Shear inhibitor for pre-miR-21 post-transcriptional processing as well as preparation method and application of shear inhibitor

Abstract

The invention belongs to the field of biological medicines, and discloses a shearing inhibitor for pre-miR-21 post-transcriptional processing as well as a preparation method and application of the shearing inhibitor. The shearing inhibitor for pre-miR-21 post-transcriptional processing is a benzimidazole derivative with a structure as shown in the following formula I. The invention further discloses a preparation method of the shearing inhibitor for pre-miR-21 post-transcriptional processing. The shearing inhibitor for pre-miR-21 post-transcriptional processing can be combined with pre-miR-21 in vivo and in vitro and inhibit shearing of pre-miR-21 post-transcriptional processing, so that expression of miR-21 is silenced, modified and / or improved, and finally growth of human breast cancer cells MDA-MB-231 is inhibited in vivo; the shearing inhibitor processed after the pre-miR-21 transcription is good in stability, convenient to store, low in cost and good in anti-tumor effect. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to a pre-miR-21 post-transcriptional processing shearing inhibitor and a preparation method and application thereof. The pre-miR-21 post-transcriptional processing shearing inhibitor is a benzimidazole derivative. Background Art

[0002] In addition to encoding and assembling proteins, RNA is also involved in countless cellular activities. Only 1-2% of the human genome encodes proteins, but about 80% of it is transcribed into RNA. Although most transcribed RNAs are non-coding, many non-coding RNAs are functionally involved in regulating cellular activities and disease states. These functional non-coding RNAs are potential therapeutic targets for related diseases.

[0003] Currently, the approach to targeting RNA is to use oligonucleotide compounds that preferentially target unstructured regions, and therefore, the development of therapeutic approaches targeting RNA has focused primarily on the use of oligonucleotides. However, RNA structure has been shown to play a key role in important biological processes and disease states. Since RNA biology is often mediated by the structures it forms, targeting structured RNA may be a potential strategy to address related issues. However, little is known about the interactions between structured RNA and small molecule compounds, which has led to the belief that targeting structured RNA with small molecule compounds is not feasible. However, in recent years, a large number of studies have shown that small molecules have been studied for targeting the three-dimensional structure of the ribosome, ribosomal switches, certain viral RNAs, and repeat expansion of nucleotides, and small molecules are fully capable of targeting RNA.

[0004] One class of structured RNAs that play a role in disease biology is noncoding microRNAs (miRs). They are generated from highly structured precursors. The precursor of pre-miR-21 (pri-miR-21) is processed stepwise in the nucleus by Drosha to pre-miR-21, which is then processed by Dicer in the cytoplasm to produce mature miR-21, which is loaded into the RNA-induced silencing complex (RISC) to regulate gene expression. Many miRs play important roles in human disease biology. For example, studies have shown that miR-21 expression is negatively correlated with survival in patients with triple-negative breast cancer and is expressed in solid tumors.

[0005] The treatment of major diseases such as tumors, ALS, and Alport syndrome (AS) through the regulation of post-transcriptional processing of miRNA is a hot frontier in the field of biomedicine at home and abroad at this stage. At present, the methods for downregulating the expression level of miRNA mainly include chemically synthesized oligonucleotides (ASO) and vector construction. Chemically synthesized oligonucleotides use antisense miRNA to block the activity of specific miRNA. For vectors, it is mainly to construct plasmids or viral systems to express siRNA that is complementary to the stem-loop structure of the miRNA precursor. However, these methods are currently mostly in the laboratory stage because of their high prices and cannot be truly used in clinical treatment. Therefore, the development of new means to downregulate miRNA levels has become an extremely urgent research field. Summary of the invention

[0006] In order to solve the shortcomings and deficiencies of the prior art methods for downregulating miR-21, which are expensive and not truly applied in clinical practice, the primary purpose of the present invention is to provide a pre-miR-21 post-transcriptional processing splicing inhibitor; the post-transcriptional processing splicing inhibitor can bind to pre-miR-21 in vitro and in vivo and inhibit its post-transcriptional processing splicing, thereby silencing, modifying and / or improving the expression of miR-21, and ultimately inhibiting the growth of human breast cancer cells MDA-MB-231 in vivo; the pre-miR-21 post-transcriptional processing splicing inhibitor has good stability, is easy to store, has low cost, and has good anti-tumor effect.

[0007] Another object of the present invention is to provide a method for preparing the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor.

[0008] Another object of the present invention is to provide the use of the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor in the preparation of anti-tumor drugs.

[0009] Another object of the present invention is to provide an anti-tumor drug containing the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A pre-miR-21 post-transcriptional processing splicing inhibitor, wherein the pre-miR-21 post-transcriptional processing splicing inhibitor is a benzimidazole derivative having a structure shown in the following formula I:

[0012]

[0013] R1 is an amine substituent; R2 is hydrogen or Wherein R is hydrogen, alkyl, substituted alkyl, aryl or substituted aryl; R3 is methyl; R4, R5, R6, R7 are fluorine, chlorine, bromine, alkyl, hydrogen, amino, nitro, methoxy, trifluoromethyl or amine substituents respectively; R8 is hydrogen, alkyl, substituted alkyl, aryl or substituted aryl.

[0014] Preferably, R2 is hydrogen or Wherein R is hydrogen, alkyl, or substituted alkyl; R4, R5, R6, and R7 are alkyl, hydrogen, amino, nitro, methoxy, trifluoromethyl, or amine substituents, respectively; and R8 is hydrogen, alkyl, or substituted alkyl.

[0015] More preferably, R2 is hydrogen or Wherein R is hydrogen or alkyl; R4, R5, R6, and R7 are alkyl, hydrogen, methoxy, trifluoromethyl, or amine substituents, respectively; and R8 is hydrogen or alkyl.

[0016] More preferably, R2 is hydrogen; R4, R5, R6, and R7 are alkyl, hydrogen, or amine substituents; and R8 is hydrogen.

[0017] The pre-miR-21 post-transcriptional processing cleavage inhibitor is more preferably a compound having a structure shown in the following formula II, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 (3-(Dimethylamino)propyl)-6-methylpyrimidine-2,4-diamine;

[0018]

[0019] The preparation method of the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor is carried out according to the following steps:

[0020] (1) Using substituted o-phenylenediamine as the starting material, a nucleophilic substitution reaction with various amine substituents occurs under alkaline conditions to obtain intermediate 1;

[0021] (2) intermediate 1 is reacted with dicyandiamide under acidic conditions by reflux to obtain intermediate 2;

[0022] (3) Intermediate 2 undergoes a cyclization reaction with substituted ethyl acetoacetate under alkaline conditions to obtain intermediate 3;

[0023] (4) Intermediate 3 undergoes a condensation reaction with amines under alkaline conditions to obtain the final product, a pre-miR-21 post-transcriptional processing cleavage inhibitor.

[0024] The structure of the substituted o-phenylenediamine is shown in Formula III, the structure of the intermediate 1 is shown in Formula IV, the structure of the intermediate 2 is shown in Formula V, and the structure of the intermediate 3 is shown in Formula VI:

[0025]

[0026] Among them, R2, R3, R4, R5, R 6、 R 7、 R8 is as defined above.

[0027] The reaction equation for preparing the splicing inhibitor of pre-miR-21 post-transcriptional processing is as follows:

[0028]

[0029] wherein R1, R2, R3, R4, R5, R6, R7 and R8 are as defined above.

[0030] In the step (1), the reaction temperature is 25°C to 160°C, preferably 25°C to 40°C; the reaction time is 8h-24h, preferably 10h-14h; the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methyl pyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butanol or isopropanol, preferably N,N-dimethylformamide; the base used in the alkaline condition is potassium carbonate, sodium carbonate, sodium bicarbonate, cesium carbonate, potassium acetate, triethylamine, diethylamine, N,N-diisopropylethylamine, pyridine or potassium hydroxide, preferably potassium carbonate;

[0031] In the step (2), the reaction temperature is 90°C to 160°C, preferably 100°C to 120°C; the reaction time is 1h-6h, preferably 1h-2h; the acid used in the acidic condition is 10% sulfuric acid or 3M hydrochloric acid aqueous solution, preferably 10% sulfuric acid;

[0032] In the step (3), the reaction temperature is 100°C to 180°C, preferably 120°C to 140°C; the reaction time is 16h-72h, preferably 24h-48h; the base used in the alkaline condition is potassium carbonate, sodium carbonate, sodium bicarbonate, cesium carbonate, potassium acetate, triethylamine, diethylamine, N,N-diisopropylethylamine, pyridine or potassium hydroxide, preferably N,N-diisopropylethylamine; the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methylpyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butyl alcohol or isopropanol, preferably N,N-dimethylformamide;

[0033] In the step (4), the reaction temperature is 25°C to 160°C, preferably 25°C to 40°C; the reaction time is 6h to 24h, preferably 8h to 16h; the condensation agent used in the condensation reaction is O-(7-azabenzotriazole-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate, 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate, ((1H-benzo[d][1,2,3]triazol-1-yl)oxy)tris(dimethylamino)phosphonium hexafluorophosphate (V) or (3H-1,2,3-triazolo[4,5-b]pyridine-3-oxy )tri-1-pyrrolidinylphosphonium hexafluorophosphate, preferably (3H-1,2,3-triazolo[4,5-b]pyridine-3-oxy)tri-1-pyrrolidinylphosphonium hexafluorophosphate; the base used under alkaline conditions is pyridine, triethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene, preferably 1,8-diazabicyclo[5.4.0]undec-7-ene; the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methylpyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butyl alcohol or isopropanol, preferably N,N-dimethylformamide.

[0034] The application of the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor in the preparation of an anti-tumor drug, wherein the anti-tumor drug is a drug for triple-negative breast cancer.

[0035] An anti-tumor drug comprising the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor.

[0036] The anti-tumor drug can be prepared into tablets, capsules, injections and other preparations.

[0037] Compared with the prior art, the present invention has the following advantages and effects:

[0038] (1) The present invention focuses on triple-negative breast cancer associated with the expression level of miR-21, and obtains compounds with the structure shown in general formula I. The obtained compounds have not been reported in the literature and are novel in structure.

[0039] (2) There are almost no other pre-miR-21 small molecule inhibitors in the prior art, while the compounds involved in the present invention have a strong inhibitory effect on the splicing of pre-miRNA 21 post-transcriptional processing, and can be used to treat tumors caused by overexpression of miR-21 or other diseases related to abnormal expression of miR-21; specifically, the pre-miR-21 post-transcriptional processing splicing inhibitor can bind to pre-miR-21 in vitro and in vivo and inhibit its post-transcriptional processing splicing, silence, modify and / or improve the expression of miR-21, and ultimately inhibit the growth of human breast cancer cells MDA-MB-231 in vivo.

[0040] (3) The compounds involved in the present invention have good stability, are easy to store, have low cost, and have good anti-tumor effects; the benzimidazole derivatives described in the present invention have novel structures and enrich the research on benzimidazole derivatives in the field of preparing anti-cancer drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 These are the results of in vitro TO-PRO-1 replacement experiments on some products of the present invention.

[0042] Figure 2 The results are of the interaction between some products of the present invention and Pre-miR 21 in vitro.

[0043] Figure 3 The results show the effects of some products of the present invention on the expression of miR-21. DETAILED DESCRIPTION

[0044] The specific implementation of the present invention is further described in detail below in conjunction with the accompanying drawings and examples, but the implementation and protection of the present invention are not limited thereto. It should be pointed out that if there are processes that are not particularly described in detail below, they can be implemented or understood by those skilled in the art with reference to the prior art. The reagents or instruments used without indicating the manufacturer are deemed to be conventional products that can be purchased commercially. The nuclear magnetic resonance hydrogen spectrum of the compound was measured using a Bruker ARX-400; all reagents used were analytically pure or chemically pure.

[0045] The preparation method of the pre-miR-21 post-transcriptional processing splicing inhibitor described in the following Examples 1 to 9, the specific synthesis route is as follows:

[0046]

[0047] wherein R1, R2, R3, R4, R5, R6, R7 and R8 are as defined above.

[0048] Example 1

[0049] The preparation method of the pre-miR-21 post-transcriptional processing splicing inhibitor in this embodiment specifically comprises the following steps:

[0050] (1) Synthesis of 2-guanidinobenzimidazole

[0051] Add o-phenylenediamine (10 g, 0.092 mol) and dicyandiamide (11.60 g, 0.138 mol) into an eggplant-shaped bottle, then add 100 mL of 10% sulfuric acid, stir at 100 °C for 2 h, wait for the reaction solution to cool to room temperature, adjust the pH to 6-7 with 50% NaOH in an ice bath, and solid precipitate; filter under reduced pressure, wash the filter cake three times with water, and dry the filter cake to obtain 2-guanidinobenzimidazole, which is directly used in the next step without further purification, with a yield of 80%.

[0052] (2) Synthesis of 2-((1H-benzo[d]imidazol-2-yl)amino)-6-methylpyrimidin-4(3H)-one

[0053] The 2-guanidinobenzimidazole (12.9 g, 0.074 mol) obtained in step (1) was added to an eggplant-shaped bottle; then 100 mL of N,N-dimethylformamide, N,N-diisopropylethylamine (25.78 mL, 0.148 mol) and ethyl acetoacetate (93.59 mL, 0.74 mol) were added in sequence, stirred at 120° C. for 24 h, diluted with anhydrous ether, filtered under reduced pressure, the precipitate was collected, and the solid was washed with more anhydrous ether. The filter cake was dried to obtain 2-((1H-benzo[d]imidazol-2-yl)amino)-6-methylpyrimidin-4(3H)-one, which was directly used in the next step without further purification, with a yield of 50%.

[0054] (3)N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 Synthesis of -(2-(Diethylamino)ethyl)-6-methylpyrimidine-2,4-diamine

[0055] 2-((1H-benzo[d]imidazol-2-yl)amino)-6-methylpyrimidin-4(3H)-one (120.5 mg, 0.5 mmol) and (3H-1,2,3-triazolo[4,5-b]pyridine-3-oxy)tri-1-pyrrolidinylphosphonium hexafluorophosphate (335.6 mg, 0.643 mmol) obtained in step (2) were added to a pressure tube; N,N-dimethylformamide (10 mL) and 1,8-diazapine were then added. Bicyclo[5.4.0]undec-7-ene (108.9 μL, 0.729 mmol) was stirred at room temperature for 1 h; then N,N-diethylethylenediamine (176.9 μL, 1.25 mmol) was added and stirred overnight; then the mixture was diluted with water, filtered under reduced pressure, the precipitate was collected, and the solid was washed with more water; finally, column chromatography was used for purification, and the developing solvent was a mixture of dichloromethane and methanol in a volume ratio of 50:1. The final yield of the product was 16%. The structural characterization data of the product are: 1 H NMR(400MHz,Methanol-d4)δ7.46–7.39(m,2H),7.15–7.09(m,2H),6.02(s,1H),3.54(s,2H),2.79 (t,J=7.0Hz,2H),2.72(q,J=7.2Hz,4H),2.32(s,3H),1.10(t,J=7.2Hz,6H).HRMS(ESI,m / z)calcd for C 18 H 26 N7[M+H] + ,340.2244; found 340.5486.

[0056] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(2-(Diethylamino)ethyl)-6-methylpyrimidine-2,4-diamine:

[0057]

[0058] Example 2

[0059] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by N-(2-aminoethyl)morpholine in an equal molar ratio, and the product yield is 27%. The structural characterization data of the product are: 1H NMR (400MHz, Methanol-d4) δ7.46–7.40(m,2H),7.22–7.17(m,2H),6.06(s,1H),3.73(t,J=4.7Hz, 4H),3.37(s,2H),2.67(t,J=6.6Hz,2H),2.57(t,J=4.7Hz,4H),2.33(s,3H)._HRMS(ESI,m / z)calcd for C 18 H 24 N7O[M+H] + ,354.2037; found 354.1260.

[0060] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-6-methyl-N 4 -(2-Morpholinoethyl)pyrimidine-2,4-diamine:

[0061]

[0062] Example 3

[0063] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by 1-(3-aminopropyl)-4-methylpiperazine in an equal molar ratio, and the product yield is 28%. The structural characterization data of the product are: 1 H NMR(400MHz, Methanol-d4)δ7.45–7.38(m,2H),7.16–7.07(m,2H),6.00(s,1H),3.70–3.61(m,2H),2.51 (dt,J=5.6,2.5Hz,2H),2.66–2.37(m,8H),2.30–2.25(m,3H),1.98–1.86(m,2H)._HRMS(ESI,m / z)calcd for C 20 H 29 N8[M+H] + ,381.2510; found 381.8470.

[0064] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-6-methyl-N 4 -(3-(4-methylpiperazin-1-yl)propyl)pyrimidine-2,4-diamine:

[0065]

[0066] Example 4

[0067] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by 1-cyclopropylcarbonylpiperazine in an equal molar ratio, and the product yield is 4%. The structural characterization data of the product are: 1 H NMR(400MHz, Methanol-d4)δ7.47–7.38(m,2H),7.12(dt,J=6.0,3.6Hz,2H),6.30(s,1H),3.85(d,J=27.1Hz,4H),3.70(s,4H), 2.42(s,3H),1.99(ddd,J=9.4,6.8,4.0Hz,1H),0.91(dt,J=4.8,2.8Hz,2H),0.86(dt,J=8.1,2.9Hz,2H)._HRMS(ESI,m / z)calcd for C 20 H 24 N7O[M+H]+,378.2037; found378.2502.

[0068] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named (4-(2-((1H-benzo[d]imidazol-2-yl)amino)-6-methylpyrimidin-4-yl)piperazin-1-yl)(cyclopropyl)methanone:

[0069]

[0070] Example 5

[0071] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by 1-methylpiperazine in an equal molar ratio, and the product yield is 13%. The structural characterization data of the product are: 1 HNMR(400MHz,Methanol-d4)δ7.42(dd,J=6.0,3.2Hz,2H),7.13(dd,J=5.9,3.2Hz,2H),6.31(s,1 H),3.75(t,J=5.0Hz,4H),2.56(t,J=5.1Hz,4H),2.39(s,3H),2.37(s,3H)._HRMS(ESI,m / z)calcd for C 17 H 22 N7[M+H] + ,324.1931; found 324.1864.

[0072] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N-(4-methyl-6-(4-methylpiperazin-1-yl)pyrimidin-2-yl)-1H-benzo[d]imidazol-2-amine:

[0073]

[0074] Example 6

[0075] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by N,N-dimethyl-1,3-propylenediamine in an equal molar ratio, and the product yield is 19%. The structural characterization data of the product are: 1 H NMR(400MHz,Methanol-d4)δ7.45–7.38(m,2H),7.16–7.07(m,2H),6.00(s,1H),3.41(s,2H) ),2.54–2.46(m,2H),2.31(s,6H),2.31(s,3H),1.85(p,J=7.0Hz,2H).HRMS(ESI,m / z)calcd forC 17 H 24 N7[M+H] + ,326.2088; found 326.2614.

[0076] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 (3-(Dimethylamino)propyl)-6-methylpyrimidine-2,4-diamine:

[0077]

[0078] Example 7

[0079] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by 4-methyl-1-piperazineethylamine in an equal molar ratio, and the product yield is 18%. The structural characterization data of the product are: 1 H NMR (400MHz, Methanol-d4) δ7.42 (dd, J=5.9, 3.2Hz, 2H), 7.13 (dd, J=5.9, 3.2Hz, 2H), 5.99 (s, 1H) ,3.52(s,2H),2.65(s,2H),2.58(d,J=28.2Hz,8H),2.31(s,3H),2.30(s,3H).HRMS(ESI,m / z)calcd for C 19 H 27N8[M+H] + ,367.2353; found 367.7343.

[0080] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-6-methyl-N 4 -(2-(4-methylpiperazin-1-yl)ethyl)pyrimidine-2,4-diamine:

[0081]

[0082] Example 8

[0083] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by 4-pyridinemethylamine in an equal molar ratio, and the product yield is 25%. The structural characterization data of the product are: 1 HNMR(400MHz, Methanol-d4)δ8.55–8.45(m,2H),7.51–7.44(m,2H),7.38(d,J=4.8Hz,2H), 7.13(dd,J=6.0,3.2Hz,2H),6.11(s,1H),4.73(s,2H),2.35(s,3H)._HRMS(ESI,m / z)calcd for C 18 H 18 N7[M+H] + ,332.1618;found332.3468.

[0084] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-6-methyl-N 4 -(Pyridin-4-ylmethyl)pyrimidine-2,4-diamine:

[0085]

[0086] Example 9

[0087] The other steps are the same as in Example 1, except that the N,N-diethylethylenediamine raw material in step (4) is replaced by 1-cyclopropylmethylpiperazine in an equal molar ratio, and the product yield is 8%. The structural characterization data of the product are: 1H NMR(400MHz, Methanol-d4)δ7.46–7.40(m,2H),7.17(dd,J=5.9,3.2Hz,2H),6.35(s,1H),3.83(t,J=5.1Hz,4H),3.36(s,2H), 2.78(t,J=5.0Hz,4H),2.46(dd,J=6.9,2.3Hz,2H),2.40(s,3H),0.66–0.58(m,2H),0.28–0.19(m,2H)._HRMS(ESI,m / z)calcd for C 20 H 26 N7[M+H] + ,364.2244;found364.7627.

[0088] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N-(4-(4-(cyclopropylmethyl)piperazin-1-yl)-6-methylpyrimidin-2-yl)-1H-benzo[d]imidazol-2-amine:

[0089]

[0090] Example 10: Study on the in vitro Pre-miR-21 inhibitory activity of some products of the present invention

[0091] Experimental instruments and materials:

[0092] Shanghai Lingguang Technology Co., Ltd. F98 fluorescence spectrophotometer, cuvette, Pre-miR-21, TO-PRO-1, Na2HPO4, NaCl, ethylenediaminetetraacetic acid (EDTA), HCl, DMSO.

[0093] Among them, Pre-miR-21 was purchased from Shanghai Jierui Bioengineering Co., Ltd., and the sequence is as follows:

[0094] UAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAC CAGUCGAUGGGCUGU

[0095] Experimental methods:

[0096] Before screening, the EC of TO-PRO-1 to Pre-miR-21 was determined 50: Pre-miR-21 was folded in SB1 (screening buffer 1, containing 8mM Na2HPO4, pH 7.0, 185mM NaCl, 0.1mM EDTA), placed at 95°C for 2min, and then quickly cooled in an ice bath for 10min; then BSA was added to a final concentration of 40μg / mL to obtain SB2 (screening buffer 2). Pre-miR-21 was dropped into 100nM TO-PRO-1 prepared in SB2, and the fluorescence intensity was measured after each addition of Pre-miR-21 under the conditions of excitation wavelength of 485nm and emission wavelength of 535nm. The obtained curve was fitted to a single-site binding model. EC 50 The value is: 219±76nM.

[0097] EC binding to TO-PRO-1 50 The corresponding Pre-miR-21 concentration was used for the TO-PRO-1 displacement experiment. Pre-miR-21 was folded as described above. SB2 was first added to the cuvette and its fluorescence intensity was measured; then TO-PRO-1 was added to a final concentration of 100 nM and its fluorescence intensity was measured. BC ; Then add Pre-miR-21 to the cuvette to a final concentration of 220 nM, and measure its fluorescence intensity I NC ; Then, the pre-miR-21 post-transcriptional processing shear inhibitors obtained in Examples 1 to 9 above were added to the cuvettes to a final concentration of 100 μM, and the fluorescence intensity I was measured. The fluorescence intensity was measured using a Shanghai Lingguang Technology Co., Ltd. F98 fluorescence spectrophotometer with an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The fluorescence change was normalized to a percentage response (% displacement rate) according to the following formula:

[0098]

[0099] Where I is the median fluorescence intensity of each sample, I NC is the median fluorescence intensity when no compound is added, I BC The median fluorescence intensity when only SB2 and TO-PRO-1 were added was shown. Each fluorescence intensity was tested 5 times.

[0100] The results of the in vitro TO-PRO-1 replacement experiment of the product of the present invention are as follows Figure 1 As shown, the test results show that the product obtained in Example 6 exhibits a good TO-PRO-1 substitution rate (67%), and the higher TO-PRO-1 substitution rate indicates that the above compound has a potential strong binding effect with Pre-miR-21. In order to further determine the binding affinity of the product obtained in Example 6 with Pre-miR-21, the product obtained in Example 6 was then subjected to an isothermal titration calorimetry experiment.

[0101] Example 11: Study on the In vitro Pre-miR-21 Inhibitory Activity of Some Products of the Present Invention

[0102] Experimental instruments and materials:

[0103] MicroCa PEAQ-ITC isothermal titration calorimeter, calorimeter cell, syringe, Pre-miR-21SB1 (screening buffer 1; 8mM Na2HPO4, pH 7.0, 185mM NaCl, 0.1mM EDTA), Pre-miR-21, the mother liquor of the product obtained in Example 6 with a molar concentration of 80mM, and distilled water.

[0104] Among them, Pre-miR-21 was purchased from Shanghai Jierui Bioengineering Co., Ltd., and the sequence is shown in Example 10.

[0105] Experimental methods:

[0106] In this embodiment, an isothermal titration calorimetry experiment was performed using a MicroCa PEAQ-ITC isothermal titration calorimeter at 25°C. The Pre-miR-21 to be titrated was diluted with Pre-miR-21SB1 to a concentration of 10 μM and then loaded into the sample pool. The concentration of the substance amount of the compound obtained in Example 6 was diluted to 400 μM with Pre-miR-21SB1 to obtain a sample solution, which was loaded into a syringe. Subsequently, the sample solution was added in 30 steps, with 1.2 μL added in each step (due to the long wait before the start of the experiment, the compound in the sample solution at the front end of the syringe was diluted to less than 400 μM, so only 0.4 μL of compound dilution was added in the first step). The MicroCaIPEAQ-ITC analysis software was used to analyze the curve fitting and enzyme kinetic parameters, and the binding affinity of the compound to Pre-miR-21 was indexed by the Kd value, wherein the smaller the Kd value, the stronger the binding affinity of the compound to Pre-miR-21.

[0107] The results of the interaction of the compound obtained by the present invention with Pre-miR 21 in vitro are as follows Figure 2As shown, the test results show that the product obtained in Example 6 of the present invention has good binding affinity with Pre-miR-21, and the Kd value is 12.7 μM. The good binding affinity of the compounds with Pre-miR-21 indicates that they can potentially inhibit the shearing of PremiR-21 post-transcriptional processing, thereby silencing, modifying and / or improving the expression of miR-21, and ultimately inhibiting the growth of human breast cancer cells MDA-MB-231 in vivo. In order to further determine whether the compounds with high binding affinity to Pre-miR-21 can interfere with the shearing of Pre-miR-21 post-transcriptional processing, thereby downregulating the expression level of miR-21, qPCR experiments were performed on the above compounds.

[0108] Example 12: Study on the splicing inhibition activity of post-transcriptional processing of Pre-miR-21 of some products of the present invention

[0109] Experimental materials: MDA-MB-231 cells, mother solution of the compound obtained in Example 6 with a substance concentration of 10 mM, miR-21Fwd Primer, miR-21Rev Primer, β-actin Fwd Primer, β-actin Rev Primer, DEPC water, etc.

[0110] Among them, the upstream and downstream primers of miR-21 and the upstream and downstream primers of the internal reference gene β-actin were purchased from Shanghai Jierui Bioengineering Co., Ltd., and the sequences are as follows:

[0111] miR-21Fwd Primer: CCAGTGAAGATGTGTTCAGCT

[0112] miR-21Rev Primer:GCACAGCCAGTAGAAGTAGAT

[0113] β-actin Fwd Primer:GCGAGAAGATGACCCAGATC

[0114] β-actin Rev Primer:GGATAGCACAGCCTGGATAG

[0115] Experimental methods:

[0116] MDA-MB-231 breast cancer cells were inoculated in 6-well plates, with a cell number of about 500,000. After culturing in DMEM containing 10% FBS for 24 hours, the mother solution of the compound obtained in Example 6 with a substance concentration of 10 mM was added to make the final concentrations 0, 2, and 4 μM, respectively. After culturing for 72 hours, the total RNA in the cells was extracted using an RNA extraction kit, and reverse transcription was performed using AMV reverse transcriptase to obtain cDNA. qPCR was used to detect miR-21 expression. Specific method of qPCR:

[0117] 1. Prepare primers (target gene primers include upstream primer miR-21Fwd Primer and downstream primer miR-21Rev Primer, and internal reference gene primers include upstream primer β-actin Fwd Primer and downstream primer β-actin Rev Primer): use DNA stabilizer (DNA buffer or DEPC water) to prepare 100 μM storage solution, vortex to mix, and store at -20℃;

[0118] 2. Use DNA buffer to dilute the upstream and downstream primers to 5 μM (working solution).

[0119] 3. The volume of each well of qPCR is 10 μL, including: 5 μL enzyme and other reagent kit liquid, 1 μL primer (including 0.5 μL upstream primer + 0.5 μL downstream primer), 2 μL cDNA, 2 μL DEPC water

[0120] 4. Prepare the solution. The universal solution can be prepared at one time:

[0121] Use a 200 μL ep tube to prepare a mix solution: DEPC water + primer + enzyme and other reagent kit solutions, vortex, centrifuge, and then place on an ice box;

[0122] 5. Design and preparation of cDNA concentration:

[0123] This time, the concentration of 50ng / well was selected for the experiment. Since the volume of cDNA in 10μL is 2μL, it is necessary to use DEPC water to prepare a concentration of 50ng÷2μL=25ng / μL. For example, the concentration of the cDNA master solution after reverse transcription is 1000ng / 10μL, that is, 100ng / μL, so it needs to be diluted four times, that is, 30μL DEPC water + 10μL cDNA master solution. Vortex to ensure mixing, centrifuge, and then place on an ice box for sample loading;

[0124] 6. Add cDNA and mix solution to the qPCR plate. After adding samples, centrifuge at 2200 rpm for 1 min, transfer to the ice box and put it on the qPCR machine;

[0125] 7. After the reaction procedure is completed, the Ct value of each sample is obtained. The Ct value of the blank control group is used as the control, and the average Ct value of the blank control group is calculated. The Ct value of the fluorescence quantitative results of other experimental groups minus the Ct value of the blank control group is ΔCt. The ΔCt of the blank control group is used as the correction number to calculate the 2-ΔΔCt value, and the 2-ΔΔCt value is used as the relative expression amount of miR-21.

[0126] The results of the effects of some products of the present invention on the expression of miR-21 are as follows Figure 3 As shown, the test results show that the product obtained in Example 6 of the present invention can downregulate the expression of miR-21. The results of the in vitro activity study of the above-mentioned compounds binding to Pre-miR-21 show that the product obtained in Example 6 can bind to Pre-miR-21, thereby affecting the shearing of Pre-miR-21 post-transcriptional processing, thereby downregulating the expression of miR-21. In order to further determine whether the compound can induce tumor cell apoptosis by downregulating the expression of miR-21, the compounds obtained in Example 6 above were subjected to CCK8 experiments to determine their inhibitory activity on MDA-MB-231 human breast cancer cells.

[0127] Example 13: Study on the inhibitory activity of some products of the present invention on MDA-MB-231 human breast cancer cells

[0128] Experimental Materials:

[0129] MDA-MB-231 cells, 96-well cell culture plates, CO2 incubator, pipette, microplate reader, CCK-8 kit, etc.

[0130] Experimental methods:

[0131] 1. Preparation of single cell suspension and counting

[0132] For MDA-MB-231 cells growing in suspension, first directly centrifuge to collect cells in the logarithmic growth phase. For cells growing on the wall, trypsin is used to digest them first, and then centrifuge to collect the cells. Subsequently, the collected cells are resuspended in serum-containing culture medium and counted using a hemocytometer. Finally, the cells are diluted to a concentration of 5,000 to 50,000 cells per ml to prepare a single cell suspension.

[0133] 2. Cell seeding

[0134] First, the single cell suspension needs to be evenly inoculated into each well of a 96-well cell culture plate, and 100 μL of the single cell suspension is added to each well. Six replicate wells are set for each concentration group.

[0135] 3. Dosing and incubation

[0136] First, the 96-well cell culture plate was placed in an incubator for pre-culture for about 12 hours (at 37°C, 5% carbon dioxide). Once the cells successfully attached and showed good adhesion, the culture medium was aspirated, and then the compound obtained in Example 6 was added to each well of the culture plate with a final concentration of 40μM, 20μM, 10μM, 5μM, 2.5μM, 1.25μM, 0.625μM, 0.3125μM, 0.15625μM, and 0μM, respectively, and then returned to the incubator for incubation for 72 hours.

[0137] IV. CCK8 Incubation

[0138] First, add 10 μL of CCK-8 solution to each well. After adding the reagent, gently shake the culture plate to ensure thorough mixing. Next, place the treated culture plate in the incubator and incubate for 1.5 hours.

[0139] 5. Determine the absorbance OD value

[0140] The absorbance value (OD value) at a wavelength of 450nm was measured using an enzyme reader. The survival rate of MDA-MB-231 breast cancer cells or the inhibition rate of the compound on the growth of MDA-MB-231 breast cancer cells was calculated. The drug concentration (IC 50 Value). Survival rate (%) = OD of drug-treated well / OD of control well × 100%. Inhibition rate (%) = (OD of control well-OD of drug-treated well) / OD of control well × 100%. The experiment was repeated three times or more, and the average value and standard deviation were calculated.

[0141] The test results show that the compounds of the present invention have a certain inhibitory effect on the proliferation and growth of MDA-MB-231 breast cancer cells (Table 1). The compound obtained in Example 6 shows an excellent inhibitory effect on MDA-MB-231 breast cancer cells. 50 2.00 μM respectively.

[0142] Table 1 Antitumor activity test results of some compounds

[0143]

[0144] The synthesis method of the present invention can efficiently and conveniently obtain various benzimidazole compounds. Therefore, the present invention can provide a convenient approach and a rich material basis for the discovery of lead compounds of anti-tumor drugs.

[0145] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A pre-miR-21 post-transcriptional processing splicing inhibitor, characterized in that: The pre-miR-21 post-transcriptional processing splicing inhibitor is a benzimidazole derivative having a structure shown in the following formula I: Wherein, R1 is an amine substituent; R2 is hydrogen or wherein R is hydrogen, alkyl, substituted alkyl, aryl or substituted aryl; R3 is methyl; R4, R5, R6, and R7 are fluorine, chlorine, bromine, alkyl, hydrogen, amino, nitro, methoxy, trifluoromethyl, or amine substituents; R8 is hydrogen, alkyl, substituted alkyl, aryl or substituted aryl.

2. A pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1, characterized in that: R2 is hydrogen or Wherein R is hydrogen, alkyl, or substituted alkyl; R4, R5, R6, and R7 are independently alkyl, hydrogen, amino, nitro, methoxy, trifluoromethyl, or amine substituents; R8 is hydrogen, alkyl or substituted alkyl.

3. A pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1, characterized in that: R2 is hydrogen or Wherein R is hydrogen or alkyl; R4, R5, R6, and R7 are alkyl, hydrogen, methoxy, trifluoromethyl, or amine substituents; R8 is hydrogen or alkyl.

4. A pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1, characterized in that: Said R2 is hydrogen; R4, R5, R6, and R7 are alkyl, hydrogen, or amine substituents; R8 is hydrogen.

5. A pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1, characterized in that: The pre-miR-21 post-transcriptional processing cleavage inhibitor is more preferably a compound having a structure shown in the following formula II, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 (3-(Dimethylamino)propyl)-6-methylpyrimidine-2,4-diamine; 6. The method for preparing the pre-miR-21 post-transcriptional processing splicing inhibitor according to any one of claims 1 to 5, characterized in that Follow these steps: (1) Using substituted o-phenylenediamine as the starting material, a nucleophilic substitution reaction with various amine substituents occurs under alkaline conditions to obtain intermediate 1; (2) intermediate 1 is reacted with dicyandiamide under acidic conditions by reflux to obtain intermediate 2; (3) Intermediate 2 undergoes a cyclization reaction with substituted ethyl acetoacetate under alkaline conditions to obtain intermediate 3; (4) Intermediate 3 undergoes condensation reaction with amine under alkaline conditions to obtain the final product, a splicing inhibitor of post-transcriptional processing of pre-miR-21; The structure of the substituted o-phenylenediamine is shown in Formula III, the structure of the intermediate 1 is shown in Formula IV, the structure of the intermediate 2 is shown in Formula V, and the structure of the intermediate 3 is shown in Formula VI: Among them, R2, R3, R4, R5, R 6、 R 7、 R8 is as defined in any one of claims 1-5.

7. The preparation method according to claim 6, characterized in that: In the step (1), the reaction temperature is 25°C to 160°C, the reaction time is 8h to 24h, the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methyl pyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butanol or isopropanol, and the base used in the alkaline condition is potassium carbonate, sodium carbonate, sodium bicarbonate, cesium carbonate, potassium acetate, triethylamine, diethylamine, N,N-diisopropylethylamine, pyridine or potassium hydroxide; In the step (2), the reaction temperature is 90°C to 160°C, the reaction time is 1h to 6h, and the acid used in the acidic condition is 10% sulfuric acid or 3M hydrochloric acid aqueous solution; In the step (3), the reaction temperature is 100°C to 180°C, the reaction time is 16h to 72h, the base used in the alkaline condition is potassium carbonate, sodium carbonate, sodium bicarbonate, cesium carbonate, potassium acetate, triethylamine, diethylamine, N,N-diisopropylethylamine, pyridine or potassium hydroxide, and the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methylpyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butanol or isopropanol; In the step (4), the reaction temperature is 25°C to 160°C, the reaction time is 6h to 24h, and the condensation agent used in the condensation reaction is O-(7-azabenzotriazole-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate, 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate, ((1H-benzo[d][1,2,3]triazol-1-yl)oxy)tris(dimethylamino)phosphonium hexafluorophosphate The base used under alkaline conditions is pyridine, triethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene, and the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methylpyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butyl alcohol or isopropanol.

8. The preparation method according to claim 7, characterized in that: In the step (1), the reaction temperature is 25°C to 40°C, the reaction time is 10h to 14h, the solvent used in the reaction is N,N-dimethylformamide, and the base used in the alkaline condition is potassium carbonate; In the step (2), the reaction temperature is 100° C. to 120° C., the reaction time is 1 h to 2 h, and the acid used in the acidic condition is 10% sulfuric acid; In the step (3), the reaction temperature is 120°C to 140°C, the reaction time is 24h to 48h, the base used in the alkaline condition is N,N-diisopropylethylamine, and the solvent used in the reaction is N,N-dimethylformamide; In the step (4), the reaction temperature is 25°C to 40°C, the reaction time is 8h to 16h, the condensation agent used in the condensation reaction is (3H-1,2,3-triazolo[4,5-b]pyridine-3-oxy)tri-1-pyrrolidinylphosphonium hexafluorophosphate; the base used under alkaline conditions is 1,8-diazabicyclo[5.4.0]undec-7-ene; and the solvent used in the reaction is N,N-dimethylformamide.

9. Use of the pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1 in the preparation of anti-tumor drugs, characterized in that: The anti-tumor drug is a drug for triple-negative breast cancer.

10. An anti-tumor drug comprising the pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1.

Images