PS) transposon is shown in any one of SEQ ID NOs: 1, 99-120.

[0008] In some embodiments, the ITR sequence comprises a polynucleotide sequence that is at least 75% identical to SEQ ID NO: 1, and does not contain 1-3 CpG motifs in the polynucleotide sequence as shown in SEQ ID NO: 1. The sequence of the CpG motif is shown in positions 2-3, 11-12, or 23-24 of SEQ ID NO: 1.

[0009] In some embodiments, the ITR sequence does not contain any CpG motif in the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the CpG motif is replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the CpG motif is replaced by ApG.

[0010] In some embodiments, the ITR sequence does not contain any two CpG motifs in the polynucleotide sequence shown in SEQ ID NO:1; preferably, the two CpG motifs are arbitrarily replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the first CpG motif is replaced by ApG; most preferably, the two CpG motifs are replaced by ApG and ApG, or ApG and TpG, respectively.

[0011] In some embodiments, the ITR sequence does not contain the three CpG motifs in the polynucleotide sequence shown in SEQ ID NO:1; preferably, the three CpG motifs are arbitrarily replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the first two CpG motifs are replaced by ApG and TpG, respectively; most preferably, the three CpG motifs are replaced by ApG, TpG and CpT, respectively.

[0012] In some embodiments, the ITR sequence is as shown in SEQ ID NO:2-32, preferably as shown in SEQ ID NO:2, 7, 10, 11.

[0013] The second aspect of the present invention provides a transposon comprising a polynucleotide of the ITR sequence described in any embodiment of the present invention.

[0014] In some embodiments, the transposon has more than two ITRs at at least one end, and / or the transposon has more than two repeats of a TA sequence outside the terminal inverted repeat sequence at at least one end.

[0015] In some embodiments, the transposon has two terminal inverted repeat sequences at each end, and includes four TA sequence repeats outside the terminal inverted repeat sequences at each end.

[0016] In some embodiments, the transposon comprises a combination of DNA elements located between two terminal inverted repeat sequences, and the combination of DNA elements includes but is not limited to promoters, enhancers, expressed genes, 5-UTRs, 3-UTRs and other sequence elements well known to those skilled in the art.

[0017] In some embodiments, the transposon includes or does not include a target gene (or foreign gene) expression cassette located between the terminal inverted repeat sequences. The target gene expression cassette may include gene function elements such as a promoter, a target gene, and a polyA signal sequence.

[0018] In some embodiments, the gene of interest encodes a protein selected from a cell receptor, an immune checkpoint protein, a cytokine, a T cell receptor, a B cell receptor, a chimeric antigen receptor, and any combination thereof.

[0019] In another aspect, the present disclosure provides a transposon system, comprising a transposase or a polynucleotide encoding a transposase, and a transposon; the transposase is a PS transposase, a PS mutant transposase, or a PS fusion transposase; and the transposon is the transposon of any embodiment herein.

[0020] In some embodiments, the PS transposase is the PS transposase in CN201910366530.0, and the amino acid sequence is shown in SEQ ID NO: 33.

[0021] In some embodiments, the PS mutant transposase is a PS mutant transposase (also referred to as JL transposase) according to any one of the embodiments of CN202310081106.8; preferably, the PS mutant transposase is the same as SEQ ID Compared with the PS transposase shown in NO: 33, it has one or more of the following mutations: TQS57-59KKA, T129R, T129K, I98K, TQ57-58RK, TQ57-58RK\T129K, TQ57-58RK\T129R, E32K, E32K\T129K, E32K\T129R, TQ57-58RK\I98K, TQ57-58RK\I98K\T129K, TQS57-59KKA\I98K, TQS57-59KKA\I98K\T129K, R123H, Q136K, K16R, E32K\T129K 47K, TQ57-58RR, E32K\T57R\Q58R, T57R, T57K, Q58K, Q58R, S59A, M95L, Y46Q, A8S, T187K, I35V, N199H, N193S, T350S, Q22K, T368E, N2 13D, H24R, T150A, H165D, K55R, K73R, L228M, E335S, K159H, V359L, T129Q, H215K, R51K, A84L, Q69E, I284L, K45R, H215E, H215Q, I237V.

[0022] In some embodiments, the fusion transposase is a wild-type PS transposase or a mutant thereof fused with a functional polypeptide, wherein the functional polypeptide is a DNA sequence-specific or non-specific binding domain and / or a nuclear localization signal domain.

[0023] In some embodiments, the DNA sequence-specific or non-specific binding domain comprises a leucine zipper domain, a CRISPR / Cas domain, a TALE domain, a zinc finger domain, an AAV Rep DNA binding domain, or any combination thereof.

[0024] In some embodiments, the nuclear localization signal domain comprises SV40 NLS, C-myc NLS, TAF1 NLS, TP53 NLS, STAT3 NLS, or any combination thereof.

[0025] In some embodiments, the functional polypeptide and the wild-type PS transposase or a mutant thereof may or may not contain a linker.

[0026] In some embodiments, the polynucleotide encoding the transposase is mRNA, preferably, the mRNA is chemically modified.

[0027] In some embodiments, the transposon is present in a DNA vector. Preferably, the DNA vector is selected from conventional circular DNA plasmids, linear DNA plasmids, or DNA forms that do not contain antibiotics or / and replicon DNA sequences, such as minicircle plasmids, nanoplasmids, doggybone linear miniplasmids. Preferably, the DNA vector is an antibiotic-free miniplasmid, such as an antibiotic-free miniplasmid in any embodiment of CN202310072956.1.

[0028] In some embodiments, the DNA vector is a microcarrier, the backbone sequence of which is within 600 bp in length, and has reduced and / or no CpG DNA motif.

[0029] In some embodiments, the polynucleotide encoding the transposase is DNA, and it and the transposon are present in the same DNA vector or in different DNA vectors.

[0030] In some embodiments, the polynucleotide molecule comprising a sequence encoding a PS transposase or a PS mutant transposase, and / or a transposon ITR sequence is present in a viral vector, including but not limited to AAV, lentivirus, retrovirus, adenovirus, etc.

[0031] In yet another aspect, the present disclosure provides a host cell comprising or capable of producing a polynucleotide of an ITR according to any embodiment herein, a polynucleotide of a transposon according to any embodiment herein, or a transposon system according to any embodiment herein.

[0032] In yet another aspect, the present disclosure provides a method for preparing a cell, comprising the step of introducing a polynucleotide of an ITR according to any embodiment of the present invention, a polynucleotide of a transposon according to any embodiment of the present invention, or a transposon system according to any embodiment of the present invention into the cell.

[0033] In some embodiments, the introducing comprises contacting the cell with a DNA vector containing the transposon. In some embodiments, the introducing comprises contacting the cell with an mRNA encoding the transposase and a plasmid vector containing the transposon. In some embodiments, the introducing comprises contacting the cell with a plasmid vector containing a polynucleotide encoding the transposase and the transposon. In some embodiments, the introducing comprises contacting the cell with a plasmid vector containing a polynucleotide encoding the transposase and a plasmid vector containing the transposon. In some embodiments, the introducing comprises contacting the cell with the transposase.

[0034] In some embodiments, the cell is a primary cell isolated from a subject. In some embodiments, the subject is a human. In some embodiments, the subject is a patient with a disease. In some embodiments, the subject has been diagnosed with cancer or a tumor. In some embodiments, the cell is separated from the blood of the subject. In some embodiments, the cell comprises a primary immune cell. In some embodiments, the cell comprises a primary leukocyte. In some embodiments, the cell comprises a primary T cell. In some embodiments, the primary T cell comprises a γδT cell, a helper T cell, a memory T cell, a natural killer T cell, an effector T cell, or any combination thereof. In some embodiments, the primary immune cell comprises a CD3+ cell. In some embodiments, the cell comprises a stem cell. In some embodiments, the stem cell is selected from: an embryonic stem cell, a hematopoietic stem cell, an epidermal stem cell, an epithelial stem cell, a bronchial alveolar stem cell, a mammary stem cell, a mesenchymal stem cell, an intestinal stem cell, an endothelial stem cell, a neural stem cell, an olfactory adult stem cell, a neural crest stem cell, a testicular cell, and any combination thereof. In some embodiments, the stem cell comprises an induced pluripotent stem cell.

[0035] In some embodiments, the cell is from an animal, such as a vertebrate or an invertebrate, preferably a mammal, and further preferably a human. In some embodiments, the cell is an immune cell, preferably a T cell.

[0036] In some embodiments, the introducing comprises transfecting the cell by electroporation, microinjection, calcium phosphate precipitation, cationic polymers, dendrimers, liposomes, lipid nanoparticles (LNP), microparticle bombardment, fugene, direct sonic loading, cell squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, nucleofection, or any combination thereof.

[0037] In some embodiments, the introducing comprises electroporating the cells.

[0038] In some embodiments, the introduction comprises contacting the cell with mRNA encoding the transposase and a plasmid containing the transposon. Preferably, the mRNA is used at a dosage of 1×10 7 1-30 μg of cells, the dosage of the plasmid is per 1×10 7 The most preferred dosage of the mRNA is 0.1-5 μg per 1×10 7 The concentration of the plasmid used is 1-5 μg per 1×10 7 Cells 0.1-2μg.

[0039] Another aspect of the present disclosure provides a transgenic animal or transgenic cell produced using the polynucleotide of ITR of any embodiment herein, the transposon of any embodiment herein, or the transposon system of any embodiment herein, wherein the transgenic expression element comprises a gene expression cassette and transposon ITR sequence elements on both sides.

[0040] Yet another aspect of the present disclosure provides a kit, comprising: a polynucleotide of an ITR according to any embodiment herein, a transposon according to any embodiment herein, or a transposon system according to any embodiment herein, or a cell according to any embodiment herein.

[0041] Yet another aspect of the present disclosure provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and cells prepared by the method of any embodiment herein.

[0042] In another aspect, the present disclosure provides a polynucleotide of an ITR according to any embodiment of the present invention, a transposon according to any embodiment of the present invention, or a transposon system according to any embodiment of the present invention, a cell according to any embodiment of the present invention, or a use of a cell according to any embodiment of the present invention, which is selected from any one of the following (1)-(6):

[0043] (1) Application in the preparation of drugs or reagents for integrating the target gene expression cassette into the host cell genome;

[0044] (2) Application in the preparation of tools for integrating target gene expression cassettes into the host cell genome;

[0045] (3) Application in the preparation of transgenic animals and transgenic cells;

[0046] (4) Application in the preparation of drugs or preparations for genome research, gene therapy, cell therapy, or stem cell induction and differentiation after induction;

[0047] (5) Application in the preparation of tools for genome research, gene therapy, cell therapy, or stem cell induction and post-induced differentiation;

[0048] (6) Application in the preparation of kits, engineered immune cells or pharmaceutical compositions.

[0049] Another aspect of the present disclosure provides a method of treatment, comprising: (a) introducing a transposon as described herein and a transposase that recognizes the transposon into a cell, thereby generating a genetically modified cell; (b) administering the genetically modified cell to a patient in need of the treatment. In some embodiments, the genetically modified cell comprises a transgene introduced by the transposon. In some embodiments, the patient has been diagnosed with cancer or a tumor. In some embodiments, the administration comprises infusing the genetically modified cell into a blood vessel of the patient. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 :pTini-PS(CES)-dCGEGFP plasmid map.

[0051] Figure 2 : Integration efficiency of ITR first site modification in CHO cells.

[0052] Figure 3 :Integration efficiency of ITR second site modification in CHO cells.

[0053] Figure 4A : Integration efficiency of single mutation transformation at the third site of ITR in CHO cells using pTini-PS(CES)-dCGEGFP-AGAG as template.

[0054] Figure 4B : Using pTini-PS(CES)-dCGEGFP-AGAG as template, the integration efficiency of ITR third site double mutation transformation in CHO cells.

[0055] Figure 4C : Integration efficiency of single mutation transformation at the third site of ITR in CHO cells using pTini-PS(CES)-dCGEGFP-AGTG as template.

[0056] Figure 5 : Integration efficiency of ITR-preferred mutants in Jurkat cells.

[0057] Figure 6 : Integration efficiency of ITR preferred mutants in PBMCs. DETAILED DESCRIPTION

[0058] Compared with viral transduction of immune cells (such as T lymphocytes), delivery of transgenes via DNA transposons has several advantages: ease of use, potential for delivery of large gene fragments, rapid clinical application and low production costs, long-term and high-level stable expression of transgenes, significantly less mutagenicity, non-carcinogenicity and reversibility compared to retroviruses. Ex vivo genetic modification of non-transformed primary human T lymphocytes using gene transfer delivery systems based on non-viral vectors is extremely difficult and requires a high level of transposition efficiency to be achieved. Currently, the mature cases reported are limited to Sleeping Beauty transposons, PiggyBac transposons, and TcBuster transposons.

[0059] Prior patent application CN201910366530.0 (the entire contents of which are incorporated herein by reference) proved that PS transposon is an effective non-viral tool for integrating transgenes into cell chromosomes, but the transposition efficiency of PS transposon system still cannot meet the needs for cell or gene therapy. Prior patent application CN202310081106.8 (the entire contents of which are incorporated herein by reference) engineered PS transposase to obtain PS mutant transposase (also known as JL transposase), which further improved the transposition efficiency.

[0060] DNA transposons can transpose via a non-replicative "cut and paste" mechanism. This requires recognition of two terminal inverted repeats (ITRs) by a catalytic enzyme, the transposase, which can cut its target, thereby releasing the DNA transposon from its donor template. After cutting, the DNA transposon can then be integrated into the recipient DNA cut by the same transposase. In some of their natural configurations, the DNA transposon is flanked by two terminal inverted repeats and may contain genes encoding transposases that catalyze transposition.

[0061] The genome editing application based on DNA transposon includes a binary system containing a transposase component and a transposon component, wherein the transposase component is a transposase or its encoding nucleic acid (mRNA or DNA), and the transposon component is a transposon DNA containing a target gene flanked by terminal inverted repeat sequences and for insertion into the host genome. The transposon component and the transposase component are co-delivered into the target cell to achieve a transposition integration effect that relies on a cutting and pasting mechanism.

[0062] Inverted terminal repeats (ITR)

[0063] In this paper, the inverted terminal repeat sequences (ITR, also known as TIR) on both sides of the Passer (PS) transposon were modified. Using molecular biological methods, ITRs with reduced CpG and no CpG were constructed to reduce the immunogenicity of the transposon without affecting or even improving the transposition efficiency.

[0064] The first aspect of the present invention provides a polynucleotide of an ITR sequence, wherein the ITR sequence is a mutant of the terminal inverted repeat sequence of the Passer (PS) transposon, and compared with the terminal inverted repeat sequence of the Passer (PS) transposon, the terminal inverted repeat sequence contains reduced or no CpG motif.

[0065] Preferably, the ITR sequence of the Passer (PS) transposon can be an ITR sequence of a wild-type PS transposon from different sources or an ITR sequence containing other mutations. In some embodiments, the ITR sequence of the Passer (PS) transposon is shown in any one of SEQ ID NOs: 1, 99-120.

[0066] In some embodiments, the ITR sequence comprises a polynucleotide sequence that is at least 75% identical to SEQ ID NO: 1, and does not contain 1-3 CpG motifs in the polynucleotide sequence as shown in SEQ ID NO: 1. The sequence of the CpG motif is shown in positions 2-3, 11-12, or 23-24 of SEQ ID NO: 1.

[0067] The engineering modification methods for ITR sequences without CpG motifs include: replacing or deleting 1 or 2 nucleotides in the CpG motif, or adding 1 or more nucleotides in the middle of the CpG motif to reduce the immunogenicity caused by the CpG motif.

[0068] In some embodiments, the ITR sequence does not contain any CpG motif in the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the CpG motif is replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the CpG motif is replaced by ApG.

[0069] In some embodiments, the ITR sequence does not contain any two CpG motifs in the polynucleotide sequence shown in SEQ ID NO:1; preferably, the two CpG motifs are arbitrarily replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the first CpG motif is replaced by ApG; most preferably, the two CpG motifs are replaced by ApG and ApG, or ApG and TpG, respectively.

[0070] In some embodiments, the ITR sequence does not contain the three CpG motifs in the polynucleotide sequence shown in SEQ ID NO:1; preferably, the three CpG motifs are arbitrarily replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the first two CpG motifs are replaced by ApG and TpG, respectively; most preferably, the three CpG motifs are replaced by ApG, TpG and CpT, respectively.

[0071] The fewer the number of CpG motifs in the ITR sequence, the lower the immunogenicity, but at the same time, the greater the difference from the wild-type ITR sequence, the more likely it is to affect the recognition of the transposase and reduce the transposition efficiency. In some embodiments, the ITR sequence is as shown in SEQ ID NO: 2-32, preferably as shown in SEQ ID NO: 2, 7, 10, 11.

[0072] Transposon

[0073] The present invention also provides a transposon polynucleotide, comprising the ITR polynucleotide described in any embodiment of the present invention. It should be understood that the terminal inverted repeat sequences at both ends of the transposon may be one of the terminal inverted repeat sequences with a nucleotide mutation, or multiple or all of them may have a nucleotide mutation, and the nucleotide mutations of each terminal inverted repeat sequence may be the same or different.

[0074] In some embodiments, the transposon DNA sequence has multiple ITRs (i.e., multiple copies of ITR sequences connected in series) at one or both ends, which can be expressed as (ITR)n, n≥2, such as 2, 3, 4, etc. The multiples include but are not limited to 2 times, 3 times, or 4 times, etc. The number of copies of the ITR sequences at both ends may be the same or different, for example, each end independently has 1, 2, 3, 4 or more repeated ITRs, and both ends do not have 1 ITR sequence at the same time. The repeated ITR sequence may or may not contain the above-mentioned nucleotide mutations compared to the wild-type ITR sequence.

[0075] In some embodiments, the ITR sequences at both ends of the transposon DNA sequence have a cleavage site sequence for a transposase, and the cleavage site sequence is TA (nucleotide sequence). The ITR sequence may or may not contain the above-mentioned nucleotide mutation compared to the wild-type ITR sequence. In some embodiments, one or both ends of the transposon DNA have a multi-copy cleavage site sequence, expressed as (TA)m, m≥2, and the multi-copy value m is preferably 2, 3 or 4. The number of TA repeats at both ends may be the same or different, for example, each independently has 1, 2, 3, 4 or more repeated TA sequences at both ends, and both ends are not 1 TA sequence at the same time.

[0076] In some embodiments, the transposon includes at the left end (TA)m (ITR) n , including (ITR) on the right side p (TA) q , wherein m, n, p, q are integers, m≥1, preferably 2-4, n≥1, preferably 2-4, p≥1, preferably 2-4, q≥1, preferably 2-4, ITR can be a wild-type PS transposon ITR or a mutant ITR, and when the ITR is a wild-type ITR, m, n, p, q are not 1 at the same time (i.e., at least one of m, n, p, q is ≥2). In addition, when the ITR is repeated, each repeated ITR can be independently selected from any sequence of the wild-type ITR sequence and its mutant. In a preferred embodiment, m=2-4, preferably 4, n=2, p=2-4, preferably 4, and q is 2. In a more preferred embodiment, the ITR is a mutant ITR, m=2-4, preferably 4, and n=2.

[0077] In some embodiments, the transposon DNA sequence preferably includes (TA)2(ITR1)2, (TA)3(ITR1)2, or (TA)4(ITR1)2, wherein ITR1 is a mutant ITR, most preferably (TA)4(ITR1)2. In some embodiments, the transposon DNA sequence contains (TA)4(ITR1)2 at one or both ends.

[0078] The transposon may comprise a combination of DNA elements located between ITR sequences, such as a target gene expression cassette. The combination of DNA elements includes, but is not limited to, sequence elements well known to those skilled in the art such as promoters, enhancers, target genes (expressed genes), 5-UTRs, 3-UTRs, etc. The term "exogenous gene" or "target gene" as used throughout this article refers to a nucleic acid or protein sequence that is not naturally associated with a target gene or a host cell that is an object of introduction, including a naturally occurring nucleic acid sequence located in a non-naturally occurring genomic location, or a non-naturally occurring multiple copy of a naturally occurring nucleic acid (e.g., a DNA sequence).

[0079] In some embodiments, the DNA element combination includes an expressed gene. Accordingly, the DNA element combination may also include a promoter selected from, but not limited to, CMV, EFS, MND, EF1α, CAGC, PGK, UBC, U6, H1, and Cumate. In some embodiments, the expressed gene encoding is selected from a protein selected from a cell receptor, an immune checkpoint protein, a cytokine, and any combination thereof. In some embodiments, the expressed gene encoding is selected from a protein selected from a cell receptor, an immune checkpoint protein, a cytokine, a T cell receptor (TCR), a B cell receptor (BCR), a chimeric antigen receptor, and any combination thereof.

[0080] In some embodiments, the expressed gene encodes CAR. CAR may sequentially include a binding antigen binding domain, a hinge region, a transmembrane region, and an intracellular signal region. The hinge region, transmembrane region, and intracellular signal region known in the art for constructing CAR may be used to construct the CAR of the present invention. Typically, the antigen binding domain is able to bind to a membrane antigen widely expressed by tumor cells with moderate affinity, and the polypeptide is usually inserted with an antigen epitope, and the insertion position is selected from any one, two, or three of the following three positions: the N-terminus of the polypeptide, between the polypeptide and the hinge region, and inside the polypeptide. The antigen binding domain may be a natural polypeptide or an artificially synthesized polypeptide. The chimeric antigen receptor can be directed against one or more of the following antigens: CD19, CD20, CEA, GD2, FR, PSMA, PMEL, CA9, CD171 / L1-CAM, IL-13RL1, MART-1, ERBB2, NY-ESO-1, AFP, MUC1, CD22, CD23, CD30, CD33, CD44v7 / 8, CD70, VEGFR1, VEGFR2, IL-11R / , EGP-2, EGP-40, FBP, GD3, PSCA, FSA, PSA, HMGA2, LeY, EpCAM, MSLN, IGFR1, EGFR, EGFRvIII, ERBB3, ERBB4, CA125, CA15-3, CA19-9, CA72-4, CA242, CA50, CYFRA21-1, SCC, AFU, EBV-VCA, POA and PROGRP.

[0081] In some embodiments, the antigen binding domain may comprise an antibody, an antibody mimetic, a protein scaffold, or a fragment thereof. In certain embodiments, the antibody is a chimeric antibody, a recombinant antibody, a humanized antibody, or a human antibody. In certain embodiments, the antibody is affinity-tuned. Non-limiting examples of antibodies of the present invention include single-chain variable fragments (scFv), VHH, single-domain antibodies (sdAB), small modular immunopharmaceuticals (SMIP) molecules, or nanobodies. In certain embodiments, VHH is of the camelid family. Alternatively or in addition, in certain embodiments, VHH is humanized. Non-limiting examples of antibody fragments of the present invention include complementary determining regions, variable regions, heavy chains, light chains, or any combination thereof. Non-limiting examples of antibody mimetics of the present invention include: affibodies, Afflilin molecules, affimers, Affitin molecules, alphabodies, anticalins, and Avimer molecules, DARPins, Fynomers, Kunitz domain peptides, or monobodies. Non-limiting examples of protein scaffolds of the present invention include Centyrin.

[0082] In some embodiments, CAR suitable for the present invention can refer to CN 202111681582.0, the entire contents of which are incorporated herein by reference.

[0083] In some embodiments, the expressed gene encodes an immune checkpoint inhibitor, such as a PD-1 antibody, a CTLA-4 antibody, etc. Non-limiting examples of the antibody include a single-chain variable fragment (scFv), a VHH, a single domain antibody (sdAB), a small modular immunopharmaceutical (SMIP) molecule, or a nanobody.

[0084] In some embodiments, the PD-1 antibodies suitable for use in the present invention can be referenced to CN 202111681582.0, the entire contents of which are incorporated herein by reference.

[0085] In some embodiments, the expressed genes encode CAR and PD-1 antibodies as described in CN 202111681582.0.

[0086] Transposons are usually provided in the form of nucleic acid constructs, particularly DNA vectors. In this regard, any DNA vector that is convenient for introducing transposons into cells in the art can be used, including but not limited to conventional circular DNA plasmids, linear DNA plasmids, minicircular plasmids, nanoplasmids, Doggybone and other DNA forms that do not contain antibiotics or / and replicon DNA sequences. In some embodiments, the DNA vector is a DNA microcarrier, the DNA backbone sequence of which does not contain an antibiotic expression cassette and is preferably limited to a length of less than 600 bp, and / or does not contain a CpG DNA motif. In some embodiments, the DNA vector is a non-resistant microplasmid, i.e., a microplasmid without an antibiotic resistance gene (a microplasmid without an antibiotic expression cassette), also referred to as a tiny or tiniplasmid. The non-resistant microplasmid suitable for the present invention can be referred to patent application 202310072956., and the entire contents of this application are incorporated herein by reference.

[0087] Transposase

[0088] The transposase suitable for the ITR sequence or transposon of the present invention is PS transposase, PS mutant transposase or PS fusion transposase.

[0089] In some embodiments, the PS transposase is the PS transposase in CN201910366530.0, and the amino acid sequence is shown in SEQ ID NO: 33.

[0090] In some embodiments, the PS mutant transposase is the PS mutant transposase (also referred to as JL transposase) of any embodiment in CN202310081106.8.

[0091] The PS mutant transposase has one or more of the following mutations compared to the PS transposase shown in SEQ ID NO: 33: TQS57-59KKA, T129R, T129K, I98K, TQ57-58RK, TQ57-58RK\T129K, TQ57-58RK\T129R, E32K, E32K\T129K, E32K\T129R, TQ57-58RK\I98K, TQ57-58RK\I98K\T129K, TQS57-59KKA\I98K, TQS57-59KKA\I98K\T129K, R123H, Q136K, K16R, E32K\T129K, E32K\T129R, 47K, TQ57-58RR, E32K\T57R\Q58R, T57R, T57K, Q58K, Q58R, S59A, M95L, Y46Q, A8S, T187K, I35V, N199H, N193S, T350S, Q22K, T368E, N2 13D, H24R, T150A, H165D, K55R, K73R, L228M, E335S, K159H, V359L, T129Q, H215K, R51K, A84L, Q69E, I284L, K45R, H215E, H215Q, I237V. Preferably, the PS mutant transposase is JL18 transposase, which has the following mutation compared to the PS transposase shown in SEQ ID NO: 33: TQS57-59KKA.

[0092] PS transposase or PS mutant transposase can be fused with other functional polypeptides or protein domains, and will not affect or even improve the transposase or transposon gene integration function. There is no restriction on the PS transposase mutant in the fusion transposase. The inventors have found that, when a functional polypeptide (especially the leucine zipper domain described below) is fused, no matter what kind of mutation of PS transposase, a higher gene integration function than wild-type PS transposase can be obtained.

[0093] The "functional polypeptide" described herein refers to a polypeptide having its own function, such as a DNA sequence-specific or non-specific binding domain and / or a nuclear localization signal domain (NLS). The DNA sequence-specific or non-specific binding domain refers to a domain that functions based on DNA sequence specificity or non-specificity, such as a leucine zipper domain, a CRISPR / Cas domain, a TALE domain, a zinc finger domain, an AAV Rep DNA binding domain, or any combination thereof. The nuclear localization signal domain includes SV40 NLS, C-myc NLS, TAF1NLS, TP53 NLS, STAT3 NLS, or any combination thereof. The amino acid sequences of these nuclear localization signal domains can be found in Chinese patent application CN202211150935.9, etc.

[0094] In some embodiments, the leucine zipper domain is derived from the Basic_leucine-zipper_C protein family of IPR020983 in the InterPro protein database (https: / / www.ebi.ac.uk / interpro / ), the bZIP protein family of IPR004827, and the bZIP_sf protein family of IPR046347. The domain portion that mediates homodimerization. In some embodiments, the leucine zipper domain is selected from C / EBPα (also referred to as C-EBPO or C / EBPO in this article), LZIP, CREPT, TEF.

[0095] In some embodiments, the DNA sequence-specific or non-specific binding domain may be located at the C-terminus or N-terminus of the transposase. In some embodiments, the nuclear localization signal domain may be located at the C-terminus or N-terminus of the transposase, preferably the N-terminus. In some embodiments, the DNA sequence-specific or non-specific binding domain and the nuclear localization signal domain may be located at the same end or different ends of the transposase. When located at the same end of the transposase, from the N-terminus to the C-terminus, it may be a DNA sequence-specific or non-specific binding domain-nuclear localization signal domain, or it may be a nuclear localization signal domain-DNA sequence-specific or non-specific binding domain. When located at different ends of the transposase, the DNA sequence-specific or non-specific binding domain and the nuclear localization signal domain may be located at the N-terminus and C-terminus of the transposase, or at the C-terminus and N-terminus, respectively.

[0096] In an exemplary structure, when a C-myc NLS domain is present, from the N-terminus to the C-terminus are a leucine zipper domain, a C-myc NLS domain, and a transposase. By adding a leucine zipper domain, homodimerization can be mediated, thereby improving transposition efficiency.

[0097] In the fusion transposase, the transposase, the DNA sequence-specific or non-specific binding domain, and the nuclear localization signal domain can be directly connected or separated by a linker. Typically, the linker comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, or at least 50 amino acids. Exemplarily, the sequence of the linker is (GGGS) n or A(EAAAK) n A, n is a positive integer greater than 0, such as 1, 2, 3, 4 or 5; preferably, the sequence of the linker is GGGS.

[0098] The sequence of the PS transposase or PS mutant transposase described herein may be a modified polypeptide sequence. Modifications (usually without changing the primary structure) include: chemical derivatization of the polypeptide in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as those produced by glycosylation modification during the synthesis and processing of the polypeptide or in further processing steps. Such modifications can be accomplished by exposing the polypeptide to an enzyme that performs glycosylation (such as a mammalian glycosylase or deglycosylase). Modified forms also include sequences with phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides that have been modified to increase their resistance to proteolysis or optimize their solubility.

[0099] It should be understood that in gene cloning operations, it is often necessary to design suitable restriction sites, which will inevitably introduce one or more irrelevant residues at the end of the expressed amino acid sequence, which does not affect the activity of the target sequence. In order to construct fusion proteins, promote the expression of recombinant proteins, obtain recombinant proteins that are automatically secreted outside the host cell, or facilitate the purification of recombinant proteins, it is often necessary to add some amino acids to the N-terminus, C-terminus or other suitable regions in the protein of the recombinant protein, for example, including but not limited to suitable linker peptides, signal peptides, leader peptides, terminal extensions, etc. Therefore, the amino terminus or carboxyl terminus of the transposase of the present invention may also contain one or more polypeptide fragments as protein tags. Any suitable tag can be used herein. For example, the tag can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6. These tags can be used to purify proteins.

[0100] Polynucleotide molecule encoding transposase

[0101] The present invention provides polynucleotide molecules encoding the transposase of the present invention. The present invention also provides a complementary sequence of the coding sequence of the transposase. The polynucleotide can be a recombinant nucleic acid molecule or a synthetic one; it can include DNA, RNA and PNA (peptide nucleic acid) and can be a hybrid thereof. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The present invention also includes degenerate variants of the polynucleotide sequence encoding the JL transposase, i.e., nucleotide sequences encoding the same amino acid sequence but with different nucleotide sequences.

[0102] In some embodiments, the polynucleotide molecule comprises a DNA encoding the transposase. In some embodiments, the polynucleotide is present in a nucleic acid construct such as a DNA vector. The vector may be a cloning vector or an expression vector. The expression vector comprises an expression cassette for the transposase, which is a nucleic acid construct that contains a promoter, a transposase coding sequence, and a PolyA tailing signal sequence. The expression vector generally also contains other elements that are generally contained in the vector, such as a multiple cloning site, a resistance gene, a replication initiation site, and the like. The nucleic acid construct may also contain other elements required for expression, including but not limited to enhancers, and the like. The DNA vector includes conventional circular DNA plasmids, linear DNA plasmids, and also includes DNA forms that do not contain antibiotics and / or replicon DNA sequences such as minicircle plasmids, nanoplasmids, and doggybone linear miniplasmids. In some embodiments, the polynucleotide is present in a viral vector, including but not limited to AAV, lentivirus, retrovirus, adenovirus, and the like. In some embodiments, the DNA vector is a DNA microcarrier, the DNA backbone sequence of which does not contain an antibiotic expression cassette and is preferably limited to a length of less than 600 bp, and / or does not contain a CpG DNA motif.

[0103] In some embodiments, the polynucleotide comprises a messenger RNA (mRNA) encoding the transposase. In some embodiments, the mRNA is chemically modified, such as pseudouridine (ψ), N1-methyl pseudouridine (m1ψ), 5-methylcytosine nucleoside (m5C), 5-methoxyuridine (5moU), etc.

[0104] Transposon system

[0105] The present invention also relates to a system for genome editing (transposon system), which comprises the transposase and the transposon. In some embodiments, a transposon system is provided, which comprises a transposon of the ITR sequence and a transposase that can recognize the transposon or a polynucleotide encoding it. In some embodiments, the transposon system provided is a transposon system of a PS mutant transposase, which comprises: (1) a transposon as described herein, or a polynucleotide encoding it, and (2) a JL transposon or a wild-type PS transposon as described herein.

[0106] In some embodiments, the transposon ITR sequences of the transposon system are each independently selected from the sequence shown in any one of SEQ ID NOs: 2-32, or their reverse complementary sequences.

[0107] In some embodiments, the transposon may be present in an expression vector. In many cases, the expression vector may be a DNA plasmid, including but not limited to conventional circular DNA plasmids, linear DNA plasmids, minicircle plasmids, nanoplasmids, Doggybone, etc., which do not contain antibiotics or / and replicon DNA sequences. Sometimes, the expression vector may be a minicircle vector. As used herein, the term "minicircle vector" may refer to a minicircle plasmid derivative that does not contain most (if not all) prokaryotic vector parts (e.g., control sequences or non-functional sequences of prokaryotic origin). In some cases, the toxicity to cells produced by transfection or electroporation may be mitigated by using "minicircles" as described herein. In some embodiments, the DNA vector is a non-antimicroplasmid, such as a non-antimicroplasmid in any embodiment in CN202310072956.1.

[0108] In some embodiments, the polynucleotide encoding the transposase of the transposon system may be DNA, which may be present in an expression vector, and may be present in the same expression vector or in a different expression vector as the transposon. The expression vector may be as described in any embodiment herein.

[0109] In some embodiments, the polynucleotide encoding the transposase of the transposon system may be a messenger RNA (mRNA). mRNA can be produced by many methods well known to those of ordinary skill in the art, such as but not limited to in vivo transcription and RNA purification, in vitro transcription and de novo synthesis. In many cases, mRNA can be chemically modified. Chemically modified mRNA can be more resistant to degradation than unmodified or natural mRNA, or can be degraded faster. In many cases, chemical modification of mRNA can enable mRNA to be translated with higher efficiency. Chemical modification of mRNA can be performed using known techniques available to those skilled in the art or by commercial suppliers.

[0110] The transposon system disclosed in the present invention can be applied to stable transfection of cells, cell line development, genome modification, gene therapy, cell therapy, transgenic animals, etc. in the form of viruses, plasmid DNA, mRNA or proteins.

[0111] Host cells

[0112] Herein, when expressing an exogenous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell that is capable of replicating a vector and / or expressing an exogenous gene encoded by a vector. A host cell can be used as a recipient of a vector or mRNA. A host cell can be "transfected" or "transformed," which refers to the process of transfection or transduction of an exogenous nucleic acid into a host cell. Transformed cells include primary subject cells and their progeny. The terms "engineered" and "recombinant" cells or host cells used herein often refer to cells into which an exogenous nucleic acid sequence, such as a vector or mRNA, has been introduced. Therefore, recombinant cells can be distinguished from naturally occurring cells that do not contain an introduced recombinant nucleic acid.

[0113] Herein, host cells include cells that carry and / or produce the ITR sequences, transposons or transposon systems described herein. Specifically, the present invention provides cells that carry the ITR sequences, transposons or transposon systems described herein. The cells may also contain a nucleic acid sequence encoding a transposase that can recognize the transposon.

[0114] The type of cell is not limited, and in some embodiments, the cell is a primary cell isolated from a subject. The subject is a healthy subject or has been diagnosed with a disease (eg, cancer or tumor).

[0115] In some embodiments, the cells are isolated from the blood of the subject, such as PBMC or cells derived therefrom. The cells may comprise primary immune cells, such as primary leukocytes. In some embodiments, the cells comprise primary T cells. The primary T cells comprise γδT cells, helper T cells, memory T cells, natural killer T cells, effector T cells, or any combination thereof. In some embodiments, the primary immune cells comprise CD3+ cells.

[0116] In some embodiments, the cell comprises a stem cell. The stem cell is selected from the group consisting of embryonic stem cells, hematopoietic stem cells, epidermal stem cells, epithelial stem cells, bronchial alveolar stem cells, mammary stem cells, mesenchymal stem cells, intestinal stem cells, endothelial stem cells, neural stem cells, olfactory adult stem cells, neural crest stem cells, testicular cells, and any combination thereof. The stem cell comprises an induced pluripotent stem cell.

[0117] The ITR sequences, transposons or transposon systems of the present invention can be introduced into the cells of interest. Herein, the method of introduction includes transfection of the cells by means of electroporation, microinjection, calcium phosphate precipitation, cationic polymers, dendrimers, liposomes, lipid nanoparticles (LNP), microparticle bombardment, fugene, direct sonic loading, cell extrusion, optical transfection, protoplast fusion, impalefection, magnetofection, nuclear transfection or any combination thereof. In certain embodiments, introduction adopts electroporation.

[0118] Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. The culture is carried out under conditions suitable for the growth of the host cells. In the embodiment of using an inducible promoter to express the transposase, after the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0119] The polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0120] method

[0121] The present invention also relates to a method for preparing a cell, comprising the step of introducing the transposon system described herein into the cell.

[0122] In some embodiments, the introducing comprises contacting the cell with a polynucleotide encoding the transposase. The polynucleotide comprises DNA or messenger RNA (mRNA) encoding the transposase.

[0123] In some embodiments, the introduction comprises contacting the cell with the transposase, preferably providing the transposase protein by adding the transposase directly to a culture medium containing the cell (preferably to a cell culture medium of cells of the target organism). In direct contact of the transposase with the target cell according to the present invention, no reagent, carrier or method that alters the penetration of the protein across the cell membrane may be used.

[0124] In some embodiments, the introduction includes contacting the cell with a DNA vector containing the transposon. In some embodiments, the DNA vector includes a microcarrier plasmid, preferably the DNA backbone sequence of the microcarrier does not contain an antibiotic expression frame and is preferably limited to 600bp in length, and / or does not contain a CpG DNA motif. In some embodiments, the introduction includes contacting the cell with a plasmid vector containing the transposon and a polynucleotide encoding the transposase. In some embodiments, the introduction includes contacting the cell with an mRNA encoding the transposase and a plasmid vector containing the transposon. In some embodiments, the introduction includes contacting the cell with a plasmid vector containing the polynucleotide and the transposon. In some embodiments, the introduction includes contacting the cell with a plasmid vector containing the polynucleotide and the transposon. In some embodiments, the introduction includes contacting the cell with a plasmid vector containing the polynucleotide and a plasmid vector containing the transposon.

[0125] In some embodiments, the transposon system described herein can be delivered to cells by viruses, including retroviruses (such as lentiviruses, etc.), adenoviruses, adeno-associated viruses (AAV), herpes viruses, etc. The transposon and transposase genes can be contained together on the same recombinant viral genome; one infection can deliver the two parts of the transposon system, so that the expression of the transposase can guide the transposon to cleave from the recombinant viral genome and then insert into the cell chromosome. In another example, the transposase and the transposon can be delivered separately by a combination of viruses and / or non-viral systems (such as lipid-containing reagents). In these cases, the transposon and / or the transposase gene can be delivered by a recombinant virus. In each case, the expressed transposase gene guides the transposon to be liberated from its carrier DNA (viral genome) and inserted into the chromosomal DNA. The JL transposase of the present invention is very small and is particularly suitable for delivery using AAV.

[0126] The term "protein transfection" in the context of the present invention should be understood to broadly refer to any method or reagent that is sufficient to introduce a protein that cannot effectively enter a target cell into the target cell. Common protein transfection systems and reagents include commercial protein transfection reagents such as PULSin TM 、ProteoJuice TM 、Xfect TM and Pierce TM Protein transfection reagent (ThermoFisher), TransPass TM , and methods such as protein electroporation.

[0127] The present invention also provides transgenic animals and transgenic cells obtained by the above method.

[0128] Also provided herein is a method of treatment, comprising: (a) introducing a transposon system into a cell, thereby generating a genetically modified cell comprising a transgene introduced by the transposon; (b) administering the genetically modified cell to a patient in need of the treatment. In some embodiments, the patient has been diagnosed with cancer or a tumor. In some embodiments, the administration comprises infusing the genetically modified cell into a blood vessel of the patient.

[0129] The present invention also relates to the use of the ITR sequences, transposons, cells, or transposon systems described herein in the preparation of products, such as gene editing kits, engineered immune cells, or pharmaceutical compositions. The immune cells include γδT cells, helper T cells, memory T cells, natural killer T cells, effector T cells, and the like.

[0130] The scope of the present invention also encompasses a kit comprising the ITR sequence, transposon or transposon system described herein. The kit further comprises one or more of a nucleic acid encoding a transposase that can recognize the transposon or a nucleic acid construct thereof (e.g., a DNA vector comprising the transposon), a host cell, a cell culture medium suitable for the host cell, a cytokine, and instructions for use.

[0131] Pharmaceutical compositions and administration

[0132] The transposon, transposon system and cell of the present invention can be administered alone or as a pharmaceutical composition in combination with a diluent and / or other components such as related cytokines or cell populations. Therefore, the present invention also provides a pharmaceutical composition comprising a transposon, transposon system and / or cell prepared by the method described herein and a pharmaceutically acceptable excipient.

[0133] In the present invention, "pharmaceutically acceptable excipients" are pharmaceutically or food-acceptable carriers, solvents, suspending agents or excipients for delivering the transposon, transposon system or cell of the present invention to animals or humans. In this article, pharmaceutically acceptable excipients are non-toxic to the recipient of the composition at the dose and concentration used. Various types of carriers or excipients commonly used for delivering proteins, nucleic acids or cells in treatments known in the art may be included. Exemplary excipients may be liquid or solid, including but not limited to: pH regulators, surfactants, carbohydrates, adjuvants, antioxidants, chelating agents, ionic strength enhancers, preservatives, carriers, glidants, sweeteners, dyes / colorants, flavor enhancers, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents or emulsifiers. In some embodiments, pharmaceutically acceptable excipients may include one or more inactive ingredients, including but not limited to: stabilizers, preservatives, additives, adjuvants, sprays, compressed air or other suitable gases, or other suitable inactive ingredients used in combination with pharmacodynamic compounds. See, for example, REMINGTON'S PHARMACEUTICAL SCIENCES, 18th ed., AR Genrmo, ed., 1990, Mack Publishing Company. The optimal pharmaceutical composition may be determined depending on the intended route of administration, mode of delivery, and desired dosage.

[0134] The pharmaceutical composition of the present invention can be selected for parenteral delivery, for inhalation or delivery through the digestive tract (such as oral), for example, for intravenous infusion delivery. The preparation of the composition is within the technology of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations containing immune cells, particularly immune cells (e.g., T cells), in sustained or controlled release delivery formulations. The pharmaceutical composition of the present invention can also be administered in a manner suitable for the disease to be treated (or prevented).

[0135] Pharmaceutical compositions for in vivo administration are usually provided in the form of sterile preparations. Sterilization is achieved by filtering through a sterile filtration membrane. Compositions for parenteral administration can be stored in lyophilized form or in solution (e.g., frozen preparations). Parenteral compositions are usually placed in containers with sterile access holes, such as intravenous solution strips or vials with stoppers that can be pierced by hypodermic needles.

[0136] Once the pharmaceutical composition is formulated, it is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal, frozen material or in a dehydrated or lyophilized powder. The pharmaceutical formulation (e.g., a frozen preparation) can be stored in a ready-to-use form or in a form that is further formulated before administration. For example, suitable for delivering the pharmaceutical composition described herein can be a frozen preparation, which can withstand long-distance transportation without damaging cells. In addition to the cells themselves, the frozen preparation generally includes components such as cell freezing solution and human serum albumin (HSA). Before administration (e.g., intravenous infusion), the frozen pharmaceutical composition needs to be stored at low temperatures (e.g., placed in liquid nitrogen). After thawing, the frozen preparation can be directly or formulated as an infusion composition for infusion to the patient. Those skilled in the art are aware of the components and concentrations of conventional freezing solutions. For example, the freezing solution or infusion composition may also contain dimethyl sulfoxide, sodium chloride, glucose, sodium acetate, potassium chloride or magnesium chloride, etc., and its concentration may be determined by those skilled in the art (e.g., experienced physicians) according to conditions such as cells, diseases, and patients.

[0137] In some embodiments of the invention, the genetically modified cells of the invention or compositions thereof may be combined with other therapies known in the art.

[0138] "Patient", "subject", "individual" and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

[0139] application

[0140] The subject matter provided herein can be widely applied to applications related to genome editing, such as the preparation of transgenic organisms, gene therapy, cell therapy, etc.

[0141] A non-limiting example relates to the generation of genetically modified cells for research and clinical applications. For example, as described above, genetically modified T cells can be prepared using the subject matter provided herein, which can be applied to help people resist a variety of diseases, such as, but not limited to, cancer and infectious diseases.

[0142] A specific example includes using the method provided herein to produce genetically modified primary leukocytes, and applying the genetically modified primary leukocytes to patients in need. The generation of genetically modified primary leukocytes can include introducing a transposon system into leukocytes, thereby producing genetically modified leukocytes. In many cases, the transposon may include a transgene. The transgene can be a cell receptor, an immune checkpoint protein, a cytokine, an antibody, and any combination thereof. Sometimes, a cell receptor may include but is not limited to a T cell receptor (TCR), a B cell receptor (BCR), a chimeric antigen receptor (CAR), or any combination thereof. In some other cases, the transposon system is designed to delete or modify endogenous genes, such as cytokines, immune checkpoint proteins, oncogenes, or any combination thereof. The genetic modification of primary leukocytes can be designed to promote immunity to infectious pathogens or cancer cells that make patients in a sick state.

[0143] Another non-limiting example relates to the generation of genetically modified organisms for agriculture, food production, medicine and pharmacy. The species range that can be genetically modified is very wide, including but not limited to plants and animals. Genetically modified organisms, such as genetically modified crops or livestock, can be modified in some aspects of their physiological properties. The example in edible crops includes resistance to certain pests, diseases or environmental conditions, the reduction of corruption, or resistance to chemical treatment (such as resistance to herbicides), or improves the nutritional profile of crops. The example in non-edible crops includes the production of medicaments, biofuels and other industrially useful commodities, and is used for bioremediation. The example in livestock includes the resistance to certain parasites, the generation of certain nutrients, the increase of growth rate and the increase of milk production.

[0144] The present invention is further described in detail by reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the present invention should never be construed as being limited to the following examples, but should be construed as including any and all variations that become apparent due to the teachings provided herein. The methods and reagents used in the examples, unless otherwise stated, are conventional methods and reagents in the art.

[0145] Example 1 Construction of CpG Free mutant plasmid

[0146] Entrust Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize primers

[0147] The first site (CpG motif at position 2-3 of SEQ ID NO: 1):

[0148] sPS-AG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCGGAAAATACTGTATATATAGC(SEQ ID NO:34)

[0149] sPS-AG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCGGAAAATACTGTATATATAGAG(SEQ ID NO:35)

[0150] sPS-CA-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCGGAAAATATGGTATATATAGC(SEQ ID NO:36)

[0151] sPS-CA-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCGGAAAATATGGTATATATAGAG(SEQ ID NO:37)

[0152] sPS-CC-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCGGAAAATAGGGTATATATAGC(SEQ ID NO:38)

[0153] sPS-CC-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCGGAAAATAGGGTATATATAGAG(SEQ ID NO:39)

[0154] sPS-CT-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCGGAAAATAAGGTATATATAGC(SEQ ID NO:40)

[0155] sPS-CT-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCGGAAAATAAGGTATATATAGAG(SEQ ID NO:41)

[0156] sPS-TG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCGGAAAATACAGTATATATAGC(SEQ ID NO:42)

[0157] sPS-TG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCGGAAAATACAGTATATATAGAG(SEQ ID NO:43)

[0158] CpG gene (SEQ ID NO:1:11-12):

[0159] AGAG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:44)

[0160] AGAG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCTGAAAATACTGTATATAGAG(SEQ ID NO:45)

[0161] AGCA-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGTGGAAAATACTGTATATAGCTAG(SEQ ID NO:46)

[0162] AGCA-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGTGGAAAATACTGTATATAGAG(SEQ ID NO:47)

[0163] AGCC-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGGGGAAAATACTGTATATAGCTAG(SEQ ID NO:48)

[0164] AGCC-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGGGAAAATACTGTATATAGAG(SEQ ID NO:49)

[0165] AGCT-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGAGGAAAATACTGTATATAGCTAG(SEQ ID NO:50)

[0166] AGCT-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGAGGAAAATACTGTATATAGAG(SEQ ID NO:51)

[0167] AGTG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCGCCTTATAGTGCAGAAAATACTGTATATAGCTAG(SEQ ID NO:52)

[0168] AGTG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCGCCTTATAGTGCAGAAAATACTGTATATAGAG(SEQ ID NO:53)

[0169] CpG gene (SEQ ID NO:1:23-24):

[0170] 3AG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCTCCTTATAGTGCAGAAAATACTGTATATAGCTAG(SEQ ID NO:54)

[0171] 3AG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCTCCTTATAGTGCAGAA AATACTGTATATATAGAG(SEQ ID NO:55)

[0172] 3TG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCACCTTAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:56)

[0173] 3TG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCACCTTAGTGCTGAAA ATACTGTATATATAGAG(SEQ ID NO:57)

[0174] 3GG-F:GCTAATGGTCCAAGATGCTTAAGGGTGCCCCTTATAGTGCGGAAAATACTGTATATAGCTAG(SEQ ID NO:58)

[0175] 3GG-R:GCTAATGGTCCAAGATGTCTAGAGGTGCCCCTTATAGTGCGGAA AATACTGTATATATAGAG(SEQ ID NO:59)

[0176] 3CA-F:GCTAATGGTCCAAGATGCTTAAGGGTGTGCCTTATAGTGCCAAAAATACTGTATATATAGCTAG(SEQ ID NO:60)

[0177] 3CA-R:GCTAATGGTCCAAGATGTCTAGAGGTGTGCCTTATAGTGCCAAAA ATACTGTATATATAGAG(SEQ ID NO:61)

[0178] 3CT-F:GCTAATGGTCCAAGATGCTTAAGGGTGAGCCTTATAGTGCCTAAAATACTGTATATATAGCTAG(SEQ ID NO:62)

[0179] 3CT-R:GCTAATGGTCCAAGATGTCTAGAGGTGAGCCTTATAGTGCCTAAAATACTGTATATATAGAG(SEQ ID NO:63)

[0180] 3CC-F:GCTAATGGTCCAAGATGCTTAAGGGTGGGCCTTATAGTGCCCAAAATACTGTATATATAGCTAG(SEQ ID NO:64)

[0181] 3CC-R:GCTAATGGTCCAAGATGTCTAGAGGTGGGCCTTATAGTGCCCAAAATACTGTATATATAGAG(SEQ ID NO:65)

[0182] 3AA-F:GCTAATGGTCCAAGATGCTTAAGGGTGTTCCTTATAGTGCTGAAAATACTGTATATATAGCTAG(SEQ ID NO:66)

[0183] 3AA-R:GCTAATGGTCCAAGATGTCTAGAGGTGTTCCTTATAGTGCTGAAAATACTGTATATATAGAG(SEQ ID NO:67)

[0184] 3AT-F:GCTAATGGTCCAAGATGCTTAAGGGTGATCCTTAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:68)

[0185] 3AT-R:GCTAATGGTCCAAGATGTCTAGAGGTGATCCTTAGTGCTGAAAATACTGTATATAGAG(SEQ ID NO:69)

[0186] 3AC-F:GCTAATGGTCCAAGATGCTTAAGGGTGGTCCTTATAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:70)

[0187] 3AC-R:GCTAATGGTCCAAGATGTCTAGAGGTGGTCCTTATAGTGCTGAAAATACTGTATATAGAG(SEQ ID NO:71)

[0188] 3TA-F:GCTAATGGTCCAAGATGCTTAAGGGTGTACCTTATAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:72)

[0189] 3TA-R:GCTAATGGTCCAAGATGTCTAGAGGTGTACCTTATAGTGCTGAAAATACTGTATATAGAG(SEQ ID NO:73)

[0190] 3TC-F:GCTAATGGTCCAAGATGCTTAAGGGTGGACCTTATAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:74)

[0191] 3TC-R:GCTAATGGTCCAAGATGTCTAGAGGTGGACCTTATAGTGCTGAAAATACTGTATATAGAG(SEQ ID NO:75)

[0192] 3TT-F:GCTAATGGTCCAAGATGCTTAAGGGTGAACCTTAGTGCTGAAAATACTGTATATAGCTAG(SEQ ID NO:76)

[0193] 3TT-R:GCTAATGGTCCAAGATGTCTAGAGGTGAACCTTATAGTGCTGAAAATACTGTATATATAGAG(SEQ ID NO:71)

[0194] 3GA-F:GCTAATGGTCCAAGATGCTTAAGGGTGTCCCTTATAGTGCTGAAAATACTGTATATATAGCTAG(SEQ ID NO:78)

[0195] 3GA-R:GCTAATGGTCCAAGATGTCTAGAGGTGTCCCTTATAGTGCTGAAAATACTGTATATATAGAG(SEQ ID NO:79)

[0196] 3GT-F:GCTAATGGTCCAAGATGCTTAAGGGTGACCCTTATAGTGCTGAAATACTGTATATATAGCTAG(SEQ ID NO:80)

[0197] 3GT-R:GCTAATGGTCCAAGATGTCTAGAGGTGACCCTTATAGTGCTGAAAATACTGTATATATAGAG(SEQ ID NO:81)

[0198] 3GC-F:GCTAATGGTCCAAGATGCTTAAGGGTGGCCCTTATATGCTGAAAATACTGTATATATAGCTAG(SEQ ID NO:82)

[0199] 3GC-R:GCTAATGGTCCAAGATGTCTAGAGGTGGCCCTTATAGTGCTGAAAATACTGTATATATAGAG(SEQ ID NO:83)

[0200] 3AG-FII:GCTAATGGTCCAAGATGCTTAAGGGTGCTCCTTATATGTGCAGAAAATACTGTATATATAGCTAG(SEQ ID NO:84)

[0201] 3AG-RII:GCTAATGGTCCAAGATGTCTAGAGGTGCTCTTATATGTGCAGAAAATACTGTATATATAGAG(SEQ ID NO:85)

[0202] 3CA-FII:GCTAATGGTCCAAGATGCTTAAGGGTGTGCCTTATAGTGCAGAAAATACTGTATATATAGCTAG(SEQ ID NO:86)

[0203] 3CA-RII:GCTAATGGTCCAAGATGTCTAGAGGTGTGCCTTATAGTGCAGAAAATACTGTATATATAGAG(SEQ ID NO:87)

[0204] 3CC-FII:GCTAATGGTCCAAGATGCTTAAGGGTGGGCCTTATAGTGCAGAAAATACTGTATATATAGCTAG(SEQ ID NO:88)

[0205] 3CC-RII:GCTAATGGTCCAAGATGTCTAGAGGTGGGCCTTATAGTGCAGAAAATACTGTATATATAGAG(SEQ ID NO:89)

[0206] 3CT-FII:GCTAATGGTCCAAGATGCTTAAGGGTGAGCCTTATAGTGCAGAAAATACTGTATATATAGCTAG(SEQ ID NO:90)

[0207] 3CT-RII:GCTAATGGTCCAAGATGTCTAGAGGTGAGCCTTATAGTGCAGAAAATACTGTATATATAGAG(SEQ ID NO:91)

[0208] 3GG-FII:GCTAATGGTCCAAGATGCTTAAGGGTGCCCCTTATAGTGCAGAAAATACTGTATATATAGCTAG(SEQ ID NO:92)

[0209] 3GG-RII:GCTAATGGTCCAAGATGTCTAGAGGTGCCCCTTATAGTGCAGAAAATACTGTATATATAGAG(SEQ ID NO:93)

[0210] 3TG-FII:GCTAATGGTCCAAGATGCTTAAGGGTGCACCTTATAGTGCAGAAAATACTGTATATATAGCTAG(SEQ ID NO:94)

[0211] 3TG-RII: GCTAATGGTCCAAGATGTCTAGAGGTGCACCTTATAGTGCAGAAAATACTGTATATATAGAG (SEQ ID NO:95)

[0212] bu-rII:GCAGAAAATACTGTATATATAGAGCTCTTTGACAATTAAACATTGGCATAGTATATCTGC(SEQ ID NO:96)

[0213] The wild-type plasmid pTini-PS(CES)-dCGEGFP was obtained from Shanghai Cell Therapy Group, and the map is shown in Figure 1 The nucleotide sequence is shown in SEQ ID NO:97.

[0214] Taking the construction of the first site pTini-PS(CES)-dCGEGFP-AG as an example, pTini-PS(CES)-dCGEGFP was used as a template, and primers sPS-AG-F and sPS-AG-R were used for PCR amplification. According to the instructions of the Phanta Max Super-Fidelity DNA Polymerase Kit, a 670 bp fragment was amplified and the fragment was recovered by electrophoresis.

[0215] pTini-PS(CES)-dCGEGFP-AGAG was digested with AflⅡ and Xba Ⅰ to obtain 2039 bp and 630 bp fragments. The 2039 bp fragment was recovered. The 2039 bp fragment and the 670 bp fragment obtained by the above PCR were separated according to HiFi DNA Assembly instructions were used for seamless cloning to obtain a plasmid with the first site of ITR mutated to AG, named pTini-PS(CES)-dCGEGFP-AG.

[0216] The subsequent site mutation construction method is the same as pTini-PS(CES)-dCGEGFP-AG, the difference is the primers and templates used. Referring to Table 1, the corresponding template is amplified using the corresponding primers, and then seamlessly cloned into the corresponding template to obtain the corresponding mutant plasmid.

[0217] Table 1

[0218]

[0219]

[0220] Example 2 Detection of integration efficiency of the first site modified plasmid in CHO cells

[0221] 1) Electroporation of CHO cells

[0222] Preparation of culture medium: DMEM culture medium and RPMI 1640 culture medium were mixed in a ratio of 1:1, and then 10% fetal bovine serum, 1% glutamine, 1% hypoxanthine and thymidine nucleoside mixture were added.

[0223] Preparation of electrotransfection mixture: According to the instructions of Human T Cell Nucleofector transfection kit, 1 μL RNase inhibitor, 4 μg mutant plasmid, and 5 ug PS mutant transposase (JL18 transposase) mRNA (the amino acid sequence of JL18 transposase is shown in SEQ ID NO: 98) were added to 100 μL electrotransfection solution. The experimental groups are shown in Table 2.

[0224] Table 2

[0225]

[0226] Prepare 1E6 CHO-K1 cells in the logarithmic growth phase, mix the electroporation mixture in the above step with the cell pellet, add them to the electroporation cup, put them into the Lonza-Nucleofector 2b electroporator, select the program CHO cell high activity program (H-014), and perform electroporation; after electroporation, use the micropipette in the kit to absorb the preheated culture medium and the electroporation suspension and mix them, quickly transfer them to a 6-well plate with 3 mL of preheated culture medium, mix them, and culture them in a 37°C, 5% CO2 incubator.

[0227] The electrotransfected CHO-K1 cells were subjected to fluorescence and flow cytometry detection on D3, D6, D9, and D12.

[0228] 2) Integration efficiency detection in CHO cells

[0229] The supernatant of the culture medium in the 6-well plate was discarded, and 1 ml of PBS was gently added to each well to remove the residual culture medium. The PBS in the 6-well plate was discarded, and 300 μl of 0.25% trypsin was added to each well to digest and terminate. The digested cells were added to a 1.5 mL centrifuge tube, centrifuged at 1500 rpm for 3 min, and the supernatant was discarded; 1 ml of PBS was added to each well, and the cells were fully resuspended. 10 μl of the cell suspension was taken, and then diluted with 0.4% trypan blue at a ratio of 1:1. After fully mixing, the cells were counted. According to the counting results, 2E5 cells were taken from each group for further culture. The remaining cells were kept for flow cytometry detection.

[0230] The cells were centrifuged at 1500 rpm for 3 min, the supernatant was discarded, and then resuspended in 500 μl PBS, and detected using a Cytek flow cytometer and the supporting software for analysis.

[0231] The flow cytometry results are as follows Figure 2As shown, the positive rates of each group tended to stabilize from D9. At D12, the positive rate of cells in the positive control group was 24.76%, and the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AG group was 48.13%, which was significantly higher than that in the positive control group. The experimental group AG had the best effect, and mutations of other sites will be performed based on the transformation of the first site.

[0232] Example 3 Detection of integration efficiency of the plasmid after the second site modification in CHO cells

[0233] The CHO cell electroporation and detection method was the same as in Example 2, except that the plasmid used was a second site-transformed plasmid. The experimental groups are shown in Table 3.

[0234] Table 3

[0235]

[0236] The flow cytometry results are as follows Figure 3 As shown, the positive rate of each group tended to be stable from day 9. At D12, the positive rate of cells in the positive control group was 24.60%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGAG group was 26.78%, and the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGTG group was 39.56%, all of which were higher than that in the positive control group. Therefore, subsequent mutations were performed based on pTini-PS(CES)-dCGEGFP-AGAG and pTini-PS(CES)-dCGEGFP-AGTG.

[0237] Example 4 Detection of integration efficiency of the plasmid after the third site modification in CHO cells

[0238] The CHO cell electroporation and detection method was consistent with Example 2, except that the plasmid used was a second site-modified plasmid. According to different templates and mutations, the experiments were divided into three groups, as shown in Table 4.

[0239] Table 4-1

[0240]

[0241] Table 4-2

[0242]

[0243]

[0244] Table 4-3

[0245]

[0246] The flow cytometry results are as follows Figures 4A-4CAs shown, the positive rates of the third site mutations in each group tended to be stable from day 9. After stable transformation, the positive rate of pTini-PS(CES)-dCGEGFP-AGTGCT was higher than that of the positive control group. Therefore, pTini-PS(CES)-dCGEGFP-AGTGCT was the optimal mutation among the three batches of screening.

[0247] Example 5 Detection of integration efficiency of preferred transformed plasmid in Jurkat cells

[0248] 1) Electroporation of Jurkat cells

[0249] Preparation of Jurkat culture medium: Add 10% fetal bovine serum and 1% PS to RPMI 1640 culture medium, mix well and set aside.

[0250] Preparation of electroporation mixture: The preparation of electroporation solution and experimental grouping are the same as those of CHO cells, except that the plasmid used is the preferred modified plasmid screened out on CHO cells. The experimental grouping is shown in Table 5.

[0251] Table 5

[0252]

[0253]

[0254] Prepare 3E6 Jurkat cells in the logarithmic growth phase, mix them evenly with the electroporation mixture in the above step, and add them to the electroporation cup. Use the Lonza-Nucleofector 2b electroporator and select the Jurkat cell program for electroporation. After electroporation, still culture them in a 37°C, 5% CO2 incubator.

[0255] The electroporated Jurkat cells were subjected to fluorescence and flow cytometry detection on D3, D6, D9, and D12.

[0256] 2) Integration efficiency detection in Jurkat cells

[0257] Mix the cell suspension in the 6-well plate, take 10 μl of the cell suspension, and then dilute it with 0.4% trypan blue at a ratio of 1:1. After sufficient mixing, count the cells. According to the counting results, take 1.5E6 cells from each group and continue to culture in 3 ml Jurkat cell culture medium. The remaining cells are kept for flow cytometry detection.

[0258] The cells were centrifuged at 1500 rpm for 3 min, the supernatant was discarded, and then 1 ml of PBS was added for washing. After centrifugation at 1500 rpm for 3 min, the supernatant was discarded, and the cells were resuspended in 500 μl of PBS. The cells were detected using a Cytek flow cytometer and analyzed using the supporting software.

[0259] The flow cytometry results are as follows Figure 5 As shown, the positive rate of the experimental group began to stabilize from day 6. At D12, the positive rate of cells in the positive control group was 14.80%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AG group was 24.35%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGAG group was 7.47%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGCT group was 14.56%, and the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGTG group was 24.43%. Jurkat data showed that the positive rates of the transformed plasmids pTini-PS(CES)-dCGEGFP-AG and pTini-PS(CES)-dCGEGFP-AGTG after stable transformation were higher than those in the positive control group.

[0260] Example 6 Detection of integration efficiency of the preferred transformed plasmid in PBMC

[0261] 1) Electroporation of PBMC

[0262] Preparation of PBMC culture medium: Add 2% fetal bovine serum to AIMⅤ culture medium, add 500U and 100U of IL-2 respectively, mix well and set aside.

[0263] Fresh PBMCs were cultured according to Miltenyi T Cell TransAct TM Instructions, activate in 500U IL 2 for 48 hours and prepare for electroporation.

[0264] Preparation of electrotransfection mixture: According to the instructions of LONZA LV Unit transfection kit, Nucleofector Solution: Supplement = 82:18. Add 1 μL RNase inhibitor, 4 μg mutant plasmid, 5ug JL18 mRNA to 100 μL electrotransfection solution. The experimental grouping is the same as that in Example 5, see Table 5.

[0265] Prepare 7E6 activated PBMC cells, mix them evenly with the electroporation mixture in the above step, and add them to the electroporation cup. Use the Lonza-Nucleofector 4D electroporator and select the Human T sti m cell program for electroporation. After electroporation, culture them in a 37°C, 5% CO2 incubator.

[0266] The electroporated PBMC cells were subjected to fluorescence and flow cytometry detection on D3, D6, D9, and D12.

[0267] 2) Integration efficiency detection in PBMC cells

[0268] Integration efficiency detection in PBMC cells was the same as the Jurkat method.

[0269] The flow cytometry results are as follows Figure 6 As shown, the positive rate of the experimental group tended to stabilize from day 6. At D12, the positive rate of cells in the positive control group was 11.93%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AG group was 29.49%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGAG group was 25.67%, the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGCT group was 25.76%, and the positive rate of cells in the pTini-PS(CES)-dCGEGFP-AGTG group was 32.58%. The PBMC data showed that the positive rate of the transformed plasmid after stable transformation in this experiment was higher than that in the positive control group.

Claims

1. A polynucleotide of an inverted terminal repeat sequence, characterized in that: The terminal inverted repeat sequence is a mutant of the terminal inverted repeat sequence of the Passer (PS) transposon. Compared with the terminal inverted repeat sequence of the Passer (PS) transposon, the terminal inverted repeat sequence contains reduced or no CpG motif; preferably, the terminal inverted repeat sequence of the Passer (PS) transposon is shown in any one of SEQ ID NOs: 1, 99-119.

2. The polynucleotide of the terminal inverted repeat sequence according to claim 1, characterized in that The terminal inverted repeat sequence does not contain any CpG motif in the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the CpG motif is replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the CpG motif is replaced by ApG; or The terminal inverted repeat sequence does not contain any two CpG motifs in the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the two CpG motifs are arbitrarily replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the first CpG motif is replaced by ApG; most preferably, the two CpG motifs are replaced by ApG and ApG, or ApG and TpG, respectively; or The terminal inverted repeat sequence does not contain the three CpG motifs in the polynucleotide sequence shown in SEQ ID NO:1; preferably, the three CpG motifs are arbitrarily replaced by ApG, CpA, CpC, CpT, TpG; more preferably, the first two CpG motifs are replaced by ApG and TpG, respectively; most preferably, the three CpG motifs are replaced by ApG, TpG and CpT, respectively.

3. The polynucleotide of the terminal inverted repeat sequence according to claim 1, characterized in that The terminal inverted repeat sequence is shown as SEQ ID NO: 2-32, preferably as shown in SEQ ID NO: 2, 7, 10, 11.

4. A transposon, characterized in that: The transposon comprises a polynucleotide of the terminal inverted repeat sequence according to any one of claims 1 to 3, or a reverse complementary sequence thereof.

5. A transposon according to claim 4, characterized in that: The transposon has two or more terminal inverted repeat sequences at at least one end, and / or the transposon has two or more TA sequence repeats outside the terminal inverted repeat sequence at at least one end.

6. A transposon according to claim 4 or 5, characterized in that: The transposon comprises a target gene expression frame located between terminal inverted repeat sequences. Preferably, the target gene encodes a protein selected from cell receptors, immune checkpoint proteins, cytokines, T cell receptors, B cell receptors, chimeric antigen receptors and any combination thereof.

7. A transposon system, characterized in that: including a transposase or a polynucleotide encoding a transposase, and a transposon; The transposase is a wild-type PS transposase, a mutant transposase or a fusion transposase; The transposon is the transposon according to any one of claims 4 to 6.

8. A transposon system according to claim 7, characterized in that: The mutant transposase comprises an amino acid mutation compared to the wild-type PS transposase as shown in SEQ ID NO: 1, wherein any one or more amino acids in the double-stranded DNA binding and oligomerization domain of the wild-type PS transposase are mutated into positively charged amino acids; and / or the amino acid mutation comprises one or more mutations selected from the group consisting of TQS57-59KKA, T129R, T129K, I98K, TQ57-58RK, TQ57-58RK\T129K, TQ57-58RK\T129R, E32K, E32K\T129K, E32K\T129R, TQ57-58RK\I98K, TQ57-58RK\I98K\T129K, TQS57-59KKA\I98K, TQS57-59RK 7-59KKA\I98K\T129K, R123H, Q136K, K16R, E47K, TQ57-58RR, E32K\T57R\Q58 R, T57R, T57K, Q58K, Q58R, S59A, M95L, Y46Q, A8S, T187K, I35V, N199H, N193S, T 350S, Q22K, T368E, N213D, H24R, T150A, H165D, K55R, K73R, L228M, E335S, K15 9H, V359L, T129Q, H215K, R51K, A84L, Q69E, I284L, K45R, H215E, H215Q, I237V; The fusion transposase is a wild-type PS transposase or a mutant thereof fused with a functional polypeptide, wherein the functional polypeptide is a DNA sequence-specific or non-specific binding domain and / or a cell nucleus localization signal domain; Preferably, the DNA sequence-specific or non-specific binding domain comprises a leucine zipper domain, a CRISPR / Cas domain, a TALE domain, a zinc finger domain, an AAV Rep DNA binding domain or any combination thereof, and / or The cell nuclear localization signal domain includes SV40 NLS, C-myc NLS, TAF1 NLS, TP53 NLS, STAT3 NLS or any combination thereof, and / or The functional polypeptide and the wild-type PS transposase or its mutant may or may not contain a linker.

9. The transposon system of claim 7 or 8, wherein the polynucleotide encoding the transposase is mRNA, preferably, the mRNA is chemically modified, including but not limited to pseudouridine (ψ), N1-methylpseudouridine (m1ψ), 5-methylcytosine (m5C), 5-methoxyuridine (5moU).

10. The transposon system according to claim 8 or 9, wherein the polynucleotide encoding the transposase and / or the transposon are present in a DNA vector, preferably, the DNA vector is a plasmid vector or a minicircle DNA vector, preferably a non-antimicrobial plasmid vector; and / or the DNA vector is a microcarrier, the backbone sequence of which is within 600 bp in length, and has reduced and / or no CpG DNA motif; or The polynucleotide encoding the transposase and / or the transposon are present in a viral vector. Preferably, the viral vector is selected from an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a herpes simplex viral vector or a vaccinia viral vector. The transposon system according to claim 10 , wherein the polynucleotide encoding the transposase and the transposon are present in the same vector or in different vectors.

12. A host cell comprising the polynucleotide of the terminal inverted repeat sequence according to any one of claims 1 to 3, the transposon according to any one of claims 4 to 6, or the transposon system according to any one of claims 7 to 11.

13. A method for preparing a cell, comprising: The step of introducing the transposon according to any one of claims 4 to 6 or the transposon system according to any one of claims 7 to 11 into a cell, Preferably, The introducing comprises contacting the cell with a DNA vector containing the transposon, and / or The introducing comprises contacting the cell with mRNA encoding the transposase and a plasmid vector containing the transposon, and / or The introducing comprises contacting the cell with a plasmid vector containing the polynucleotide of the transposase and a plasmid vector containing the transposon.

14. The method according to claim 13, characterized in that The cell is from an animal, such as a vertebrate or an invertebrate, preferably a mammal, and more preferably a human; and / or the cell is an immune cell, preferably a T cell.

15. The method according to claim 13 or 14, characterized in that The introducing comprises transfecting the cell by means of electroporation, microinjection, calcium phosphate precipitation, cationic polymers, dendrimers, liposomes, lipid nanoparticles, microparticle bombardment, fugene, direct sonic loading, cell squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, nucleofection, virus-mediated transformation, or any combination thereof.

16. The method according to claim 14 or 15, characterized in that Said introducing comprises electroporating said cells.

17. The method according to claim 16, characterized in that The introduction comprises contacting the cell with mRNA encoding the transposase and a plasmid containing the transposon. Preferably, the plasmid is a microcarrier, the backbone sequence of which is within 600 bp in length, with reduced and / or no CpG DNA motif, and / or the plasmid is a non-antimicroplasmid.

18. A kit comprising: the polynucleotide of the terminal inverted repeat sequence according to any one of claims 1 to 3, the transposon according to any one of claims 4 to 6, or the transposon system according to any one of claims 7 to 11, or the cell according to claim 12.

19. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and cells prepared by the method according to any one of claims 13 to 17.

20. Use of the polynucleotide of the inverted terminal repeat sequence of any one of claims 1 to 3, the transposon of any one of claims 4 to 6, the transposon system of any one of claims 7 to 11, the cell of claim 12, or the pharmaceutical composition of claim 19, which is selected from any one of the following (1) to (6): (1) Application in the preparation of drugs or reagents for integrating the target gene expression cassette into the host cell genome; (2) Application in the preparation of tools for integrating target gene expression cassettes into the host cell genome; (3) Application in the preparation of transgenic animals and transgenic cells; (4) Application in the preparation of drugs or preparations for genome research, gene therapy, cell therapy, or stem cell induction and differentiation after induction; (5) Application in the preparation of tools for genome research, gene therapy, cell therapy, or stem cell induction and post-induced differentiation; (6) Application in the preparation of kits, engineered immune cells or pharmaceutical compositions.

Images