Molecular marker of wheat storage protein content regulation gene TaARF14-1D and application of molecular marker

Abstract

The invention discloses a molecular marker of a wheat storage protein content regulation gene TaARF14-1D and application of the molecular marker. The invention belongs to the technical field of biology, and particularly relates to a molecular marker of a wheat storage protein content regulation gene TaARF14-1D and application of the molecular marker. The method for identifying or assisting in identifying the storage protein content of the wheat comprises a method A or a method B: A) detecting the genotype of an SNP (Single Nucleotide Polymorphism) site in a wheat genome to be detected, and identifying the storage protein content of the wheat according to the genotype, the SNP site being an SNP site on a wheat 1D chromosome, the nucleotide being A or G and being the 71th nucleotide of a sequence 4; b) detecting the haplotype in the wheat genome to be detected, identifying the storage protein content of the wheat according to the haplotype, and the storage protein content of the wheat variety with the haplotype being TaARF14-1D-Hap1 is higher than that of the wheat variety with the haplotype being TaARF14-1D-Hap2.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker of a wheat storage protein content regulating gene TaARF14-1D and an application thereof. Background Art

[0002] Wheat storage proteins mainly include glutenin and alcohol-soluble proteins. The composition and content of storage proteins determine the rheological properties of wheat dough. Changing the composition and content of storage proteins is of great significance to improving the processing quality of wheat.

[0003] The wheat auxin response factor (ARF) family is a group of key transcription factors in plants. They play a core role in plant development and can bind to auxin response elements (AuxRE) to regulate gene expression, thereby affecting processes such as cell division, differentiation, and tissue development. Molecular interactions confirmed that TaARF14 can bind to the promoter of storage protein encoding genes. Transgenics showed that overexpression of TaARF14 promoted the accumulation of storage proteins, increased the strength, elasticity, and extensibility of dough, and improved the quality of bread processing. Exploring and identifying alleles with high expression of the TaARF14 gene will help breed high-quality strong-gluten wheat varieties. Summary of the invention

[0004] The main problem to be solved by the present invention is how to identify or assist in identifying the content of wheat storage protein.

[0005] In order to solve the above problems, the present invention provides a method for identifying or assisting in identifying the content of wheat storage protein.

[0006] The method for identifying or assisting in identifying the content of wheat storage protein of the present invention comprises method A or B:

[0007] A) detecting the genotype of a SNP site in a wheat genome to be tested, and identifying or assisting in identifying the content of wheat storage protein according to the genotype, wherein the SNP site is a SNP site on wheat chromosome 1D, the nucleotide type of which is A or G, and is the 71st nucleotide of sequence 4 in the sequence list;

[0008] B) detecting haplotypes in the wheat genome to be tested, and identifying or assisting in identifying the content of wheat storage protein according to the haplotypes, wherein the storage protein content of the wheat variety with the haplotype TaARF14-1D-Hap1 is higher than that of the wheat variety with the haplotype TaARF14-1D-Hap2;

[0009] The allelic variant bases of the haplotype TaARF14-1D-Hap1 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are A, T, G, G, T, G, C, C and T respectively;

[0010] The allelic variant bases of the haplotype TaARF14-1D-Hap2 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are T, A, A, A, C, C, T, T and A, respectively.

[0011] As an implementation method, the method for identifying or assisting in identifying the content of wheat storage protein may include the following steps:

[0012] (1) Using the genomic DNA of wheat to be tested as a template, a primer combination is used to perform KASP molecular marker detection;

[0013] (2) After completing step (1), performing fluorescence detection to determine the genotype of the SNP site of the wheat to be tested;

[0014] (3) Identifying the storage protein content of the wheat to be tested based on the genotype results: The storage protein content of the wheat to be tested whose genotype at the SNP site is AA is higher than that of the wheat to be tested whose genotype at the SNP site is GG.

[0015] In the above method, the primer composition consists of primer A, primer B and primer C;

[0016] The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 21st to 38th position of sequence 1 in the sequence list;

[0017] The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th position of sequence 2 in the sequence list;

[0018] The nucleotide sequence of primer C is a single-stranded DNA molecule of sequence 3 in the sequence list.

[0019] In the above method, the reaction system of KASP can be: 2.0 μL KASP 2×Master Mix (LGC, Catalog No.: 13448166), 0.048 μL KASP primer (3 primers mixed, total concentration is 50 μM, wherein the molar ratio of two upstream primers and one downstream primer is 2:2:5), 2.0 μL template DNA (50 ng / μL).

[0020] The reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, 61°C-55°C (touch down program was selected, decreasing 0.6°C per cycle) for 1 min, amplification for 10 cycles; denaturation at 94°C for 20 s, 55°C for 1 min, and amplification for 31 cycles. Extension at 72°C for 3 min and storage at 4°C.

[0021] In the above method, the method for determining the genotype of the SNP in the wheat to be tested can be: the A base type carries FAM fluorescence and is distributed near the x-axis; the G base type carries HEX fluorescence and is distributed near the y-axis; samples with no detection signal are distributed near the origin.

[0022] In the above method, KASP labeling can be performed on a common PCR amplification instrument.

[0023] The present invention also provides a method for wheat breeding, comprising method M or N:

[0024] M) detecting the genotype or haplotype of the aforementioned SNP site in the wheat genome, and selecting wheat with the genotype of the SNP site being AA as a parent for breeding, wherein AA is the homozygous type of the SNP site being A;

[0025] N) detecting the haplotype described above in the wheat genome, and selecting wheat of the haplotype TaARF14-1D-Hap1 as a parent for breeding, wherein the allelic variant bases of the haplotype TaARF14-1D-Hap1 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeqv1.0 are A, T, G, G, T, G, C, C and T, respectively.

[0026] The present invention also provides application of the above-mentioned method in wheat breeding.

[0027] The present invention also provides the use of a substance for detecting the polymorphism or genotype of a SNP site in a wheat genome in any of the following:

[0028] (1) Identify or assist in identifying the content of wheat storage protein;

[0029] (2) Wheat breeding;

[0030] (3) preparing products for identifying or assisting in identifying the content of wheat storage protein;

[0031] (4) preparing wheat breeding products;

[0032] The SNP site is a SNP site on wheat chromosome 1B, the nucleotide type of which is A or G, and is the 71st nucleotide of sequence 4 in the sequence list.

[0033] In the above method and application, the genotype of the SNP site is AA or GG, wherein AA is the homozygous type of the SNP site A, and GG is the homozygous type of the SNP site G; the storage protein content of the wheat to be tested whose genotype of the SNP site is AA is higher than that of the wheat to be tested whose genotype of the SNP site is GG.

[0034] The present invention also provides a product, which contains the substance in the above-mentioned application, and the product can be any one of:

[0035] C1) Products for detecting single nucleotide polymorphisms or genotypes related to wheat storage protein content;

[0036] C2) Products that identify or assist in identifying the content of wheat storage protein;

[0037] C3) Products for wheat breeding.

[0038] In the above applications, methods and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0039] In the above applications or products, the substance may be the following D1), D2) or D3):

[0040] D1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site;

[0041] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0042] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0043] In the above-mentioned applications, methods and products, the primer composition may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be connected to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or move the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly read the sequence) without a marker.

[0044] Furthermore, in the above application or product, the primer composition consists of primer A, primer B and primer C;

[0045] The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 21st to 38th position of sequence 1 in the sequence list;

[0046] The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th position of sequence 2 in the sequence list;

[0047] The nucleotide sequence of primer C is a single-stranded DNA molecule of sequence 3 in the sequence list.

[0048] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is sequence 4 in the sequence list.

[0049] The present invention also provides the use of the DNA molecule described above in any of the following:

[0050] (1) Identify or assist in identifying the content of wheat storage protein;

[0051] (2) Wheat breeding;

[0052] (3) preparing products for identifying or assisting in identifying the content of wheat storage protein;

[0053] (4) Prepare wheat breeding products.

[0054] Herein, the purpose of the breeding may include cultivating wheat with high storage protein content. The wheat may be a pure line variety or an inbred line.

[0055] The method established by the present invention can be used to predict the storage protein content of wheat, can be used for early screening of wheat to be screened, can be used for wheat molecular marker-assisted breeding, and has important application value in the research of discovering wheat germplasm resources with improved storage protein content and breeding wheat varieties with improved storage protein content. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 These are the mutation sites and haplotype typing results of wheat TaARF14-1D gene.

[0057] Figure 2 This is the result of ELISA typing test of KASP products. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0059] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0060] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0061] The 152 wheat lines in the Huanghuai wheat region in the natural population in the following embodiment have been recorded in: Li J, Xie L, Tian X, Liu S, Xu D, Jin H, Song J, Dong Y, Zhao D, Li G, Li Y, Zhang Y, Zhang Y, Xia X, He Z, Cao S. (2021) TaNAC100 acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant Journal 108 (3): 829-840. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiment of the present invention and cannot be used for other purposes.

[0062] EXCEL statistical software was used to process the data. The experimental results were expressed as mean ± standard deviation. Independent sample T test was used for significance test. * indicates significant difference at P < 0.05 level.

[0063] Example 1: Identification of TaARF4-1D gene polymorphic sites and haplotypes

[0064] The gene number of TaARF14-1D (TraesCS1D02G337400) was entered into the wheat genome variation database (Wheat-SnpHub-Portal, http: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / ), and 183 varieties (MP group and NC-CC group) in the database were selected to retrieve the variation information of the gene open reading frame and its upstream and downstream 2Kb. A total of 13 variation sites were identified, which were recorded as Indel 1, Indel 2, Indel 3, Indel 4, SNP 5, SNP 6, SNP 7, SNP 8, SNP 9, SNP 10, SNP 11, SNP 12 and SNP 13 ( Figure 1), the physical positions of these 13 variant sites in the Chinese Spring reference genome sequence RefSeq v1.0 are 427148611, 427148628, 427148806, 427148978, 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766. The above closely linked allelic variation information defines two major haplotypes of TaARF14-1D, TaARF14-1D-Hap1 and TaARF14-1D-Hap2 ( Figure 1 ).

[0065] Among them, the 427150056th, 427150072nd, 427150166th, 427152744th, 427152755th, 427152866th, 427153284th, 427153548th and 427153766th positions of TaARF14-1D-Hap1 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are A, T, G, G, T, G, C, C and T respectively; the 427150056th, 427150072nd, 427150166th, 427152744th, 427152755th, 427152866th, 427153284th, 427153548th and 427153766th positions of TaARF14-1D-Hap2 in the Chinese spring wheat reference genome sequence RefSeq The 427150056th, 427150072nd, 427150166th, 427152744th, 427152755th, 427152866th, 427153284th, 427153548th and 427153766th positions in v1.0 are T, A, A, A, C, C, T, T and A respectively.

[0066] Example 2. Development of molecular markers for the TaARF14-1D haplotype and specific primer sets thereof

[0067] A KASP marker K-1D-SNP7 was designed for SNP7 of TaARF14-1D (position 427150166 in the Chinese spring wheat reference genome sequence RefSeq v1.0) using Polymarker (https: / / www.polymarker.info / ), including a KASP primer set (consisting of forward primer F1, forward primer F2 and reverse primer R), and the primer sequences were evaluated using WheatOmics (http: / / 202.194.139.32 / ).

[0068] Forward Primer A: 5'- GAAGGTGACCAAGTTCATGCTTTGGTGAGGCGCTTGGA-3' (SEQ ID No: 1, the underlined part is the specific recognition sequence of the FAM fluorescent probe);

[0069] Forward primer B: 5'- GAAGGTCGGAGTCAACGGATT TTTGGTGAGGCGCTTGGG-3' (SEQ ID No: 2, the underlined part is the HEX fluorescence specific recognition sequence);

[0070] Downstream primer C: 5'-GGTGAGATCAGCAACAAAAGTG-3' (SEQ ID No: 3).

[0071] The K-1D-SNP7 marker is that the 71st base from the 5′ end of SEQ ID No: 4 in the wheat genome (corresponding to the last base at the 3′ end of the two forward primers) is G or A. In SEQ ID No: 4, r represents A or G.

[0072] SEQ ID No:4:5'

[0073] -ACGCATGGAGGTTTCTCTGTTCCTCGCCGGGCAGCCGAGGACTGTTTCGCACCTTTGGTGAGGCGCTTGGrAA AAATAATTCCAAACCTGCACATTGATATAGTCACTTTTGTTGCTGATCTCACCACTTCAATCTCTGCA-3'.

[0074] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with nucleotide "A" at the SNP7 site. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescent quantitative PCR instrument;

[0075] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with the nucleotide "G" at the SNP7 site. The fluorescent signal of the HEX group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0076] Example 3: Establishment of a method for detecting the genotype of SNP7 using KASP markers

[0077] 1. PCR amplification system and procedure

[0078] The genomic DNA of common wheat leaves was extracted by the CTAB method. The quality and concentration of the genomic DNA must meet the PCR requirements, which are: agarose electrophoresis shows a single DNA band without obvious diffusion; the A260 / A280 ratio detected by the ultraviolet spectrophotometer Nanodrop2100 (Thermo) is between 1.8-2.0 (the DNA sample has no protein contamination), the A260 / A230 ratio is between 1.8-2.0 (the DNA sample has a low salt ion concentration), and there is no obvious light absorption at 270nm (the DNA sample has no phenol contamination); the concentration of the genomic DNA of the wheat to be tested is 50-200ng / μL.

[0079] 2. PCR amplification of KASP markers

[0080] The genomic DNA of the wheat to be tested was used as a template and PCR amplification was performed using the KASP primer set synthesized in Example 2 to obtain a PCR product.

[0081] Reaction system: 2.0 μL KASP 2×Master Mix (LGC, catalog number: 13448166), 0.048 μL KASP primers (3 primers mixed, total concentration of 50 μM, in which the molar ratio of two upstream primers and one downstream primer is 2:2:5), 2.0 μL template DNA (50 ng / μL).

[0082] The reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, 61°C-55°C (touch down program was selected, decreasing 0.6°C per cycle) for 1 min, amplification for 10 cycles; denaturation at 94°C for 20 s, 55°C for 1 min, and amplification for 31 cycles. Extension at 72°C for 3 min and storage at 4°C.

[0083] A blank control (CK) in which no template DNA was added to the reaction system was set up at the same time in the experiment, and one control was set up for each plate.

[0084] 3. Genotyping

[0085] The fluorescence signal was detected using a PHERAstar Plus autofocus fluorescence multifunctional microplate reader (BMG Labtech GmbH, Ortenberg, Germany), and typing was performed using KlusterCaller software (LGC, Hoddesdon, UK). When the temperature of the PCR amplification product dropped below 40°C, the fluorescence value was read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent probe was observed at an excitation light wavelength of 485nm and an emission light wavelength of 520nm, and the HEX fluorescent probe was observed at an excitation light wavelength of 528nm and an emission light wavelength of 560nm), and the genotype of the wheat to be tested at the SNP7 site was determined based on the color of the fluorescence signal. The A base type carries FAM fluorescence and is distributed near the x-axis; the G base type carries HEX fluorescence and is distributed near the y-axis; samples without detection signals are distributed near the origin.

[0086] The specific judgment principles are as follows: if the KASP marker amplification product of the wheat to be tested shows a blue fluorescent signal, the genotype of the wheat to be tested at the SNP7 site is AA homozygous (that is, the SNP7 site in the wheat genome is homozygous for A); if the KASP marker amplification product of the wheat to be tested shows a red fluorescent signal, the genotype of the wheat to be tested at the SNP7 site is GG homozygous (that is, the SNP7 site in the wheat genome is homozygous for G).

[0087] Example 4: Application of molecular marker K-1D-SNP7 and its KASP primer set in identifying wheat storage protein phenotypes in multiple environments

[0088] 1. Field phenotypic identification and data analysis of 152 natural populations in the Huanghuai wheat region

[0089] 152 natural wheat varieties from the Huanghuai wheat region were planted in Anyang, Henan and Suixi, Anhui in 2012-2013 and 2013-2014, and in Anyang, Henan and Gaoyi, Hebei in 2014-2015. A completely randomized block design was used with three replications, single-row plots, 1.5m long, 0.2m wide, and 50 grains per row. Field management measures were carried out in accordance with local wheat field management regulations.

[0090] The protein content was analyzed using a near-infrared reflectance spectrometer (Perten DA 7200, Springfield, IL, USA). The BLUE values ​​of the multi-environment storage protein phenotype data are shown in Table 1.

[0091] 2. The genotype of SNP7 of the wheat lines in the Huanghuai wheat region was identified and detected using the method of Example 3. The specific genotype identification results are shown in Table 1.

[0092] Table 1. Genotyping and phenotypic data analysis of 152 representative wheat lines in the Huanghuai wheat region using molecular marker K-1D-SNP7

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] 3. Association analysis between wheat TaARF14-1D gene SNP7 genotype and storage protein

[0100] According to the typing results of step 2, the data were subjected to T test using EXCEL statistical software to determine the genetic effect of ARF14-1D gene haplotype on storage protein. The results of the genetic effect analysis on storage protein are shown in Table 2, * indicates significant difference (P < 0.05).

[0101] Table 2. Analysis of the phenotypic relationship between SNP7 genotype and wheat storage protein content traits

[0102]

[0103] The above results show that the storage protein content of wheat varieties with genotype AA at SNP7 is significantly higher than that of wheat varieties with genotype GG. Based on the research in Example 1, the haplotype type corresponding to the wheat varieties with genotype AA at SNP7 is ARF14-1D-Hap1. When subsequently breeding wheat varieties with high storage protein content, wheat varieties with genotype AA at SNP7 or haplotype ARF14-1D-Hap1 can be used as parents for breeding.

[0104] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for identifying or assisting in identifying the content of wheat storage protein, characterized in that , including method A or B: A) detecting the genotype of a SNP site in a wheat genome to be tested, and identifying or assisting in identifying the content of wheat storage protein according to the genotype, wherein the SNP site is a SNP site on wheat chromosome 1D, the nucleotide type of which is A or G, and is the 71st nucleotide of sequence 4 in the sequence list; B) detecting haplotypes in the wheat genome to be tested, and identifying or assisting in identifying the content of wheat storage protein according to the haplotypes, wherein the storage protein content of the wheat variety with the haplotype TaARF14-1D-Hap1 is higher than that of the wheat variety with the haplotype TaARF14-1D-Hap2; The allelic variant bases of the haplotype TaARF14-1D-Hap1 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are A, T, G, G, T, G, C, C and T respectively; The allelic variant bases of the haplotype TaARF14-1D-Hap2 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are T, A, A, A, C, C, T, T and A, respectively.

2. A method for wheat breeding, characterized in that , including method M or N: M) detecting the genotype or haplotype of the SNP site in claim 1 in the wheat genome, and selecting wheat with the genotype of the SNP site being AA as a parent for breeding, wherein AA is the homozygous type of the SNP site being A; N) detecting the haplotype of claim 1 in the wheat genome, selecting wheat of the haplotype TaARF14-1D-Hap1 as a parent for breeding, wherein the allelic variant bases of the haplotype TaARF14-1D-Hap1 at positions 427150056, 427150072, 427150166, 427152744, 427152755, 427152866, 427153284, 427153548 and 427153766 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are A, T, G, G, T, G, C, C and T, respectively.

3. Application of the method according to claim 1 or 2 in wheat breeding.

4. Use of a substance for detecting polymorphism or genotype of a SNP site in a wheat genome in any of the following: (1) Identify or assist in identifying the content of wheat storage protein; (2) Wheat breeding; (3) preparing products for identifying or assisting in identifying the content of wheat storage protein; (4) preparing wheat breeding products; The SNP site is a SNP site on wheat chromosome 1B, the nucleotide type of which is A or G, and is the 71st nucleotide of sequence 4 in the sequence list.

5. The method according to claim 1 or 2, or the use according to claim 4, characterized in that: The genotype of the SNP site is AA or GG, wherein AA is the homozygous type of the SNP site being A, and GG is the homozygous type of the SNP site being G; the storage protein content of the wheat to be tested whose genotype of the SNP site is AA is higher than that of the wheat to be tested whose genotype of the SNP site is GG.

6. The product is characterized by: The product contains the substance in the application described in claim 4, and the product is any one of: C1) Products for detecting single nucleotide polymorphisms or genotypes related to wheat storage protein content; C2) Products that identify or assist in identifying the content of wheat storage protein; C3) Products for wheat breeding.

7. The use according to claim 4 or the product according to claim 6, characterized in that: The substance is the following D1), D2) or D3): D1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The use or product according to claim 7, characterized in that: The primer composition consists of primer A, primer B and primer C; The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 21st to 38th position of sequence 1 in the sequence list; The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-39 in sequence 2 in the sequence list; The nucleotide sequence of primer C is a single-stranded DNA molecule of sequence 3 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence of the DNA molecule is sequence 4 in the sequence listing.

10. Use of the DNA molecule according to claim 9 in any of the following: (1) Identify or assist in identifying the content of wheat storage protein; (2) Wheat breeding; (3) preparing products for identifying or assisting in identifying the content of wheat storage protein; (4) Prepare wheat breeding products.

Images