Medical application of citraconic acid in treatment of peri-implantitis

Abstract

The invention provides a medical application of citraconic acid in treatment of peri-implantitis, and discloses a novel medical application of citraconic acid, which can effectively intervene the inflammatory process of peri-implantitis, relieve inflammatory symptoms and promote tissue repair. The traditional Chinese medicine composition for preventing and treating the peri-implantitis overcomes the defects of a traditional medical method for preventing and treating the peri-implantitis, provides a new treatment means for treating the peri-implantitis, can be prepared into a medicine for resisting the peri-implantitis, and has wide medical value.

Description

Technical Field

[0001] The invention discloses a medical use of citraconic acid in the treatment of peri-implantitis, in particular to related research and application based on a mouse peri-implantitis model, belonging to the field of medical technology. Background Art

[0002] In the field of oral rehabilitation, implants have been widely used. However, with the increasing popularity of implant technology, the incidence of peri-implantitis has gradually increased, and has become a key factor affecting the long-term stability and success rate of implant dentures. It not only causes the implant to loosen and fall off, causing pain and swelling, but also seriously affects the patient's chewing function, brings physical and psychological burdens to patients, and increases medical costs.

[0003] At present, the main treatments for peri-implantitis are mechanical debridement, antibacterial therapy, laser therapy, and surgical treatment. Although mechanical debridement can remove some plaque and tartar, it is often difficult to completely remove the pathogenic factors of deep periodontal pockets and complex implant surfaces, and it is very easy to damage the implant surface during the operation, thereby affecting bone bonding; in terms of chemical drug treatment, whether it is local or systemic use of antibiotics, long-term use is prone to cause thorny problems such as the production of drug-resistant bacteria and dysbiosis, and some drugs themselves may have toxic side effects, which greatly limits their long-term use; in addition, auxiliary treatment methods such as laser therapy and guided tissue regeneration are expensive and require extremely precise operation. Guided tissue regeneration is significantly affected by individual differences among patients, and the healing effect is unstable.

[0004] The citraconic acid of the present invention has the molecular formula C 5 H 6 O 4 , with a molecular weight of 130.1 g / mol. In traditional cognition, citraconic acid, as an important organic compound, is often used in the chemical industry to synthesize a variety of polymer materials, such as polyesters and polyamides with special properties. Its unique chemical structure gives the material good flexibility, stability and other properties. Summary of the invention

[0005] The purpose of the present invention is to provide a medical use of citraconic acid in the treatment of peri-implantitis. Citraconic acid can effectively intervene in the inflammatory process of peri-implantitis, alleviate inflammatory symptoms, and promote the function of tissue repair.

[0006] The anti-inflammatory mechanism of the citraconic acid described in the present invention is manifested in the following aspects:

[0007] Inhibition of inflammatory factor expression: Citraconic acid can significantly reduce the mRNA expression levels of proinflammatory factors interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and interleukin-1β (IL-1β) in macrophages induced by human monocytic leukemia cells (THP-1).

[0008] Model establishment: C57BL / 6 mice were selected, and implants were implanted in front of their maxillary first molars, and the peri-implantitis model was induced by silk thread ligation. After the model was established, the model was evaluated and verified by Micro-CT technology (such as bone volume fraction (BV / TV), trabecular number (Tb.N) and trabecular thickness (Tb.Th)), histological examination (such as the degree of inflammatory cell infiltration), etc.

[0009] Evaluation of the therapeutic effect of citraconic acid

[0010] Grouping and administration: Mice with peri-implantitis were randomly divided into a treatment group and a control group. The treatment group was given a certain dose of citraconic acid by local injection into the peri-implant tissue; the control group was given an equal amount of normal saline.

[0011] Drug dosage form: Dissolve 32.53 mg of citraconic acid in 10 ml of cell culture medium by ultrasonic treatment until the citraconic acid is completely dissolved to form a homogeneous solution.

[0012] Local administration: Use a micro-syringe to deliver the citraconic acid solution directly to the deep layers of the tissue surrounding the implant to improve the penetration and absorption efficiency of citraconic acid.

[0013] The positive effects of the present invention are: disclosing a new medical use of citraconic acid, being able to effectively intervene in the inflammatory process of peri-implantitis, alleviating inflammatory symptoms, and promoting the function of tissue repair; solving the defects and shortcomings of traditional medical methods for preventing and treating peri-implantitis, providing a new treatment method for peri-implantitis, and being able to be prepared into anti-peri-implantitis drugs, having a wide range of medical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :Schematic diagram of the effect of Citra at different concentrations on THP-1 cell viability; Figure 2 : Schematic diagram of the inhibitory effect of Citra on activated THP-1 cells inflammation in vitro (*p<0.05, **p<0.01, ***p<0.001); Figure 3 : HE and Micro-CT schematic diagram of Citra's anti-inflammatory effect in a mouse implantitis model; Figure 4: HE diagram of the effects of Citra on various organs of mice. DETAILED DESCRIPTION

[0015] The present invention is further described by way of the following examples, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or change made to the present invention that is easily implemented by a person of ordinary skill in the art will fall within the scope of the claims of the present invention. Example 1

[0016] Effect of Citra on THP-1 cell viability: The present invention aims to explore the effect of Citra on the activity of THP-1 cells. First, THP-1 cells in the logarithmic growth phase were collected using a cell scraper, and then 1×10 4 The cells were plated at a density of 100 ng / ml in a pre-treated 96-well plate in a culture medium containing 100 ng / ml of the inducer phorbol ester (PMA). After 24 hours, THP-1 cells were incubated with 0 mM, 1 mM, 5 mM, 10 mM, and 15 mM Citra for 24 and 48 hours, respectively.

[0017] The cell viability was detected by CCK-8 method; 10 μL of CCK8 reagent was added to each well of the 96-well plate, and the cells were incubated in the cell culture incubator for 1-4 hours, and the absorbance was detected at 450 nm by a microplate reader; the results of the CCK-8 method showed that "with the change of Citra concentration, the cell viability showed a trend of first increasing and then decreasing. When the Citra concentration was 5 mM, the cell viability reached the highest.

[0018] Example 2

[0019] Inhibitory effect of Citra on pro-inflammatory factors in THP-1 cells: Effect of Citra on the gene expression of proinflammatory factors IL-6, IL-1β, and TNF-α in THP-1 cells: THP-1 cells were seeded in 6-well plates at a density of 1×106 cells per well. Macrophages were pretreated with 5 mM Citra for 3 h. THP-1 cells were stimulated with LPS (5 μg mL-1) for 24 h, and the effect of Citra on the gene expression of proinflammatory factors IL-1β, IL-6, and TNF-α in THP-1 cells was detected.

[0020] RNA extraction and detection: First, wash the cells in the six-well plate with pre-cooled PBS. Then, add 1mL Trizol to each well and collect the cells into a 1.5mL enzyme-free centrifuge tube. Next, add 200μL chloroform to each centrifuge tube, mix by inversion for 15s, and centrifuge at 4℃12000g for 15 minutes. Carefully transfer the supernatant to another enzyme-free centrifuge tube and add 0.5mL isopropanol. After shaking and mixing, let it stand on ice for 10 minutes, and then centrifuge at 4℃12000g for 10 minutes. White precipitate can be observed at the bottom of the EP tube. After discarding the supernatant, add 1mL of anhydrous ethanol to thoroughly wash the precipitate, and centrifuge at 4℃, 7500g for 5 minutes. After absorbing all the ethanol, add 30uL enzyme-free water when the RNA becomes translucent and gently blow to mix. Finally, the Nanodrop instrument was used to determine the content and purity of the extracted total RNA, and the 260 / 280nm absorbance ratio of all samples was ensured to be between 1.8 and 2.0. According to the instructions, 1000 ng of total RNA was reverse transcribed.

[0021] IL-1β (Human): Forward primer: GGGCCTCAAGGAAAAGAATC; Reverse primer: TTCTGCTTGAGAGGTGCTGA; IL-6 (Human): Forward primer: TGCAATAACCACCCCTGACC; Reverse primer: AGGGTTTGCTACAACATGGG; TNF-α(Human): Forward primer: CTGCACTTTGGAGTGATCGG; Reverse primer: GTACTCCAGAAGACCAGAGG; The forward and reverse primers were prepared into 100 μM stock solutions with TE buffer and stored at -20°C. When performing PCR experiments, they were diluted to 5 μM working solutions with RNase-free water. Changes in RNA content were detected according to the instructions of the Roche SYBR GREEN kit.

[0022] The results are shown in the attached Figure 2 As shown in the figure, LPS (5μgmL-1) successfully activated THP-1 cells, and the expression of pro-inflammatory genes IL-1β, IL-6, and TNF-α was significantly upregulated compared with the blank control group (Control) (P<0.001). Citra within the safe concentration can significantly downregulate the gene expression of pro-inflammatory factors IL-1β, IL-6, and TNF-α in activated THP-1 cells at the gene level (see Appendix Figure 2 ), indicating that Citra has a significant inhibitory effect on inflammation in vitro.

[0023] Example 3

[0024] Effect of Citra in treating peri-implantitis in mice: Male C57BL / 6 mice (18-20 g) were selected and anesthetized with isoflurane to implant a pure titanium implant with sandblasting and acid etching surface treatment in front of the left first molar. After healing for 4 weeks, the mouse peri-implantitis model was successfully established by ligating with ligature wire and injecting 10 μL LPS (1 mg / mL) into the tissue around the implant for 2 weeks. Citra (2.5 mg mL-1, 10 μL) was injected into the gingival tissue around the mouse implant. The control group had no ligature wire and was injected with normal saline (10 μL) as a control. The injection lasted for 14 days, and the loosening of the ligature wire and the fall of the implant were checked every day. The mice were killed by 4% paraformaldehyde cardiac perfusion fixation, and the gingival tissue was obtained, fixed, dehydrated step by step, and histologically stained. The maxillary bone was collected, and the bone volume fraction (BV / TV), trabecular number (Tb.N) and trabecular thickness (Tb.Th) were quantitatively analyzed using Micro-CT technology. The results showed that the peri-implantitis group (LPS) showed significant alveolar bone resorption compared with the control group. However, Citra alleviated the adverse trend of alveolar bone resorption. Microscopic observation showed that compared with the control group (Control), the soft and hard tissues of the peri-implantitis group (LPS) were severely damaged, and a large number of inflammatory cells such as neutrophils and macrophages infiltrated the gingival tissue, while the inflammatory cell infiltration was reduced in the local injection of Citra group. (See Appendix Figure 3 ), indicating that Citra has anti-inflammatory properties and provides a new therapeutic target for the clinical treatment of peri-implantitis.

[0025] Example 4

[0026] Study on the biological toxicity of Citra in mice: The mice were perfused and fixed with 4% paraformaldehyde, and the heart, liver, spleen, lungs and kidneys were fixed, dehydrated and histologically stained to determine whether Citra would cause organ damage. Microscopic observation showed that compared with the control group, no obvious histological changes were observed in the organs of the Citra group (see Appendix). Figure 4 ), indicating that Citra has good biological safety in vivo. Example 5

[0027] The citraconic acid of the present invention can be prepared into any pharmaceutical preparations such as powders, oral liquids, granules, tablets, capsules, pills, etc. for preparing drugs for treating peri-implant inflammation, and conventional pharmaceutically acceptable excipients can also be added.

Claims

1. A medical use of citraconic acid in the preparation of a drug for treating peri-implant inflammation, wherein the molecular formula of the citraconic acid is C 5 H 6 O 4 , molecular weight is 130.1g / mol.

2. The citraconic acid as claimed in claim 1 can be made into any pharmaceutical preparations such as powders, oral liquids, granules, tablets, capsules, pills, etc. for preparing drugs for treating peri-implant inflammation.

3. The citraconic acid as claimed in claim 1 can also be added with conventional pharmaceutically acceptable excipients.

Images