Nanobody targeting extracellular segment of fcepsilon ria protein and use thereof

Abstract

The present application relates to a kind of nanobody anti Fc epsilon RI alpha-A9 targeted to extracellular segment of Fc epsilon RI alpha protein (IgE-Fc high affinity receptor) and its application.The nanobody anti Fc epsilon RI alpha-A9 includes three antigen complement determining regions CDR1, CDR2 and CDR3, and the amino acid sequences of the CDR1, CDR2 and CDR3 are respectively amino acid sequences with more than 80% homology with the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

Description

Technical Field

[0001] This invention relates to the field of biopharmaceutical technology, and in particular to a nanobody that targets the extracellular segment of the FcεRIα protein (IgE-Fc high affinity receptor) and its application. Background Technology

[0002] Allergic reactions, leading to rhinitis, asthma, and even anaphylactic shock, cause significant disruption to many people's lives. IgE proteins play a crucial role in human allergic reactions. In type I hypersensitivity reactions, multiple specific IgE aggregates, cross-linked with allergens, bind to the extracellular domain of the α subunit of the high-affinity receptor FcεRI protein on the surface of mast cells and basophils. This leads to FcεRI protein aggregation, causing phosphorylation of downstream messenger proteases, activating the reaction pathway, and ultimately resulting in degranulation of effector cells. This releases large amounts of enzymes, cytokines, and vasoactive mediators, causing various clinical manifestations of allergic reactions, including airway obstruction and rashes. Therefore, in addition to traditional histamine receptor antagonists and glucocorticoids, antibodies that block the interaction between IgE and the FcεRI receptor can also be used as drugs to treat allergic diseases.

[0003] FcεRIα protein is one of the most abundant proteins in human blood plasma and a multifunctional biomolecule. FcεRI is a transmembrane protein composed of four subunits: α, β, and γ. The extracellular domain of the α subunit, composed of two 85-amino acid immunoglobulin-like domains, is responsible for binding to IgE. Crystal structures of the FcεRIα extracellular domain and the IgE-Fc complex show that the FcεRIα extracellular domain binds to the Cε3-Cε4 domains of IgE-Fc in a 1:1 ratio, locking IgE-Fc in an open conformation and preventing its binding to CD23.

[0004] Currently, only the anti-IgE monoclonal antibody Omalizumab is approved by the FDA for the treatment of asthma and chronic spontaneous urticaria. Omalizumab inhibits degranulation and subsequent allergic reactions by blocking the binding of IgE to FcεRI, thereby reducing FcεRI on the surface of effector cells. However, Omalizumab also has drawbacks such as slow onset of action and incomplete prevention. Theoretically, antibodies that specifically bind to FcεRI can also block the cross-linking formation of IgE and FcεRI, thus inhibiting the reaction. Previous studies at home and abroad have confirmed this. Furthermore, research has shown that anti-FcεRI antibodies can replace specific allergens as a broad-spectrum desensitizing agent. Therefore, the specific FcεRIa nanobody in this invention can be used as a therapeutic drug for the treatment and diagnosis of FcεRIa-related diseases, especially allergic diseases, and also has the potential to serve as a desensitizing drug. Summary of the Invention

[0005] This invention was made in view of the above-mentioned prior art, and its purpose is to provide a nanobody that targets the extracellular domain of the FcεRIα protein and its application.

[0006] In order to solve the problems existing in the prior art, the inventors have conducted in-depth research and provided the following aspects.

[0007] On one hand, the present invention provides a nanobody (VHH) antiFcεRIa-A9 targeting the extracellular domain of FcεRIα protein, which includes three antigen complementarity-determining regions CDR1, CDR2 and CDR3, wherein the amino acid sequences of CDR1, CDR2 and CDR3 are respectively amino acid sequences having more than 80% homology with the amino acid sequences shown by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

[0008] GLTFSSYFM (SEQ ID NO: 1)

[0009] FVAAISWSGGS (SEQ ID NO: 2)

[0010] AAVRAYSTDYYARSEKYSH(SEQ ID NO: 3)

[0011] In some embodiments, preferably, the amino acid sequences of CDR1, CDR2 and CDR3 have at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the amino acid sequences shown by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

[0012] In some embodiments, the homology sequence comprises an amino acid sequence having one or more (preferably 1, 2 or 3) conserved amino acid mutations (preferably substitutions, insertions or deletions) compared to the amino acid sequences shown by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3.

[0013] In some embodiments, the amino acid sequences of CDR1, CDR2 and CDR3 are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0014] In some embodiments, the amino acid sequence of the nanobody antiFcεRIa-A9 is shown in SEQ ID NO: 4.

[0015]

[0016] The bolded underlined parts represent SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0017] In this paper, nanobodies refer to single-domain antibodies that contain only the variable region of the heavy chain, i.e., VHH antibodies.

[0018] On the other hand, the present invention also provides a heavy chain antibody targeting the FcεRIa protein, which has the nanobody antiFcεRIa-A9 and the Fc domain.

[0019] In this article, heavy chain antibody (HcAb) refers to antibodies found in camel family animals that lack light chains. In addition to lacking light chains, HcAb does not have a CH1 region between the variable region and hinge region of its heavy chain, unlike ordinary antibodies.

[0020] In some embodiments, preferably, the Fc domain is a human IgG1 Fc domain, the amino acid sequence of which is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 6.

[0021] IgG1 Fc domain amino acid sequence:

[0022]

[0023] IgG1 Fc domain nucleotide sequence:

[0024]

[0025]

[0026] On the other hand, the present invention also provides a polynucleotide encoding the nanobody antiFcεRIa-A9 or encoding the heavy chain antibody having an Fc domain, wherein the nucleotide sequence encoding the nanobody antiFcεRIa-A9 is shown in SEQ ID NO: 7.

[0027] The nucleotide sequence of antiFcεRIa-A9:

[0028]

[0029] On the other hand, the present invention also provides an expression vector containing the polynucleotide, and a host cell containing the expression vector.

[0030] In some embodiments, preferably, the host cell is a host cell used to express exogenous proteins, such as bacteria, yeast, insect cells, or mammalian cells.

[0031] On the other hand, the present invention also provides a pharmaceutical composition comprising the nanobody antiFcεRIa-A9 or the heavy chain antibody having an Fc domain.

[0032] In some embodiments, preferably, the pharmaceutical composition is in a form suitable for administration by subcutaneous injection, intradermal injection, intravenous injection, intramuscular injection, or intralesional injection.

[0033] On the other hand, the present invention provides the use of nanobody antiFcεRIa-A9 / heavy chain antibody in the preparation of medicaments for the treatment and / or diagnosis of diseases related to FcεRIa.

[0034] In some embodiments, preferably, the disease associated with FcεRIα is an allergic disease.

[0035] On the other hand, the present invention also provides the application of the nanobody antiFcεRIa-A9 or the heavy chain antibody having the Fc domain in the preparation of broad-spectrum desensitizing drugs.

[0036] In some embodiments, preferably, the nanobody antiFcεRIa-A9 / heavy chain antibody further includes a second antibody, the second antibody comprising a detectable label, such as a radioactive isotope, a luminescent substance, a colored substance, an enzyme, or polyethylene glycol.

[0037] The nanobody of this invention is derived from a natural alpaca heavy chain antibody and binds to the extracellular domain of human FcεRIa protein with high affinity. It has the following advantages: 1) Simple structure and small molecular weight, which is conducive to expression and use; 2) Convenient for efficient and large-scale expression in Escherichia coli and various eukaryotic systems; 3) As it has only one binding site, it is a single-domain antibody, which has better permeability, specificity and detection linearity as a diagnostic reagent; 4) It is easy to couple with various fusion proteins or more easily labeled by various markers; 5) It is easier to prepare bifunctional antibodies, which is more conducive to targeted drug development and cellular target-directed delivery; 6) As a drug development, it has low immunogenicity to humans and is less likely to cause immune rejection. Attached Figure Description

[0038] Figure 1 ELISA results for screening monoclonal phages that specifically bind to human FcεRIa protein.

[0039] Figure 2 The figures show the purification and SDS-PAGE analysis results of the heavy chain antibody; Figure A is the elution map of the heavy chain antibody purified using a Protein A column, and Figure B is the SDS-PAGE result of the heavy chain antibody.

[0040] Figure 3The results of ELISA analysis of the binding of nanobodies to FcεRIa; EC5 of nanobodies 50 Value: EC 50 =1.416nM.

[0041] Figure 4 The results of SPR analysis on the binding of nanobodies to FcεRIa are shown; the nanobodies have Ka(1 / Ms) = 1.111E+5, Kd(1 / s) = 2.023E-4, and KD(M) = 1.831E-9. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0043] Example 1: Preparation of antiFcεRIa-A9

[0044] 1) For immunization of alpacas (Vicugna pacos), the initial immunization uses Freund's complete adjuvant (Sigma, F5881), and the subsequent two immunizations use Freund's incomplete adjuvant (Sigma, F5506). Each dose is 200 μg of antigen, mixed at a 1:1 volume ratio with the adjuvant. The first two doses are administered subcutaneously, and the final dose is administered intramuscularly. Alpacas are immunized a total of three times, with a three-week interval between doses.

[0045] 2) At week 11, blood was drawn from the vein and peripheral blood lymphocytes were isolated using Solarbio's Ficoll.

[0046] 3) Total RNA was extracted using the Omega Biotek RNA Extraction Kit, and genomic DNA was removed.

[0047] 4) Use Takara's PrimeScript TM II. First-strand cDNA Synthesis Kit: Reverse transcription of RNA into cDNA.

[0048] 5) Construction of the nanobody phage display library: Using the above cDNA as a template, the coding sequence of the nanobody was obtained by PCR amplification using specific alpaca VHH primers (forward primer: GCTGCACAGCCTGCTATGGCACAGKTGCAGCTCGTGGAGTCTGGGGG (SEQ ID NO: 8); reverse primer: GAGTTTTGTTCGGCTGCTGCTGAGGAGACGGTGACCTGGGTCCCC (SEQ ID NO: 9)). The amplified nanobody sequence was inserted into the NcoI and NotI sites of the phage particle pR2 (MRC Laboratories of Molecular Biology) using Gibson assembly (Yisheng Biotechnology Co., Ltd., 10911ES20). The resulting Gibson assembly product was the initial nanobody phage library, and the product was recovered.

[0049] 6) *E. coli* T1 (MRC Laboratory of Molecular Biology) competent cells were prepared using the 10% glycerol washing method. Activated TG1 cells were cultured in 250 mL of 2×YT medium (formulation 1L: 16 g tryptone (OXOID), 10 g yeast extract (OXOID), 5 g NaCl (Sinopharm Chemical Reagent Co., Ltd.; all inorganic salts used in subsequent examples were from the same source)) until OD500. 600 After centrifuging at 5000g for 15 minutes at approximately 0.6-0.8, wash three times with 250mL, 250mL, and 100mL of pre-cooled 10% glycerol (Sinopharm Chemical Reagent Co., Ltd.), and finally resuspend in 1mL of 10% glycerol and dispense into 500μL tubes.

[0050] 7) Transform *E. coli* TG1 competent cells using a BTX ECM 399 electroporator. The product recovered from Gibson assembly was mixed with 500 μL of TG1 competent cells and transferred to a 0.1 cm electroporation cuvette, followed by electroporation at 2.5 kV. The electroporated product was resuspended in 20 mL of 2× medium and incubated at 37°C and 220 rpm for 1 h. 10 μL of the bacterial culture was diluted to 990 μL of 2×YT, and then another 40 μL of the bacterial culture was diluted to 160 μL of 2×YT. A 100 μL plate was then plated and incubated overnight at 37°C. The next day, the library size was calculated by counting the cells (library size = count × 10⁻⁶). 5Bacteria were plated on five 150 mm 2×YT plates supplemented with 100 μg / ml ampicillin (Zhihong Biotechnology, 1146GR005) and 2% glucose (Sinopharm Chemical Reagent Co., Ltd.) to amplify the phage library, and incubated overnight at 37°C. Next, transformed colonies were scraped from the plates, vortexed thoroughly with a final concentration of 25% glycerol, and flash-frozen in 1 mL aliquots with liquid nitrogen. The aliquots were then stored at -80°C, and the size of the phage library was calculated.

[0051] 8) Amplification of the nanobody phage display library: To amplify the nanobody phage library, 0.2 ml of the frozen library was thawed on ice and diluted in 200 mL of 2×YT medium supplemented with 100 μg / mL ampicillin and 2% glucose, and incubated at 37°C and 220 rpm. Next, 1×10⁻⁶ cells / mL of the phage library were added. 12 PFU-modified KM13 helper phage (MRC Laboratory of Molecular Biology) was added to the culture and incubated at 37°C (water bath) for 45 minutes. The cell pellet was separated by high-speed centrifugation and resuspended in 200 mL of 2×YT medium supplemented with 0.1% glucose, 50 μg / mL kanamycin (Zhihong Biotechnology, 1162GR025), and 100 μg / mL ampicillin. The cells were incubated at 25°C and 220 rpm for 20 hours to amplify the phage library. After centrifugation, polyethylene glycol (PEG) was added to the culture supernatant to precipitate the phage particles. The precipitated phage particles were dissolved in 1×PBS (formulation: 10 mmol / L Na2HPO4; 1.75 mmol / L KH2PO4; 137 mmol / L NaCl; 2.65 mmol / L KCl; pH 7.2-7.6) and stored in 1 mL aliquots at -80°C in the presence of 25% glycerol.

[0052] 9) Screening: The FcεRIa antigen was diluted with PBS to a final concentration of 0.1 mg / ml and coated into one well of a 96-well ELISA plate (Nunc Maxsorp plate), reserving one well for a negative control. After washing three times with 1×PBS, 300 μL of MPBS (1×PBS containing 5% skim milk) was added to each well of the ELISA plate, and the plate was incubated at room temperature for 2 hours to block unbound sites. Next, the plate was washed three times with 1×PBS, and 1×10⁻⁶ saturated PBS containing FcεRIa was added to each well. 11A pfu (diluted in 100 μL MPBS) phage library was added to each well and incubated at room temperature for 1 hour, followed by washing three times with PBST (1×PBS containing 0.1% Tween 20). Phages exhibiting specificity against the FcεRIa nanobody were eluted by incubation at room temperature for 1 hour with trypsin at a final concentration of 0.5 mg / mL. 10 μL of the eluted phage was added to 1 mL of *E. coli* TG1 competent cells and incubated at 37°C (water bath) for 45 minutes for infection. The bacterial culture was then plated on 2×YT supplemented with 100 μg / mL ampicillin and 2% glucose and incubated overnight at 37°C.

[0053] 10) Preparation of monoclonal phages: After one round of panning, 48 individual colonies were picked into a 96-well round-bottom culture dish containing 100 μL of 2×YT medium supplemented with 100 μg / mL ampicillin and 2% glucose (w / v). The culture was incubated at 37°C and 180 rpm for 12 hours. Next, 5 μL of this culture was inoculated into a new 96-well round-bottom culture dish containing 200 μL of 2×YT medium supplemented with 100 μg / mL ampicillin and 2% glucose (w / v). The freshly inoculated plate was incubated at 37°C and 250 rpm for 1.5 hours until the OD260 was approximately 0.5. 50 μL containing 4×10⁻⁶ phages was then inoculated into the phage. 8 PFU KM13 helper phage was added to each well of a plate using 2×YT medium and incubated at 37°C for 45 minutes without shaking for infection. After infection, 150 μL of supernatant was discarded, and the remaining fraction was centrifuged at 3500 g for 15 minutes. The supernatant was discarded again, and the bacterial pellet was resuspended in 200 mL of 2×YT medium supplemented with 100 μg / mL ampicillin, 50 μg / mL kanamycin, and 0.1% glucose (w / v). The pellet was incubated overnight at 25°C and 250 rpm for approximately 14–16 hours. The next day, the culture was centrifuged at 3500 g for 30 minutes, and 150 μL of supernatant was transferred to a new 96-well plate and stored at 4°C for screening of nanobodies.

[0054] 11) Phage ELISA assay: A 96-well round-bottom immunoassay plate was coated with 100 μL LFcεRIα to a final concentration of 0.2 μg / mL using 1×PBS dilution and incubated at 4°C for 16 hours. Next, the plate was washed three times with 1×PBS. The plate was then blocked with MPBS (1×PBS containing 5% skim milk) at room temperature for 2 hours. Afterward, the wells were washed four times with PBS-0.1% Tween 20. Finally, 100 μL of 1× 10⁻⁶ phage ELISA solution was added. 11PFU phage was added to each well and incubated at room temperature for 1 hour. The ELISA plate was then washed 5 times with PBS-0.1% Tween 20. Next, 100 μL of HRP-KM13 (Beijing Yiqiao Shenzhou) diluted 1:8000 with MPBS was added to each well, and the plate was incubated at room temperature for 1 hour. The wells were then washed 4 times with PBS-0.1% Tween 20, and 100 μL of 3,3′,5,5′-tetramethylbenzidine (TMB, Beyotime) was added to each well. The plate was incubated in the dark for 7 minutes for color development, and then 50 μL of 1M H2SO4 was immediately added to stop the reaction. The OD was measured using a microplate reader. 450nm Value, result as Figure 1 As shown.

[0055] 12) OD 450nm Twenty positive clones with a value greater than 1 were selected for sequencing and sequence analysis. Finally, a positive phage nanobody specific to the FcεRIa protein was identified and named antiFcεRIa-A9 (amino acid sequence shown in SEQ ID NO: 4). This nanobody has a specific CDR region that binds to the FcεRIa protein.

[0056] Example 2: Expression and purification of nanobody-Fc fusion protein

[0057] The secretion-guided peptide gene sequence was designed and fused to the N-terminus of the nanobody gene to ensure secretion after expression. Human IgG1 Fc was fused to the C-terminus of the nanobody gene, and the nanobody gene and human IgG1 Fc were recombined. Then, it was cloned into the mammalian expression vector pTT5.

[0058] The construct vector was transfected into HEK293F cells (density approximately 2.5 x 10⁻⁶) using polyethyleneimine (PEI, Yisheng Biotechnology Co., Ltd., 40816ES03). 6 Cells / ml, ATCC, CBP60437), in Freestyle TM Transfected mammalian cells were cultured in 293 expression medium (Yonglian Biotechnology) at 5% CO2, 150 rpm, and 37°C for 4 days. Afterward, the cells were centrifuged at 3000 rpm for 10 minutes to culture for 5 days. The supernatant of the mammalian cell culture was then collected by centrifugation at 2000 rpm for 10 minutes. The nanobody-Fc fusion protein was purified using a protein A column, eluted with 0.1 M acetic acid, and the eluted protein was analyzed by SDS-PAGE electrophoresis. Figure 2 As shown, high-purity nanobody-Fc fusion protein was obtained from the supernatant.

[0059] Example 3: Binding affinity analysis of nanobodies to FcεRIa protein

[0060] Immuno MaxiSorb (Nunc) plates were coated with 2 μg / mL FcεRIa protein and incubated at room temperature for 2 h. After washing the ELISA plates three times with 1×PBS, 240 μL of MPBS was added to each well and incubated at room temperature for 2 h to block unbound sites. Next, the nanobody-Fc was serially diluted with PBST containing 5% milk (starting at 50 nM, three-fold serial dilutions, 12 dilutions). 100 μL was added to each well and incubated at room temperature for 1 h. After 1 h, the ELISA plates were washed three times with 1×PBST, and HRP-anti-human IgG Fc (Beijing Yiqiao Shenzhou) was diluted 1:10000 with PBST containing 5% milk and incubated at room temperature for 1 h. The ELISA plates were then washed three times with 1×PBST, and 100 μL of TMB (Beyotime) was added to each well and reacted at room temperature in the dark for 7 minutes. Finally, 50 μL of 1M H2SO4 was added to terminate the reaction, and the absorbance at 450 nm was measured.

[0061] The results of the ELISA analysis are as follows: Figure 3 As shown, the FcεRIa protein and the nanobody-IgG1 Fc EC 50 The nanobodies prepared at 1.416 nM exhibited high binding affinity to the FcεRIa protein.

[0062] Example 4: Characterizing the affinity between nanobodies and FcεRIa protein using SRP

[0063] Materials: CM5 sensor chip, phosphate buffer with 0.05% Tween 20 (0.05% TPBS), acetate solution pH 5.0, hFcεRIα, antiFcεRIa-A9 nanobody, ethanolamine-HCl blocking agent, 10mM NaOH activation solution, 400mM MgCl2 regeneration solution.

[0064] SPR experiments were performed using a Biacore™ T200 system (GE Healthcare), with 0.05% TPBS used as both sample and run buffers. All analytical temperatures were set to 25°C. FcεRIa was immobilized using an amine coupling kit at pH 5.0.

[0065] FcεRIa was immobilized on the surface of a CM5 chip, and nanobodies were injected as the mobile phase. As the nanobodies flowed through the chip, the antigen specifically bound to the nanobodies, leading to an increase in the chip surface weight, thus allowing intermolecular interactions to be observed. A single-cycle kinetic method was used with seven concentrations (100–1.5625 nM). The bound nanobodies were removed by regenerating the surface with a 120-second injection of regeneration solution (400 mM MgCl2) from the capture kit. A nanobodies + 0.05% TPBS buffer injection + regeneration (blank cycle) was performed for each nanobodies. Data from the response was first subtracted from the reference flow cell, and then the blank cycle data were subtracted as a double reference. This was achieved using Biacore. TM The T200 evaluation software 2.0 selected the Kinetics method to fit the data.

[0066] The results are as follows Figure 4 As shown, the values ​​of antiFcεRIa-A9 are Ka(1 / Ms)=1.111E+5, Kd(1 / s)=2.023E-4, and KD(M)=1.831E-9, indicating that the prepared nanobody has a high binding affinity to FcεRIa.

[0067] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nanobody targeting the extracellular domain of the FcεRIα protein, antiFcεRIa-A9, comprising three antigen complementarity-determining regions CDR1, CDR2, and CDR3, The amino acid sequences of CDR1, CDR2 and CDR3 are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively.

2. The nanobody antiFcεRIa-A9 as described in claim 1, characterized in that, The amino acid sequence of the nanobody antiFcεRIa-A9 is shown in SEQ ID NO:

4.

3. A heavy chain antibody targeting the FcεRIα protein, comprising the nanobody antiFcεRIa-A9 of claim 1 and an Fc domain.

4. The heavy chain antibody as described in claim 3, characterized in that, The Fc domain is the human IgG1 Fc domain.

5. A polynucleotide encoding the nanobody antiFcεRIa-A9 of claim 1 or 2, or encoding the heavy chain antibody of claim 3 or 4.

6. An expression vector comprising the polynucleotide of claim 5.

7. A host cell comprising the expression vector of claim 6.

8. A pharmaceutical composition comprising the nanobody antiFcεRIa-A9 of claim 1 or 2, or the heavy chain antibody of claim 3 or 4.

9. The use of the nanobody antiFcεRIa-A9 according to claim 1 or 2, or the heavy chain antibody according to claim 3 or 4, in the preparation of medicaments for treating and / or diagnosing diseases related to FcεRIa, wherein, The diseases associated with FcεRIα are allergic diseases.

Images